ID: 1015664640

View in Genome Browser
Species Human (GRCh38)
Location 6:135615351-135615373
Sequence GGTCTAGGACAGCTGAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015664640_1015664646 8 Left 1015664640 6:135615351-135615373 CCCTTGCTCAGCTGTCCTAGACC No data
Right 1015664646 6:135615382-135615404 GAAGCAGACTCCACAGACAGAGG No data
1015664640_1015664648 20 Left 1015664640 6:135615351-135615373 CCCTTGCTCAGCTGTCCTAGACC No data
Right 1015664648 6:135615394-135615416 ACAGACAGAGGTTTATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015664640 Original CRISPR GGTCTAGGACAGCTGAGCAA GGG (reversed) Intergenic
No off target data available for this crispr