ID: 1015687320

View in Genome Browser
Species Human (GRCh38)
Location 6:135879510-135879532
Sequence TCTGCAGGACCTACAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015687317_1015687320 0 Left 1015687317 6:135879487-135879509 CCACTTCATTAGCCAAGGCATAC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1015687320 6:135879510-135879532 TCTGCAGGACCTACAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015687320 Original CRISPR TCTGCAGGACCTACAAAAAG TGG Intronic
No off target data available for this crispr