ID: 1015673945

View in Genome Browser
Species Human (GRCh38)
Location 6:135723800-135723822
Sequence AATTTCTCTTGGGGGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015673945_1015673953 20 Left 1015673945 6:135723800-135723822 CCTTTGACCCCCCAAGAGAAATT No data
Right 1015673953 6:135723843-135723865 AGAGTTTTCAGTTTCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015673945 Original CRISPR AATTTCTCTTGGGGGGTCAA AGG (reversed) Intergenic
No off target data available for this crispr