ID: 1015665725

View in Genome Browser
Species Human (GRCh38)
Location 6:135626357-135626379
Sequence TCCAGCTGACCCAGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015665723_1015665725 8 Left 1015665723 6:135626326-135626348 CCTTTTGCTAGGCAGAAAAGTTC No data
Right 1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015665725 Original CRISPR TCCAGCTGACCCAGAAGCCC AGG Intergenic
No off target data available for this crispr