ID: 1015685252

View in Genome Browser
Species Human (GRCh38)
Location 6:135851695-135851717
Sequence CAGTGCCCAGACCAACTGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015685252_1015685256 12 Left 1015685252 6:135851695-135851717 CCAGTCAGTTGGTCTGGGCACTG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1015685256 6:135851730-135851752 CTCTGTCCCAGCACTTGTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 379
1015685252_1015685255 11 Left 1015685252 6:135851695-135851717 CCAGTCAGTTGGTCTGGGCACTG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1015685255 6:135851729-135851751 GCTCTGTCCCAGCACTTGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 199
1015685252_1015685259 22 Left 1015685252 6:135851695-135851717 CCAGTCAGTTGGTCTGGGCACTG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1015685259 6:135851740-135851762 GCACTTGTCTGGGAGAAAAGTGG 0: 2
1: 0
2: 4
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015685252 Original CRISPR CAGTGCCCAGACCAACTGAC TGG (reversed) Exonic
900297710 1:1960289-1960311 AAGTCCCCAGGCCAACTGCCAGG + Intronic
900485805 1:2922149-2922171 CAGAGCCCAGACAGACGGACGGG - Intergenic
902753302 1:18532530-18532552 CAGTCCCCAGACCAGGTGAGGGG + Intergenic
903079060 1:20794512-20794534 CCGTGCCCAGCCCAAATTACTGG - Intergenic
911813186 1:102310450-102310472 CTGTGCCCAGCCCAACTGATGGG - Intergenic
916436446 1:164782173-164782195 CAGTGCCCAGCCCAGCTCATGGG + Intronic
917505175 1:175620916-175620938 CAGGGGCCAGCCCAACTGGCAGG - Intronic
919822110 1:201480251-201480273 CAGTGGCCAGAGAAACAGACTGG - Intergenic
921225536 1:213015593-213015615 GAGTACCCAGCCCTACTGACCGG + Exonic
1064964849 10:21004770-21004792 CTGGCCCCAGACCCACTGACAGG - Intronic
1066049299 10:31619777-31619799 CACTGCCCAGACCATCCAACTGG - Intergenic
1068813949 10:61288534-61288556 CAGTGTCCAGTTCAACTAACTGG + Intergenic
1069896178 10:71681571-71681593 CAGTGCCCAGAGTAGGTGACTGG + Intronic
1071449994 10:85785068-85785090 CAGGCCCCAGATCAAATGACTGG - Intronic
1071992374 10:91112488-91112510 AAGTTCCCAGACCTACTGATTGG + Intergenic
1072049168 10:91686632-91686654 CAGTAGCCAGAGCAACTGAATGG + Intergenic
1072532486 10:96332482-96332504 CAGTGACCAGTCCAGCTGGCAGG + Exonic
1073327640 10:102651632-102651654 CAGTGCCCAGGACATCTGAAAGG - Intronic
1076212878 10:128664074-128664096 CATTGCCCAGACCAACATAAGGG - Intergenic
1076603218 10:131672955-131672977 CAGCTTCCAGACCAACTGAGGGG - Intergenic
1076746829 10:132518712-132518734 CTGTGCCCGGACCAAATCACAGG - Intergenic
1080190093 11:29534827-29534849 CAGTGCCCATACCTAGTGACAGG + Intergenic
1083666141 11:64275775-64275797 CAGTGCCCAGGCCAAGTGCCTGG - Intronic
1084874942 11:72124277-72124299 CAGTGCCCAGAGCAGCCGGCTGG - Intronic
1086559161 11:88147243-88147265 CAGTGCCCAGAACATTTGTCTGG + Intronic
1089035496 11:115385762-115385784 GACTGCCCAGACCAGCTAACTGG + Intronic
1089730290 11:120514811-120514833 AAGTGCCCAGAAGAACTGAGTGG - Intronic
1090387601 11:126365782-126365804 CTGTGCCCAGTCCCAGTGACAGG - Intronic
1090390167 11:126382980-126383002 CTGTGCCCAGTCCCAGTGACAGG - Intronic
1090427956 11:126623164-126623186 CAGAGCCCAAACCCACTAACAGG + Intronic
1092208540 12:6631618-6631640 CAGTGCCCAGCCCAGCTCAGAGG - Intronic
1092529428 12:9332199-9332221 GAGTGCCCAGGCCAAGAGACGGG - Intergenic
1097813795 12:64049070-64049092 CTTTGCCCAGACCAATTGCCTGG + Intronic
1101801464 12:108025872-108025894 CAGAGCTCAGAGCAACTGCCTGG - Intergenic
1103493483 12:121342284-121342306 CAGTGCCAAGACCATTTGATAGG + Intronic
1104504530 12:129318931-129318953 CAGCTCCCACACCAACTGAAGGG + Intronic
1109685425 13:65813190-65813212 TGGTGCCCAGAGCAACTGACTGG + Intergenic
1111017076 13:82394933-82394955 CTTTGCCCAGACCAACTTCCTGG - Intergenic
1119179946 14:72598898-72598920 CAGTGCCCAGACCGATTGCCTGG - Intergenic
1119972282 14:78984690-78984712 CTGTACCCAGACCTACTGACTGG - Intronic
1122327241 14:100890207-100890229 CAGTGCCCAGAGCCTCTGTCGGG + Intergenic
1122351307 14:101094818-101094840 CAGTCCCCCGACCCACTGAATGG + Intergenic
1122557771 14:102591019-102591041 CCCTGCCCAGGCCAGCTGACAGG + Intergenic
1122742744 14:103881461-103881483 CAGTGCCCAGGCCAACTGGTCGG + Intergenic
1122873924 14:104654365-104654387 CAGCTGCCAGACCAGCTGACTGG - Intergenic
1123144713 14:106117265-106117287 CAGTGCCCAGAGCAGATGAGAGG + Intergenic
1202841998 14_GL000009v2_random:130211-130233 CTGTGCCCAGACCAATTTCCTGG - Intergenic
1202881230 14_KI270722v1_random:62188-62210 CTGTGCCCAGACCAATTTCCTGG + Intergenic
1127412628 15:58724511-58724533 CAGTCTCCAGGCCAAATGACAGG + Intronic
1127857343 15:62963275-62963297 CAGAGCCCAGATTAACTGACTGG - Intergenic
1133737883 16:8629593-8629615 CAGCTCCCAGTCCATCTGACTGG - Intronic
1133931647 16:10237611-10237633 CAGTGCGCAGCCACACTGACAGG + Intergenic
1136153081 16:28364921-28364943 CAGTGCCCACACCAGCCTACAGG + Intergenic
1136210002 16:28750352-28750374 CAGTGCCCACACCAGCCTACAGG - Intergenic
1138118764 16:54381336-54381358 CAGTGCCCATGCCCACTGCCTGG - Intergenic
1138627075 16:58260992-58261014 CAGTGCCCAGACCAAGGAAGGGG + Intronic
1142239081 16:88936937-88936959 CAGTTTCCAGCCCAACTGCCAGG + Intronic
1142694931 17:1628403-1628425 CAGCGCCCAGACCTACGGAACGG + Intronic
1143261124 17:5599053-5599075 TGGTTCCCAGACCCACTGACAGG + Intronic
1144356412 17:14451120-14451142 CAGGGCAGAGACCAAGTGACAGG + Intergenic
1148218855 17:45848803-45848825 CACTGCCCAGGCCACCTCACAGG + Intergenic
1151444324 17:74153339-74153361 CAGGCCCCAGCCCAACTCACAGG + Intergenic
1151778870 17:76228630-76228652 CTGTGCCCAGCCCAAGTGACTGG - Intronic
1154235993 18:12606289-12606311 CAGTGCCTAAAACAACTGTCTGG + Intronic
1154493617 18:14939938-14939960 CAGTGCCCAGAGTAACTGAAAGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1162327081 19:10005867-10005889 CAGTGCCAGGCCCAACTGCCGGG + Exonic
1162522493 19:11190020-11190042 CAGAGCCCCTACCAACAGACTGG - Intronic
1164650844 19:29890330-29890352 CAGGGCCCAGAGCCGCTGACCGG - Intergenic
1164891503 19:31827526-31827548 CAGTGCCCAGGCCAATGGATAGG - Intergenic
1165345862 19:35248613-35248635 CAGGGCCCGAACCAAGTGACTGG - Intronic
1166734700 19:45077113-45077135 CAATGCCCAGGCCCACTGGCTGG - Intergenic
1202656838 1_KI270708v1_random:31294-31316 CTGTGCCCAGACCAATTTCCTGG + Intergenic
925311852 2:2890444-2890466 CAGTGCCCAGCCCCACTGCTGGG + Intergenic
926589833 2:14728813-14728835 CAGTGCCCAGAACAATAGAGTGG - Intergenic
928600727 2:32901227-32901249 CAGTGCCCAGAGAACCTCACAGG + Intergenic
929923997 2:46194429-46194451 CAGTTCACAGACCTAGTGACAGG + Intergenic
935161541 2:100533576-100533598 CACTGGCCAGAGCAAGTGACAGG - Intergenic
935189676 2:100766812-100766834 CAGTGCCCAGTCCTACTGTGAGG - Intergenic
936846622 2:116842387-116842409 CAGTGCCCAGAGCTGCTGGCTGG + Intergenic
939277356 2:140015771-140015793 CTGTGCCCTGTCCAACTGCCTGG + Intergenic
939549262 2:143593253-143593275 CAGTACCTAAACCAGCTGACAGG - Intronic
941851340 2:170185242-170185264 CATTGCCCAGACCAACGTCCTGG + Intronic
1169519628 20:6356852-6356874 CAGGGCCCAGGCTAACTGGCTGG + Intergenic
1175034646 20:55988567-55988589 CAGTGCCCAGTGCAACTGAAAGG - Intergenic
1176630745 21:9135114-9135136 CTGTGCCCAGACCAATTTCCTGG - Intergenic
1177097455 21:16854252-16854274 TAGTGCCAAGAATAACTGACTGG - Intergenic
1178129428 21:29554878-29554900 CAGTGCCCACAGCACCTGGCAGG + Intronic
1181638035 22:24183326-24183348 GAGGGCTCAGACCCACTGACTGG + Intronic
950347653 3:12312596-12312618 CACTGCATAGTCCAACTGACTGG - Intronic
952476556 3:33717180-33717202 CACTACCCAGACCAACAGATAGG - Intronic
953241814 3:41156087-41156109 CAGTGCCCAGACCAGCTGCCGGG - Intergenic
954711645 3:52507888-52507910 CAGAACCCACACCCACTGACTGG + Intronic
954816201 3:53282656-53282678 CAGTTATCAGACCAACTGTCGGG - Intergenic
957097565 3:75790938-75790960 CTGTGCCCAGACCAATTTCCTGG - Intergenic
965158066 3:165089790-165089812 GAGTGCCTAGGCCAACAGACAGG - Intergenic
967489468 3:190073534-190073556 CAGTTCCCAGGCCAAATGACAGG - Intronic
968109409 3:196031772-196031794 CTGTGCCCAGACCAACGTCCTGG - Intronic
968908316 4:3464451-3464473 CCGTGCCCAGACCTCCTGCCTGG + Intronic
969910948 4:10445544-10445566 AAGTGGTCAGACCAACTGTCAGG - Exonic
971386848 4:26148683-26148705 CAGTCTCCAGACAAACTGCCAGG - Intergenic
974538999 4:63208705-63208727 CAAGGCCCAGACCAAATCACTGG + Intergenic
976302473 4:83528369-83528391 CAGTGCCCAGTCCCCCTGAAAGG - Intergenic
977923492 4:102671933-102671955 CAGTGCTCAAACCAAGTAACAGG + Intronic
979494572 4:121369558-121369580 CCGTGCCCAGGCCAACCGAATGG - Intronic
983778843 4:171642979-171643001 AAGTGCCTCGACCAACTGAATGG + Intergenic
985207093 4:187550328-187550350 CAGGACCCAGACCAAATCACTGG - Intergenic
987187373 5:15438378-15438400 AAGTGCCCATCCCAACTGAATGG + Intergenic
989719303 5:44505139-44505161 CAATGCCCAGAAGAACTGAGGGG + Intergenic
990346530 5:54877008-54877030 CAGTGCCTAGAACAAGTGCCTGG + Intergenic
995172471 5:109132811-109132833 CTGAGCCCAAACCAACTGATGGG + Intronic
995957825 5:117800925-117800947 TAGTGCCCAGAGCAATTTACAGG + Intergenic
996050240 5:118924109-118924131 CAGAGGGCAGACCAACAGACAGG + Intronic
999271039 5:150296581-150296603 CAGTACCCAGAGAAACTGGCTGG - Exonic
1001241414 5:170074318-170074340 CAGAGACCAGACCAACAGATAGG - Intronic
1002448265 5:179303130-179303152 ACATGCCCAGAGCAACTGACAGG - Intronic
1008548547 6:52605247-52605269 CAGTGCCCAGACTAGCTGCTGGG + Intergenic
1010114176 6:72282153-72282175 CAGTGCTCAAGGCAACTGACTGG - Intronic
1011300149 6:85865188-85865210 CAATGCCCAGCCCCACTGGCTGG - Intergenic
1013599244 6:111688905-111688927 GACTGCCCAGATCCACTGACTGG + Intronic
1013965212 6:115947501-115947523 CATTGCCCAGAACTAGTGACAGG - Intronic
1015685252 6:135851695-135851717 CAGTGCCCAGACCAACTGACTGG - Exonic
1020759993 7:12257247-12257269 CAGAGCCTAGACCAACTGGGAGG + Intergenic
1023837240 7:44075486-44075508 CACTGCCCAGTTCAGCTGACAGG - Intronic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1024769009 7:52696307-52696329 CTGTGCCCAGACAAACTGCTTGG + Intergenic
1024963853 7:55004804-55004826 CAGCGCCCAGCCCCACTGTCAGG - Intergenic
1027237210 7:76305148-76305170 CAGAGCCCTGGCCAACCGACGGG + Intergenic
1031885257 7:127239838-127239860 CAGTGCCTAGTCCATCTTACAGG - Intronic
1035046823 7:155973283-155973305 CAGGGCCCTGACCACCTCACTGG + Intergenic
1038307125 8:26414841-26414863 CAGAGCCCAGTCCACCTGCCTGG - Intronic
1042873419 8:73418647-73418669 CGTGGCCCAGACCAACTGACTGG - Intergenic
1043666068 8:82815792-82815814 CTTTGCCCAGACCAACGGCCTGG + Intergenic
1046094418 8:109540095-109540117 CAGTACCCAGAGCAGCTGTCGGG - Intronic
1049211947 8:141391033-141391055 CTGTCCCAAGACCACCTGACTGG - Intergenic
1049351038 8:142164950-142164972 CAGTGCCCAGAGGAGCTGATGGG + Intergenic
1049360926 8:142212341-142212363 CAGGGCCCTGACCAGGTGACAGG + Intronic
1049599811 8:143502257-143502279 CAGTGCCCAAACCAGAAGACGGG + Intronic
1052245146 9:26325233-26325255 CAGTCACCAGACCACCAGACAGG - Intergenic
1055017650 9:71635809-71635831 GAGTGCCCTGCCCCACTGACGGG - Intergenic
1057353396 9:94318029-94318051 CAGTCCCCAGAGCATCTGAAGGG + Intergenic
1057654355 9:96939563-96939585 CAGTCCCCAGAGCATCTGAAGGG - Intronic
1058190967 9:101915138-101915160 CAGTGCCCAGAGCTGCTGACTGG - Intergenic
1060872456 9:127053713-127053735 CAGAGCCCAGCCCCACAGACTGG - Intronic
1061101308 9:128494591-128494613 GAGTGCCAAGACCAACTGCAGGG + Exonic
1061272148 9:129549829-129549851 CGGTGCCCACACCACCTGATTGG + Intergenic
1061385431 9:130286753-130286775 CAGTGCCCAGCACCACTGCCTGG - Intronic
1062373882 9:136253463-136253485 GAGTGCCCTGGCCAGCTGACAGG + Intergenic
1062566401 9:137165789-137165811 CAGTGGCCAGACAGACGGACGGG - Intronic
1203753575 Un_GL000218v1:102816-102838 CTGTGCCCAGACCAATTTCCTGG - Intergenic
1187011546 X:15285082-15285104 CAGTGCCCAGAGACACTGACAGG + Intronic
1191965278 X:66750965-66750987 CAGTTCCCACACAAACTGAAGGG + Intergenic
1193685070 X:84567940-84567962 CAAAACCCAGACCAACTGCCTGG + Intergenic
1197265621 X:124367349-124367371 CAGAGCTCATACCACCTGACTGG + Intronic
1197559253 X:127997685-127997707 CATTGCCCAGTCCAATTGCCTGG - Intergenic
1201167218 Y:11220375-11220397 CTGTGCCCAGACCAATTTCCTGG - Intergenic