ID: 1015662274

View in Genome Browser
Species Human (GRCh38)
Location 6:135589005-135589027
Sequence ACAACCTGTGAGAACAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015662274_1015662275 6 Left 1015662274 6:135589005-135589027 CCAGGGTTGTTCTCACAGGTTGT No data
Right 1015662275 6:135589034-135589056 CTTGCAGCTTTTCTAGACAGAGG No data
1015662274_1015662276 7 Left 1015662274 6:135589005-135589027 CCAGGGTTGTTCTCACAGGTTGT No data
Right 1015662276 6:135589035-135589057 TTGCAGCTTTTCTAGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015662274 Original CRISPR ACAACCTGTGAGAACAACCC TGG (reversed) Intergenic
No off target data available for this crispr