ID: 1015658492

View in Genome Browser
Species Human (GRCh38)
Location 6:135546693-135546715
Sequence ATCCAGCAGGGAATCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015658492_1015658499 2 Left 1015658492 6:135546693-135546715 CCCACCTGGATTCCCTGCTGGAT No data
Right 1015658499 6:135546718-135546740 GCCCTAGAAGGAAGCTTCCTGGG No data
1015658492_1015658497 -10 Left 1015658492 6:135546693-135546715 CCCACCTGGATTCCCTGCTGGAT No data
Right 1015658497 6:135546706-135546728 CCTGCTGGATCAGCCCTAGAAGG No data
1015658492_1015658498 1 Left 1015658492 6:135546693-135546715 CCCACCTGGATTCCCTGCTGGAT No data
Right 1015658498 6:135546717-135546739 AGCCCTAGAAGGAAGCTTCCTGG No data
1015658492_1015658504 29 Left 1015658492 6:135546693-135546715 CCCACCTGGATTCCCTGCTGGAT No data
Right 1015658504 6:135546745-135546767 CTCCCACTTCTGCTTAAGTGTGG No data
1015658492_1015658501 3 Left 1015658492 6:135546693-135546715 CCCACCTGGATTCCCTGCTGGAT No data
Right 1015658501 6:135546719-135546741 CCCTAGAAGGAAGCTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015658492 Original CRISPR ATCCAGCAGGGAATCCAGGT GGG (reversed) Intergenic
No off target data available for this crispr