ID: 1015680991

View in Genome Browser
Species Human (GRCh38)
Location 6:135808247-135808269
Sequence ACCGAAATCACTCATAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015680991_1015680994 14 Left 1015680991 6:135808247-135808269 CCTTATCTATGAGTGATTTCGGT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1015680994 6:135808284-135808306 GTCCACATTTCTACTTCAGCAGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015680991 Original CRISPR ACCGAAATCACTCATAGATA AGG (reversed) Intergenic
908214000 1:61932301-61932323 ACCGAAACCACTGATCGAAATGG + Intronic
909491521 1:76232220-76232242 AACTACATCAGTCATAGATAGGG - Intronic
916985791 1:170190445-170190467 ACCCCAATCAGTCATAGATTTGG + Intergenic
919960344 1:202461226-202461248 ACCAAAATCACACATATAAAAGG - Intronic
921881152 1:220255791-220255813 ACCCCAATCAGTCATAGATTTGG - Intronic
924412541 1:243820792-243820814 ACCCTAATCAGTCATAGATTTGG - Intronic
1069120670 10:64566091-64566113 ACCCCAATCAATCATAGATTTGG + Intergenic
1072423570 10:95310132-95310154 ACAGAGATCACTCCTATATATGG - Intergenic
1076770822 10:132663577-132663599 ACCAAAATCACTCATTGAGTGGG - Intronic
1079668094 11:23133456-23133478 ACACCAATCACTCATAGATTTGG + Intergenic
1083149033 11:60779585-60779607 ACAGAAATCACTAAAAGACATGG + Intergenic
1087953573 11:104255890-104255912 ACTAAAATTACTTATAGATAAGG + Intergenic
1090521211 11:127481388-127481410 ACAGAAAACACTCAGAGAAAGGG - Intergenic
1093943221 12:25078465-25078487 ACTGAAATCATTCAGACATATGG - Intronic
1094106330 12:26815733-26815755 ACCAAAATAAATAATAGATAAGG + Intronic
1096756090 12:53800885-53800907 AATGAAATGACTCATAGTTATGG + Intergenic
1098047178 12:66411989-66412011 ACCCCAATCAGTCATAGATTTGG - Intronic
1101448658 12:104756448-104756470 ACCTAAATCACTCATAGTCTAGG - Intronic
1107861959 13:44669653-44669675 ACCGAAATCAGTCACAGCAATGG + Intergenic
1108873859 13:55020271-55020293 ACGGAAATAACCCATTGATAAGG - Intergenic
1111152375 13:84272009-84272031 ACAGATATCCCTCATAAATATGG - Intergenic
1126190159 15:45870606-45870628 ACAGAAAACACTCACAGATGTGG + Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1144139026 17:12329235-12329257 ACCAAAATCACAGATAGAGAAGG - Intergenic
1144542716 17:16160156-16160178 ACCTAAACTACTCATAAATAAGG + Intronic
1155392449 18:25350901-25350923 ACCGAGATCCCTCAAAGGTAAGG - Exonic
1157067805 18:44372754-44372776 ATCCAAATCAGTCATAGATTTGG + Intergenic
1158477005 18:57789257-57789279 ATCCAAATGACTCAGAGATAGGG - Intronic
929985701 2:46730156-46730178 AAAGAAATCAATCTTAGATACGG + Intronic
931043293 2:58322252-58322274 CCCCAAATCACTTATTGATAAGG + Intergenic
932850551 2:75180392-75180414 ACTGCAAACACTCATAGAAAAGG - Intronic
936407620 2:112221086-112221108 ACGGAAATGAGTCATAGATTTGG + Intronic
939586722 2:144014841-144014863 TCAGAAATGACTCATAGAAATGG - Intronic
942493126 2:176509972-176509994 ACTGGAATCACTTAGAGATAAGG - Intergenic
943194890 2:184733489-184733511 ACCAAAATCAGACAAAGATAAGG - Intronic
946837409 2:223786208-223786230 AGCGAAAACAATCATAGGTAAGG + Intronic
1174854645 20:54031844-54031866 ACCCCAATCAATCATAGATTTGG - Intronic
1177531706 21:22367956-22367978 ACCAAAATCTCTCATAAAAATGG - Intergenic
955796267 3:62640380-62640402 ACCCAAATTATTCATAGAAATGG - Intronic
956357400 3:68409288-68409310 CACGAAACCACTGATAGATATGG + Intronic
957688961 3:83542580-83542602 GCCAAAAACACACATAGATAGGG - Intergenic
965079722 3:164020852-164020874 ACAGAAATCATCCATAGATTTGG - Intergenic
967625398 3:191677643-191677665 ACCAATATCCCTCATAAATATGG - Intergenic
971970336 4:33611485-33611507 ACTGAAATAACTTATAGATGGGG - Intergenic
972196310 4:36657531-36657553 ACAGAAATCAAACATAGATTTGG - Intergenic
977995366 4:103493675-103493697 TTCGATATCCCTCATAGATAAGG - Intergenic
978008225 4:103645879-103645901 ACCAAGATTACTCCTAGATAGGG + Intronic
983629921 4:169839777-169839799 AACAAAATCACTTATAGATAGGG - Intergenic
985038601 4:185866077-185866099 ACAGAAAACACTCTTAAATATGG - Intronic
986184019 5:5419791-5419813 ACTGAAATGGCTAATAGATATGG - Intergenic
993154195 5:84201292-84201314 ACTGAAAACATTCATAGATAAGG - Intronic
993375795 5:87148415-87148437 ACCCCAATCAGTCATAGATTTGG + Intergenic
994122038 5:96125716-96125738 ACAGAAATACCTCATAGAAAAGG - Intergenic
994414134 5:99446408-99446430 TCCAAAATCACTCAAAGTTAGGG - Intergenic
995496627 5:112751621-112751643 ACAGAAATCATTCATTTATAGGG - Intronic
996139380 5:119887431-119887453 ACAGAATTTACTGATAGATAGGG - Intergenic
997477703 5:134155413-134155435 ACCCAAATAAATCATAGACATGG - Exonic
1004534584 6:16488097-16488119 ACCGAAATTAATCACAGAGAAGG - Intronic
1007068363 6:39015894-39015916 ACAGAAAGCAGTCATGGATAAGG - Intronic
1012595551 6:101034155-101034177 ATTGTAATCACTCATAAATAGGG - Intergenic
1013069392 6:106714966-106714988 AACAAAATCACACATACATACGG - Intergenic
1014904572 6:127010718-127010740 ACAGAAATGTCCCATAGATAAGG + Intergenic
1015675423 6:135741475-135741497 ACCCAAATCAAGCATAGATATGG - Intergenic
1015680991 6:135808247-135808269 ACCGAAATCACTCATAGATAAGG - Intergenic
1016843450 6:148546924-148546946 ACCATAATCCCTCATGGATAGGG - Intronic
1024713223 7:52041868-52041890 TCAGTAATCACTGATAGATAAGG - Intergenic
1026251840 7:68678111-68678133 ACAGAATTCATTCATAAATAGGG + Intergenic
1030309075 7:108050960-108050982 ACAGAAATAACTCAAAGGTAGGG + Intronic
1030800700 7:113847276-113847298 ACCTAAATAATTCATAGAAAGGG - Intergenic
1031326194 7:120401527-120401549 ACCTAAATAGCTCATATATATGG - Intronic
1032314854 7:130827648-130827670 AAAGTAATCACTGATAGATAAGG + Intergenic
1032374698 7:131400542-131400564 ACAGAATTCACTCCTAGAAATGG - Intronic
1033520452 7:142155177-142155199 AGGGAAATCCCTCATAGGTATGG + Intronic
1044303371 8:90610304-90610326 ACCAAAGTCACTCAGAGAAAGGG + Intergenic
1053599527 9:39596157-39596179 ACAGAGATCACCCATAGACAAGG - Intergenic
1053857230 9:42350342-42350364 ACAGAGATCACCCATAGACAAGG - Intergenic
1054253998 9:62746229-62746251 ACAGAGATCACCCATAGACAAGG + Intergenic
1054568059 9:66780393-66780415 ACAGAGATCACCCATAGACAAGG + Intergenic
1058136988 9:101318027-101318049 CCTCAAATAACTCATAGATAAGG + Intronic
1185738985 X:2515270-2515292 ACAGAAATAACTCATAGTTAAGG - Intergenic
1186241460 X:7571470-7571492 ACCCAAGTCACTCACTGATATGG - Intergenic
1186316143 X:8372926-8372948 ACCGGAGTCACTCTAAGATAAGG + Intergenic
1192287559 X:69754695-69754717 ACAGCAATCAGTCATAGATTTGG + Intronic
1192718479 X:73667993-73668015 ACCCCAATCAGTCATAGATTTGG + Intronic
1192755675 X:74045202-74045224 ACCCCAATCAATCATAGATTTGG + Intergenic
1193528222 X:82619868-82619890 ACCCCAATCAGTCATAGATTTGG - Intergenic
1194479720 X:94406012-94406034 GCTGAAATCAATGATAGATACGG + Intergenic
1196526331 X:116731561-116731583 ACCTTTATTACTCATAGATAGGG + Intergenic
1198038833 X:132828548-132828570 TCCGAAATCACTCAAAAATGAGG + Intronic