ID: 1015689366

View in Genome Browser
Species Human (GRCh38)
Location 6:135904344-135904366
Sequence CTGATTATACATATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 547}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015689363_1015689366 12 Left 1015689363 6:135904309-135904331 CCTGATGGCAGCTTTCTGCTTGT 0: 1
1: 0
2: 1
3: 9
4: 203
Right 1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG 0: 1
1: 0
2: 5
3: 62
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015689366 Original CRISPR CTGATTATACATATGAAAAA TGG Intronic
901053081 1:6435420-6435442 CTGATTACACAAAAGAAACATGG - Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902481160 1:16712629-16712651 CTGATTACACAAAAGAAACATGG + Intergenic
902784405 1:18723748-18723770 CTGGCTATGCATATTAAAAATGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903134375 1:21299828-21299850 CCCATTTTACAGATGAAAAATGG - Intronic
903451690 1:23457840-23457862 CTGATTAGCCATGTGTAAAATGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904574295 1:31493099-31493121 CTGATTTTTCATCTGTAAAATGG + Intergenic
904764941 1:32838395-32838417 CTGCTAATAGAAATGAAAAACGG - Intronic
904908169 1:33913582-33913604 CTGTTTCCACATCTGAAAAATGG - Intronic
905334851 1:37237681-37237703 CTGCTTTTACATCTGTAAAATGG - Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
906778207 1:48548802-48548824 CTGATTTTTCATCTGCAAAATGG - Intronic
907060270 1:51415477-51415499 CTATTTCTAAATATGAAAAAAGG + Intronic
907132113 1:52106304-52106326 CTGATCCTTCATCTGAAAAATGG - Intergenic
907645322 1:56236582-56236604 CTGTTTCTCCATATGAAAATGGG + Intergenic
909375997 1:74942852-74942874 CTGATGAAACATAATAAAAATGG + Intergenic
909408867 1:75325407-75325429 GTTATTATTTATATGAAAAAAGG + Intronic
909534921 1:76725859-76725881 CTGATTATTGATCTGAAAACAGG - Intergenic
910039201 1:82827739-82827761 CTAATTATACATCTTAAAACAGG - Intergenic
910519219 1:88099271-88099293 CTGTTTCTAGATATGCAAAACGG + Intergenic
910651073 1:89568096-89568118 CTGATTTTACAAATGTAAGACGG - Intronic
910772390 1:90843209-90843231 CTGATTATGTATATGAACACTGG - Intergenic
911471942 1:98329937-98329959 CTGATTATACAGTTTAATAAAGG + Intergenic
911580495 1:99628064-99628086 TTGAGTAGAAATATGAAAAAAGG + Intergenic
911930434 1:103895933-103895955 CTTATTATGCATGTGAAAAGTGG + Intergenic
912048073 1:105485695-105485717 CTCTTTATATATATGAAAAGCGG - Intergenic
912158992 1:106957799-106957821 CTGTTTCTTCATCTGAAAAATGG + Intergenic
912453427 1:109782206-109782228 CTAATTTGACAGATGAAAAATGG + Intergenic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915568541 1:156730806-156730828 CTGTTTCTACATCTGTAAAATGG + Intronic
915866558 1:159505850-159505872 CTGAGTATACACTTAAAAAAAGG - Intergenic
915961947 1:160274455-160274477 CTGATTATACATTTGGAAATGGG + Intergenic
916298344 1:163245681-163245703 CTGATTATGCATCTGTAAAATGG + Intronic
916667334 1:166977991-166978013 AAGTTTATACATGTGAAAAATGG + Intronic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917696256 1:177527232-177527254 CTCATTCTACCTCTGAAAAAGGG + Intergenic
918007299 1:180553916-180553938 CTGCTTGTACATAGGAAAAAGGG + Intergenic
918415582 1:184303438-184303460 CTTATTAGACATAACAAAAAAGG - Intergenic
918932710 1:190876302-190876324 CTGCTTCAACATATGAAAAATGG + Intergenic
919555088 1:199042141-199042163 CTAATTATAGATATTGAAAAAGG + Intergenic
919711257 1:200731623-200731645 CTAATTTTATACATGAAAAATGG - Intergenic
920224894 1:204431371-204431393 TTGCTTATCCATTTGAAAAATGG + Intronic
920599234 1:207305820-207305842 GTGATTAAACATATTAAACATGG + Intergenic
921178324 1:212612273-212612295 CTGACTTTACATAAGAAGAAGGG + Intronic
921410309 1:214829281-214829303 CTGATTATACAACTTAAAAATGG - Intergenic
921656210 1:217740781-217740803 TTGCTTATTAATATGAAAAAAGG - Intronic
921798307 1:219373173-219373195 CTGAACATACATATGAAAGCAGG + Intergenic
921935986 1:220797563-220797585 CTTATTAAACATTTGAGAAATGG + Intronic
923932484 1:238717870-238717892 TTGATTATTTATAAGAAAAATGG + Intergenic
924658543 1:245995386-245995408 CTGTTTATACACCTGAGAAATGG + Intronic
924895063 1:248328556-248328578 CTGATTATTCCTATTACAAAAGG - Intergenic
1063025083 10:2170212-2170234 CTGATTAGATATATGACATATGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063690703 10:8284452-8284474 CTGATTACAGGGATGAAAAAAGG - Intergenic
1063772256 10:9216956-9216978 CAAATTATACATATAGAAAATGG + Intergenic
1064241844 10:13637438-13637460 GCCATTAAACATATGAAAAAAGG - Intronic
1064599834 10:16982154-16982176 CTGAGTCTACCTCTGAAAAAAGG - Intronic
1064615565 10:17152088-17152110 CTGATTGCTCATCTGAAAAAAGG + Intronic
1064633831 10:17343995-17344017 CAGCTTCTACATCTGAAAAATGG - Intronic
1064708767 10:18100735-18100757 CTGATCATCCATAAGAAACATGG - Intergenic
1065283928 10:24168875-24168897 TTGATGATCCAGATGAAAAATGG - Intronic
1065405758 10:25361879-25361901 CAAATCATATATATGAAAAAGGG - Intronic
1066487103 10:35857051-35857073 TTGATTATTCATAAGGAAAATGG - Intergenic
1068084586 10:52359351-52359373 TTTATTACACATATTAAAAATGG - Intergenic
1068564340 10:58555478-58555500 CTGATTATCAAGATCAAAAAAGG + Intronic
1069368805 10:67722120-67722142 CTGATTTTGTATATGAACAAGGG - Intergenic
1069372994 10:67766808-67766830 CTGTATATGCATATTAAAAATGG - Intergenic
1069946701 10:71991313-71991335 CTAATTAAATATATGAAAAATGG + Intronic
1070010513 10:72469528-72469550 CTGATAAAACATCTGGAAAATGG - Intronic
1070255852 10:74812771-74812793 GCGAATAAACATATGAAAAATGG - Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1072501049 10:96018071-96018093 CTGATTCTTTATATGAAAGATGG + Intronic
1073322941 10:102626611-102626633 CTCATTTTACAGATGACAAAGGG - Intronic
1073501962 10:103947825-103947847 TTCAATATACATCTGAAAAATGG - Intergenic
1073579270 10:104649307-104649329 CTGTTTCTTCATCTGAAAAAAGG + Intronic
1073924151 10:108495392-108495414 CTTGGTATACATATGCAAAATGG + Intergenic
1074888498 10:117714604-117714626 CAGGTTATTCCTATGAAAAATGG - Intergenic
1074974509 10:118569261-118569283 CTGCTAATACATGTGAAAAGAGG + Intergenic
1075540421 10:123308301-123308323 ATGATTAAACATATAAAGAATGG - Intergenic
1075771643 10:124942960-124942982 CTGTTTGCACATATGAAAACTGG + Exonic
1078557779 11:12344416-12344438 CTTCTTTTCCATATGAAAAACGG - Intronic
1078749397 11:14145936-14145958 TTGATTCCATATATGAAAAATGG + Intronic
1079315295 11:19403077-19403099 CTGTTTCTACATCTGAAATATGG + Intronic
1079841842 11:25412385-25412407 CAGTATATACATTTGAAAAAGGG - Intergenic
1080180786 11:29423789-29423811 ATGTGTATACATAGGAAAAAAGG - Intergenic
1080857195 11:36122399-36122421 CAGATTTTCCATCTGAAAAATGG + Intronic
1080877747 11:36292059-36292081 CTGTTTCTCCATATGTAAAATGG - Intergenic
1081076132 11:38676126-38676148 CAGATTATACATCTGAATATTGG - Intergenic
1081174144 11:39905293-39905315 CACATTGTACATATGAAAATAGG + Intergenic
1081364629 11:42219185-42219207 CTGATACTACATATGTACAAAGG + Intergenic
1081370546 11:42295692-42295714 CTGATGAAAGATATAAAAAATGG - Intergenic
1081589080 11:44408408-44408430 CTGATTATAGATGAGAAAATGGG - Intergenic
1081780084 11:45704280-45704302 CTGATTCTTCATTTGAAAAATGG - Intergenic
1082621112 11:55423485-55423507 CCGATTTTGCATATGAAAAGTGG + Intergenic
1083701569 11:64482500-64482522 TTAAATATGCATATGAAAAAGGG - Intergenic
1085174476 11:74474111-74474133 AGGATGATACATATGAAAAAGGG - Intergenic
1085757073 11:79210660-79210682 CTGCTTATCCATCTGAAAATGGG + Intronic
1086270811 11:85064534-85064556 CTAATTATACATTTTCAAAAGGG + Intronic
1086470436 11:87103603-87103625 CAAATTATACATCTGATAAAGGG - Intronic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087406526 11:97737880-97737902 CTCATTACACACATGAAAAATGG - Intergenic
1087844452 11:102956502-102956524 CAGATTATTCATATGTAAAATGG - Intergenic
1088637060 11:111832233-111832255 ATGATTTTACATATGTTAAATGG - Intronic
1089098781 11:115942324-115942346 CAGATTCTACAGATGAGAAAAGG + Intergenic
1089362077 11:117897609-117897631 CTGTTTCTTCATATGTAAAATGG - Intergenic
1089365911 11:117920913-117920935 CTGATTCCACATGTGTAAAATGG + Intronic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090478578 11:127047345-127047367 TTGAATATACTTATGAAAAGGGG - Intergenic
1093145843 12:15566228-15566250 ATAATTCTACATATGAAAAGTGG + Intronic
1093264486 12:16985987-16986009 CTGTTTATAGATCTGTAAAATGG + Intergenic
1093316661 12:17659792-17659814 CTGTTTTTTTATATGAAAAATGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093671247 12:21878645-21878667 CTGATAATAGATGTGAAAACAGG + Intronic
1094755065 12:33458865-33458887 CTGATTCTACAGAAGTAAAAAGG + Intergenic
1095330008 12:40949058-40949080 TTTATTAAACATATCAAAAAAGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096612633 12:52813171-52813193 CTGATTTTGCAAATGAAAAAGGG - Intronic
1096808696 12:54156191-54156213 CTATTTATTGATATGAAAAATGG - Intergenic
1097139480 12:56888021-56888043 CTCATTATACATTTAAAAATTGG - Intergenic
1097420401 12:59371553-59371575 TTTATTGTACATATCAAAAAGGG + Intergenic
1097468832 12:59962621-59962643 CTGATTAGACATCAGATAAAGGG + Intergenic
1097682563 12:62662583-62662605 CTGATTGTTCATATGTAAAATGG - Intronic
1097780683 12:63700385-63700407 CTTATTTTACAGATGAGAAAAGG - Intergenic
1098089303 12:66883856-66883878 CTGTTTTTACATCTGCAAAATGG + Intergenic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1098297366 12:69017562-69017584 CTGCTTATAAATAGAAAAAATGG + Intergenic
1098579452 12:72081805-72081827 CTGAAAATATATGTGAAAAATGG - Intronic
1098690067 12:73475982-73476004 CACACTATATATATGAAAAAAGG - Intergenic
1098692931 12:73511928-73511950 CTAATTATATATCTGATAAAGGG + Intergenic
1098753973 12:74334222-74334244 ATTATTTTACATATGAAAAATGG + Intergenic
1098907576 12:76177979-76178001 GTGTTTATAAATATGAAAAGAGG + Intergenic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099542582 12:83931370-83931392 TTAATTTTACATATGAAAGAAGG + Intergenic
1099782747 12:87219893-87219915 CTTATTTTATAAATGAAAAACGG + Intergenic
1099783139 12:87226096-87226118 CTGATGGTAGAAATGAAAAATGG + Intergenic
1099838758 12:87939641-87939663 CTGTTTTTGCATATGAAAAATGG + Intergenic
1100040814 12:90314691-90314713 CTGTGGATGCATATGAAAAATGG + Intergenic
1100142709 12:91637877-91637899 CATATTATATAGATGAAAAACGG - Intergenic
1100238661 12:92686940-92686962 CTGGTTTTACATCTGCAAAATGG - Intergenic
1100513342 12:95299666-95299688 CTGATAATACATCAGATAAAAGG - Intronic
1100541194 12:95559125-95559147 TTGATAATACAGAAGAAAAAAGG - Intergenic
1100586834 12:95988248-95988270 ATGATTAAAAATATGAAAATGGG + Intronic
1100673294 12:96839456-96839478 CTGAGTATACTCATGAAAGAGGG + Intronic
1100743893 12:97624546-97624568 CTGTTTATACATCTGTGAAATGG - Intergenic
1101391336 12:104303262-104303284 CTCATTATACAAATGTAAATCGG - Intronic
1102563928 12:113782382-113782404 CTTTTTATACACATGAGAAATGG + Intergenic
1102862933 12:116352074-116352096 CAGTTTTTACATCTGAAAAATGG + Intergenic
1103673818 12:122640187-122640209 CTCATTATACATAAGAAAAATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1105051988 12:133062630-133062652 CTATGTATACATGTGAAAAATGG - Exonic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106951808 13:34892776-34892798 GTGATTACACATATAACAAATGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1108496744 13:51033133-51033155 CTGATTCCTTATATGAAAAATGG + Intergenic
1108823692 13:54385709-54385731 CTGACTATATATATAAAATATGG + Intergenic
1108874028 13:55023611-55023633 CTGTTTATACTAATGATAAATGG + Intergenic
1109408206 13:61928286-61928308 CTAAGCATACAAATGAAAAATGG - Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109601517 13:64636211-64636233 TTGAATATACATTTAAAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109722636 13:66295260-66295282 CTTATTATACATCTGAAAATTGG + Intergenic
1109986201 13:69988865-69988887 CAAATTATACATCTGACAAAAGG - Intronic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1110212630 13:72991402-72991424 CTGATTATACAACTGAAACTTGG - Intronic
1110374244 13:74774589-74774611 CATATTTTACATATGAAAAGAGG - Intergenic
1110631721 13:77715535-77715557 CTGGTTATGAAAATGAAAAATGG - Intronic
1111469191 13:88655175-88655197 TTGATGATACATAACAAAAAAGG - Intergenic
1111637043 13:90919222-90919244 CTGATTATACAGAGGTCAAACGG - Intergenic
1112640259 13:101265710-101265732 CTGTTTCTCCATATGTAAAAGGG - Intronic
1112925631 13:104671155-104671177 GTGATTATGAATAAGAAAAATGG - Intergenic
1113542470 13:111119703-111119725 CTGATGTTGCATAGGAAAAAAGG + Intronic
1113831758 13:113301109-113301131 CTGAGTACATATATGAAGAAAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114880579 14:26780506-26780528 CTGATTTTGCAGATGAAAGAAGG - Intergenic
1114939118 14:27584321-27584343 CTCATTAGAGATATGGAAAAGGG - Intergenic
1115374375 14:32657153-32657175 CTGATTTGACATAGGGAAAAAGG + Intronic
1115591047 14:34865271-34865293 ATGGTTATACATATGCAAAAGGG + Intronic
1115951425 14:38726806-38726828 GTGATTATACATTAGAAATATGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116568556 14:46485110-46485132 TTGATTATACCTATTCAAAAGGG + Intergenic
1117075596 14:52100405-52100427 CTGATTTTACATATTCAAAATGG - Intergenic
1117127217 14:52642050-52642072 CTGATAAGACATATGTAAAGAGG + Exonic
1118191204 14:63582244-63582266 CTGGTTCTACATTTTAAAAATGG + Intergenic
1118235457 14:63999850-63999872 TTGCTTATTCAGATGAAAAATGG - Intronic
1118617882 14:67587457-67587479 GTCATTATTCTTATGAAAAAAGG - Exonic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120253215 14:82085737-82085759 GTGATCATAAATATGAGAAAAGG + Intergenic
1121607681 14:95253260-95253282 CGGTTTATACATCTGTAAAATGG + Intronic
1121689679 14:95868187-95868209 CTGCTTTTTCATCTGAAAAATGG + Intergenic
1121733247 14:96201164-96201186 CTGATTCTCCATCTGTAAAATGG + Intergenic
1122389190 14:101368724-101368746 TTAATTATACGTAAGAAAAATGG + Intergenic
1124084079 15:26530600-26530622 CTGAGTATCTATATTAAAAAGGG + Intergenic
1124743811 15:32321414-32321436 CTGATTAAAAGTATAAAAAATGG - Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1126606510 15:50482765-50482787 CCATTTATACATATGTAAAAAGG - Intronic
1126790224 15:52214254-52214276 CTGATCCTACATATGTAACAGGG + Intronic
1127316891 15:57804919-57804941 CAGATTATACATAAACAAAAAGG - Intergenic
1128210383 15:65895794-65895816 CTTTTTATGCATAGGAAAAAAGG + Exonic
1129290441 15:74562841-74562863 CTAATTTTACATATGAATCATGG + Intronic
1129553419 15:76478290-76478312 CTCATTATAAATATGACAAATGG + Intronic
1129824484 15:78625600-78625622 CTGGTTATACATAGGAGATAGGG + Intronic
1132266805 15:100481138-100481160 CTGATTCTACATTTACAAAATGG - Intronic
1134813994 16:17190932-17190954 CAGTTTATTCATCTGAAAAATGG + Intronic
1134879094 16:17728617-17728639 CTGTGTATACACATGAAAGAGGG + Intergenic
1135091723 16:19522996-19523018 CTGTTTTTGCATATGTAAAATGG - Intergenic
1137043871 16:35638835-35638857 CTGAGAAGACATAAGAAAAATGG + Intergenic
1137486594 16:48896236-48896258 CTGATTCTCCATATGTAAAATGG - Intergenic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1138705430 16:58910441-58910463 CAGTTTATCCATCTGAAAAATGG + Intergenic
1138934665 16:61704332-61704354 CTCAATAAACATATGACAAATGG - Intronic
1139029254 16:62859555-62859577 CCCATTATACAAATGCAAAATGG + Intergenic
1139289949 16:65848889-65848911 ATGAGTATAAATATGAAAAAAGG - Intergenic
1140070669 16:71647098-71647120 CTGATGAAACAAATTAAAAATGG + Exonic
1141911850 16:87065701-87065723 CCGGTTAGACTTATGAAAAATGG + Intergenic
1144288603 17:13804150-13804172 ATAATTATACATATAAAAAAGGG + Intergenic
1145118493 17:20234028-20234050 CAGAATATACATAAGAAACATGG - Intronic
1145305283 17:21670783-21670805 CTGATTATAAATAAGACAATAGG + Intergenic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146601332 17:34219410-34219432 CTGTTTCTTCATCTGAAAAATGG + Intergenic
1146931587 17:36782043-36782065 CAGATTCTTCAGATGAAAAATGG - Intergenic
1147045532 17:37749040-37749062 CTGATTCTACCTTTGAAAAATGG + Intergenic
1147943557 17:44066953-44066975 CTGATTCCTCATATGCAAAATGG - Intronic
1148397487 17:47321564-47321586 CTAATTATACATCTGACAAGAGG + Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149027321 17:52042503-52042525 CAAATTATACATCTGATAAATGG - Intronic
1149535245 17:57428625-57428647 CTCATTCTAAATATGAAAACAGG - Intronic
1149807851 17:59636323-59636345 TTGATTGTAAATATGGAAAATGG - Intronic
1149880840 17:60288468-60288490 CCAATTATATATATAAAAAAAGG + Intronic
1149960312 17:61101890-61101912 CTGTTTATCCATCTGCAAAACGG + Intronic
1150016629 17:61563995-61564017 CTTATTTTAAAGATGAAAAAAGG + Intergenic
1150169366 17:62976540-62976562 CTGATTATACCACAGAAAAAGGG - Intergenic
1150553180 17:66229833-66229855 GTAATTATACATCTGAAAACTGG - Intronic
1150812567 17:68368248-68368270 CTGATTCTTCATCTGAAAAACGG + Intronic
1150867877 17:68873452-68873474 CAAATTATATATATGACAAAGGG - Intronic
1153138442 18:1944215-1944237 CTGATATTACCTATGATAAATGG - Intergenic
1153690440 18:7587301-7587323 CTATTTATAAAAATGAAAAATGG - Intronic
1155376671 18:25165777-25165799 CTCATTAACCATATGGAAAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155946712 18:31861250-31861272 CTTATTCTACATAACAAAAATGG - Intronic
1156656543 18:39295208-39295230 CTGATAATACCTATTGAAAAAGG - Intergenic
1156885114 18:42126311-42126333 CTCATTTTACATATGGAAACAGG + Intergenic
1156888937 18:42167559-42167581 GTGATGGTACATATAAAAAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157902186 18:51529157-51529179 CTGATTTTTTATATGAGAAAGGG - Intergenic
1157921518 18:51717872-51717894 TTGATTTCACATATGATAAAAGG + Intergenic
1158055391 18:53273376-53273398 ATGATTATATATATTAATAATGG + Intronic
1158580734 18:58680239-58680261 GTGTGTATTCATATGAAAAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159401497 18:67942356-67942378 CAGATTATACCTATGTTAAAAGG - Intergenic
1159409320 18:68050954-68050976 GTGATTATATATATAAAATATGG - Intergenic
1159569685 18:70098609-70098631 TTAATTATAAATATTAAAAAAGG - Intronic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1162837489 19:13330460-13330482 CAGTTTACACATCTGAAAAATGG - Intronic
1163306851 19:16485617-16485639 CTGATTATATGTAAGAAGAATGG - Intronic
1165995033 19:39837984-39838006 CAGTTTATTCATGTGAAAAATGG - Intronic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1167803879 19:51765716-51765738 CTGAGTATATCTATGACAAATGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
1168566390 19:57427739-57427761 CTAATAATACCTCTGAAAAAAGG - Intronic
1202715195 1_KI270714v1_random:38533-38555 CTGATTACACAAAAGAAACATGG + Intergenic
925080669 2:1061985-1062007 CAAATTATACATCAGAAAAATGG + Intronic
925248447 2:2407286-2407308 CAGTTTCTCCATATGAAAAATGG - Intergenic
925742011 2:7014002-7014024 CAGTTTTCACATATGAAAAATGG + Intronic
925920098 2:8632471-8632493 CTGATTACAAATATGACACATGG - Intergenic
926766392 2:16326006-16326028 CTCATTTTACAGATGAAAAGTGG + Intergenic
927526276 2:23743923-23743945 ATGATTATACATAAAAAAACAGG + Intergenic
928165278 2:28966854-28966876 GTCATAATACACATGAAAAATGG - Intronic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
929678005 2:43957085-43957107 CTGAACATACATATGCAAATTGG + Intronic
930298047 2:49579608-49579630 CTTACTATACTTTTGAAAAAAGG + Intergenic
930653123 2:53982151-53982173 CTATTTATACATATAAAAACTGG - Intronic
930998153 2:57747853-57747875 TTGATAATACAGATGAATAATGG - Intergenic
932200873 2:69827564-69827586 CTGAATTTACATCTGAAGAAGGG - Intergenic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933343362 2:81050566-81050588 CTGAATATCAATATTAAAAATGG + Intergenic
933629514 2:84639862-84639884 CAGATTATAAATAGAAAAAAGGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936474129 2:112824754-112824776 ATGCTTATACAAATGAGAAAAGG + Intergenic
936493828 2:112999847-112999869 CTGCTTTTACATATGAAGATAGG - Intergenic
936799892 2:116254196-116254218 CTGATGACAAAAATGAAAAAGGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938004014 2:127772591-127772613 TTCATTATAGATATGAAATAAGG - Intronic
938872875 2:135499464-135499486 CAGAGTATACATATGACAAAAGG + Intronic
939036268 2:137134821-137134843 CCTATTCTACATCTGAAAAAGGG - Intronic
939806622 2:146781638-146781660 TTTATTATACATATTATAAAGGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940263021 2:151804088-151804110 CTCATGATATAAATGAAAAATGG + Intronic
941045839 2:160675059-160675081 CTCATTATATTTATGAACAATGG + Intergenic
941950803 2:171154376-171154398 CTCATTTTACAGATGAAAAGAGG + Intronic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
943156835 2:184190478-184190500 CTGATAATGCAGATGAATAATGG + Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943850567 2:192716835-192716857 GTGATTAAACATATAATAAAAGG - Intergenic
944165236 2:196711765-196711787 CTAATTATACACATTCAAAAGGG + Intronic
944328762 2:198440438-198440460 TAGATTGGACATATGAAAAATGG + Intronic
944364960 2:198907497-198907519 CTTATTTTACAAATGAGAAATGG - Intergenic
947332944 2:229049211-229049233 CTAATTTGACAGATGAAAAATGG + Intronic
947664896 2:231898703-231898725 CTGATTCTACATACCAAAAATGG - Intergenic
948172177 2:235913100-235913122 CTGATTATAAATAAAAAAGAGGG - Intronic
948490788 2:238311569-238311591 CAAATTATACATCTGATAAAGGG + Intergenic
948958274 2:241312417-241312439 AATATTATACACATGAAAAAAGG + Intronic
1169310610 20:4535540-4535562 CAAATTATACATATAATAAAGGG - Intergenic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1170802536 20:19602314-19602336 CTGATTTTTCATCTGTAAAATGG - Intronic
1171530542 20:25850225-25850247 CTGATTATAAATAAGACAACAGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172489428 20:35323188-35323210 CTGATGAGTCATATGAGAAATGG + Intronic
1172557035 20:35851433-35851455 CTGATTCTACATTTGAAATGTGG + Intronic
1174701523 20:52614042-52614064 CTGGTTATAAATATGCAGAATGG + Intergenic
1175417191 20:58809594-58809616 CTGATTATAAAAATGATACATGG + Intergenic
1175740314 20:61415399-61415421 CTGACTGTACACATAAAAAATGG - Intronic
1176333045 21:5567786-5567808 CAGGCTATACATATGACAAAAGG - Intergenic
1176394712 21:6253166-6253188 CAGGCTATACATATGACAAAAGG + Intergenic
1176442445 21:6735938-6735960 CAGGCTATACATATGACAAAAGG - Intergenic
1176466707 21:7063008-7063030 CAGGCTATACATATGACAAAAGG - Intronic
1176490268 21:7444786-7444808 CAGGCTATACATATGACAAAAGG - Intergenic
1176510374 21:7693597-7693619 CAGGCTATACATATGACAAAAGG + Intergenic
1176638244 21:9269741-9269763 CTGGTTCAACATATGAAAATCGG + Intergenic
1177005817 21:15670837-15670859 CTTATTCTACATATGTCAAACGG + Intergenic
1177259434 21:18711212-18711234 CTGAGTATAAATAAGAAAATAGG + Intergenic
1177512928 21:22113619-22113641 CTGATTATACATAATAAAAAGGG + Intergenic
1177671558 21:24237307-24237329 CTGATTCTACAGATCAATAATGG + Intergenic
1178044133 21:28675274-28675296 ATGATAATAAAAATGAAAAATGG + Intergenic
1179425414 21:41274470-41274492 GTGATTAAATATAGGAAAAATGG + Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180371557 22:12042575-12042597 CTGGTTCAACATATGAAAATCGG + Intergenic
1180422286 22:12877238-12877260 CTGGTTCAACATATGAAAATCGG + Intergenic
1183130223 22:35827321-35827343 CAGGTAATACATAGGAAAAAAGG + Intronic
949204796 3:1425072-1425094 CTGTTTCTACATCTGTAAAATGG - Intergenic
949419713 3:3853018-3853040 CTGAATATCCATATGATAGATGG - Intronic
949546021 3:5073270-5073292 TTGATGATAGCTATGAAAAACGG + Intergenic
951378737 3:21956470-21956492 CTAATTGTAAATATGTAAAAGGG + Intronic
951627237 3:24679193-24679215 CAGATAATAGAGATGAAAAATGG + Intergenic
951706445 3:25548690-25548712 CTGATAACACATATTAAAAAAGG - Intronic
951756809 3:26099739-26099761 ATGATTGTTCATATGTAAAAGGG - Intergenic
952180811 3:30914562-30914584 CTGATTCCTCATCTGAAAAATGG + Intergenic
952591142 3:34955571-34955593 CTGATGATAGAAAGGAAAAATGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956212460 3:66815584-66815606 CTTATTATCCATCTGAAAAATGG - Intergenic
956410895 3:68978256-68978278 CCAATTATTGATATGAAAAATGG - Intronic
956945517 3:74217989-74218011 CTGATTATAAAAATAATAAAAGG - Intergenic
957165601 3:76669081-76669103 ATGTTTAAACATATGAAAACAGG + Intronic
957256907 3:77848733-77848755 CTGAGTATACATTTTTAAAAAGG - Intergenic
957332936 3:78789649-78789671 CAGATTTTACATAAGACAAAAGG - Intronic
957615035 3:82516232-82516254 GAGATTAATCATATGAAAAACGG - Intergenic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
958550789 3:95609280-95609302 TTGAGTAGAAATATGAAAAAAGG - Intergenic
958816685 3:98924282-98924304 CTCATTAGCCATATGACAAATGG - Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960413361 3:117355265-117355287 CTAATTTTAGAAATGAAAAAGGG + Intergenic
960808256 3:121604871-121604893 GTGGTTATACCCATGAAAAATGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
963195239 3:142520310-142520332 CTAAGTATACATATGAAAGGAGG + Intronic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
963543561 3:146626095-146626117 ATTATTATATATAGGAAAAAAGG + Intergenic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
963954597 3:151239835-151239857 CTGTCTATAAATATCAAAAAAGG + Intronic
964141189 3:153401861-153401883 CTGATTAAACATTTGAAAATTGG - Intergenic
964410198 3:156389970-156389992 CTGAAAATATTTATGAAAAAGGG + Intronic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
965243919 3:166241572-166241594 CTAAGCATGCATATGAAAAAGGG + Intergenic
965444291 3:168755487-168755509 CAAATTATACTTATGATAAAAGG - Intergenic
965596557 3:170417019-170417041 CTTATTTTACAAATGAGAAAAGG + Intergenic
965696200 3:171410840-171410862 CTGATTTGACATATAAAATATGG - Intronic
965859085 3:173125270-173125292 TTGATCATACATATGGAAAGAGG - Intronic
965887607 3:173467320-173467342 CACATTATAATTATGAAAAATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
1202748652 3_GL000221v1_random:135280-135302 CTGGTTCAACATATGAAAATCGG - Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
971001260 4:22325261-22325283 CTGTTTATACAAGTGTAAAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971834154 4:31740286-31740308 TTGATTAAACAAAAGAAAAATGG + Intergenic
971925158 4:32999351-32999373 GTGAGTATAAAAATGAAAAAAGG - Intergenic
972557968 4:40199460-40199482 GTGAGAATACATATGAAAGAAGG + Intronic
972615573 4:40694838-40694860 CTGATTTTAAATATAGAAAATGG - Intergenic
973104865 4:46322782-46322804 CTGATGAGACATAAGAAGAAAGG + Intronic
973167968 4:47101378-47101400 TTGATTTTAAATATGAAAAAAGG + Intronic
973168396 4:47107579-47107601 CTGTTTATTCATCTGTAAAATGG + Intronic
973825560 4:54702538-54702560 CTGATAATACATATGCATAGGGG - Intronic
974139290 4:57864090-57864112 CTTGGTATACATATGAAAAAAGG + Intergenic
974684101 4:65201754-65201776 TAGATTATAAAGATGAAAAATGG - Intergenic
974699090 4:65415506-65415528 ATGATTAAACATATTACAAAAGG - Intronic
974819353 4:67046230-67046252 CTGAATATAAATTTTAAAAAGGG - Intergenic
975142315 4:70930603-70930625 CTGATTTTACTAATAAAAAAAGG - Intronic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975282960 4:72584232-72584254 CTTGTTATGCATTTGAAAAAAGG + Intergenic
975324070 4:73040366-73040388 CTTAAGATACATATGAAATATGG - Intergenic
975616209 4:76250321-76250343 GTGAACAAACATATGAAAAAAGG - Intronic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
977259139 4:94777605-94777627 CTCATTTTGCATATCAAAAAAGG - Intronic
977709248 4:100105930-100105952 CTAATTAGGCATATAAAAAATGG + Intergenic
977759432 4:100714411-100714433 TTGATAAGACATATGCAAAAGGG - Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
979041447 4:115802418-115802440 CTGAATATTTGTATGAAAAATGG + Intergenic
979745184 4:124204640-124204662 ATGAATATACATATGAAATCAGG - Intergenic
979792269 4:124799901-124799923 CTGAATATTTATATTAAAAATGG - Intergenic
980221182 4:129918269-129918291 CAGATTTTAGATAGGAAAAAAGG - Intergenic
980389792 4:132128390-132128412 ATGATTATACCAATGAAATAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981705285 4:147652896-147652918 AAGAATATAAATATGAAAAAAGG + Intronic
982116405 4:152102069-152102091 CTGATTCTAAGTTTGAAAAAGGG + Intergenic
983577892 4:169277916-169277938 TTGATTACACATATGAATTAGGG - Intergenic
983616786 4:169715303-169715325 CTGCCTGTTCATATGAAAAAAGG + Intronic
983785640 4:171726653-171726675 CTGAGTATATCTATTAAAAAGGG - Intergenic
984460701 4:180033091-180033113 CTGTTTATATATATGAAGTATGG - Intergenic
984488869 4:180406878-180406900 CTTATTATAGATTTGAAAATAGG - Intergenic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
1202753141 4_GL000008v2_random:28153-28175 CTGGTTCAACATATGAAAATCGG + Intergenic
985507084 5:288468-288490 TAGTTTATACATATGAAAGAAGG - Intronic
988010788 5:25481065-25481087 TTGTGTATACATTTGAAAAATGG + Intergenic
988198253 5:28035935-28035957 CTGATTAAAAAGTTGAAAAATGG - Intergenic
988326538 5:29776005-29776027 CTGAGTCTTCATATGTAAAATGG + Intergenic
988675292 5:33427303-33427325 CAGAATATACATAGGAATAAAGG - Intergenic
989079231 5:37599578-37599600 CTGGTTATCCATATGTAAAAAGG + Intronic
989230450 5:39080438-39080460 TTTATTATACATATTAACAATGG - Intergenic
990024566 5:51169646-51169668 ATGATTTCACATATGAAAACAGG - Intergenic
990392513 5:55340305-55340327 CTGATTAGACTTAGGCAAAATGG + Intronic
990494887 5:56337533-56337555 CTGATTAAAAGTATCAAAAAAGG + Intergenic
990546978 5:56832509-56832531 CTGATTTCTCATATGTAAAATGG - Intronic
990915709 5:60902630-60902652 ATTATTATAAATCTGAAAAATGG - Intronic
991264558 5:64701698-64701720 CAGATGATATAAATGAAAAAGGG + Intronic
993418793 5:87673556-87673578 GTGAAAATAAATATGAAAAAGGG - Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993683697 5:90911893-90911915 CAGATTATACATAGGACATAAGG + Intronic
993802535 5:92360549-92360571 CTTCTTAAACATATGAAACATGG + Intergenic
993909042 5:93658400-93658422 CTGATCATTGATATAAAAAATGG + Intronic
994639749 5:102392495-102392517 ATGATTATACTTATGAATAATGG - Intronic
995789615 5:115871345-115871367 AGAATTATACATATGAACAATGG - Intronic
995880309 5:116837380-116837402 CTGATTAGATATATTAAAATTGG - Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996095390 5:119393032-119393054 CTGATTATTCCTATAAAGAATGG - Exonic
996507321 5:124282480-124282502 CTGATAACACATATGAGAATGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996815257 5:127566956-127566978 CTAATTTTACAGATGAAAATGGG - Intergenic
997326954 5:133029482-133029504 CTGATTCTCCAAATGAAAACAGG + Intergenic
997656405 5:135558005-135558027 CTGGTTACACATGTGAATAAGGG + Intergenic
998885042 5:146685312-146685334 CTGTTTATACATCTCTAAAATGG + Intronic
998990557 5:147810893-147810915 CTTATTTAGCATATGAAAAATGG + Intergenic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
1001583817 5:172819301-172819323 ATGATTCTAAATATGAACAATGG + Intergenic
1002204235 5:177552120-177552142 CTGTTTCTTCATCTGAAAAATGG + Intronic
1003530767 6:6935833-6935855 CTGATTATACATATGTCAGTAGG - Intergenic
1004013670 6:11712734-11712756 CTGATTAAACATTTGCTAAAAGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004701252 6:18081695-18081717 CTGATTTGAAATATGAAAATAGG - Intergenic
1004920883 6:20374499-20374521 CTGTTTCTAAATATGTAAAACGG - Intergenic
1005686170 6:28254946-28254968 CTGATTATAGATATGTAACCCGG + Intergenic
1005796805 6:29371976-29371998 CTGATTAAACATCTAAAAAATGG + Intronic
1006576256 6:35048628-35048650 TTGATTCCACATCTGAAAAAGGG - Intronic
1006724985 6:36192570-36192592 CTGATTGGACATAAGAACAAAGG - Intergenic
1008260522 6:49360584-49360606 TTGATAAAACATGTGAAAAAGGG - Intergenic
1008373749 6:50767628-50767650 TTGATGATACTGATGAAAAAGGG - Intronic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1008685732 6:53924620-53924642 CTGATTATATATAAGCAAATTGG + Intergenic
1008693091 6:54002829-54002851 CTGATTACAGATATGGAGAATGG + Intronic
1008855284 6:56078042-56078064 CTAAATATTCATATAAAAAATGG + Intronic
1009417429 6:63431154-63431176 CTGATTATGAATCTGTAAAATGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009861250 6:69335880-69335902 CTGATTATAAAAAAGAAGAAAGG - Intronic
1010191013 6:73196529-73196551 CTGCTTATATATAAGAATAAGGG - Exonic
1010636269 6:78262112-78262134 CTGCTTTCACATATGAGAAATGG + Intergenic
1010993218 6:82502943-82502965 CAGATTATAAATATGAAGAATGG - Intergenic
1011367203 6:86596015-86596037 GTGAAAATACATATTAAAAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011680773 6:89781180-89781202 TTAATTATAAATCTGAAAAAGGG + Intronic
1012422548 6:99080590-99080612 CAGGCTATTCATATGAAAAAAGG - Intergenic
1012640468 6:101605257-101605279 TTGATTACTCATCTGAAAAATGG + Intronic
1012652056 6:101767032-101767054 TTGACTTTACATATGAAAAGAGG + Intronic
1012666927 6:101982929-101982951 CTGATTCTATATTTGGAAAAAGG + Intronic
1013133056 6:107253726-107253748 CTGATTTTACTTTTGAATAAAGG + Intronic
1013576172 6:111484547-111484569 CAGTTTCTACATATGTAAAACGG + Intergenic
1013815922 6:114097305-114097327 GTGGATATACTTATGAAAAAAGG + Intronic
1014350457 6:120336987-120337009 CAGATTCTACAAATGATAAAAGG + Intergenic
1015124913 6:129743089-129743111 CTGAATATACATTTTAAAATGGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015722550 6:136258730-136258752 CTGATTTTACCTGTGACAAAAGG + Exonic
1015991823 6:138952783-138952805 CTGGATATCCATATGAAATATGG + Intronic
1016263136 6:142198350-142198372 TTCATTATACACATGACAAATGG - Intronic
1016799138 6:148151345-148151367 CTGGTTATCCGTATGAGAAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017285918 6:152676305-152676327 CTATTTATCCATCTGAAAAACGG + Intergenic
1017829317 6:158111330-158111352 CTGAATTCACATATGAAAACTGG + Exonic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018610857 6:165646321-165646343 CTGATTATAAATATGTAAGGTGG + Intronic
1019535220 7:1525728-1525750 CTGCTTGTTCATATGTAAAAGGG - Intergenic
1020461036 7:8430257-8430279 CTTATTATACTTATGAATATCGG - Intergenic
1020594742 7:10191668-10191690 CTCCTTATAAATATGAAATAGGG + Intergenic
1020666825 7:11055051-11055073 CTGATGAAACATAAGAAGAATGG - Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021567605 7:22030434-22030456 CTGATTTTACATTTAAAAATTGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022736528 7:33081360-33081382 CAGATTTTGCATAGGAAAAAGGG - Intergenic
1022939269 7:35216431-35216453 CTTATTTTACAGATGAGAAAAGG - Intronic
1023318341 7:38965458-38965480 ATAATTAAACAAATGAAAAATGG - Intergenic
1025283241 7:57643182-57643204 CTGATTATAAATAAGACAATAGG + Intergenic
1025822839 7:64985991-64986013 CTTATTCTCCACATGAAAAAAGG - Intronic
1026051197 7:66948120-66948142 CTGTTTGTTCATATGTAAAAGGG + Intronic
1026503322 7:70961049-70961071 ATGATAATACATTTTAAAAATGG - Intergenic
1027776887 7:82476407-82476429 CTACTTTTACATATGAAGAAAGG + Intergenic
1027850611 7:83446804-83446826 CTCATTTAACAAATGAAAAAAGG - Intronic
1027949445 7:84795653-84795675 CAAATTTTACATCTGAAAAATGG - Intergenic
1027981962 7:85236045-85236067 CTGAAGTTACATATGAAAATTGG - Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028931695 7:96420146-96420168 CTCATTTTATATATGAAAAATGG - Intergenic
1028944821 7:96565674-96565696 CTAATTTTACTGATGAAAAAAGG + Intronic
1029031284 7:97469904-97469926 ATGATTTTTCATCTGAAAAATGG - Intergenic
1029049688 7:97671797-97671819 CTGATTATATATAGGTAACAGGG - Intergenic
1029992919 7:104978470-104978492 CAGATTCTTCATTTGAAAAATGG - Intergenic
1030113866 7:106048788-106048810 CTTGTTATGCAGATGAAAAAAGG + Intergenic
1030388358 7:108893678-108893700 CTGGATATATATCTGAAAAAGGG + Intergenic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1030895978 7:115060256-115060278 CAGTTTCTACATATGTAAAATGG - Intergenic
1030913582 7:115283968-115283990 CTGATTATAATTATGAAATTAGG - Intergenic
1031647911 7:124249827-124249849 GTGATTATAAATAAGGAAAAGGG + Intergenic
1032065295 7:128764536-128764558 CAAATTATTCATATGAAAGACGG - Intronic
1032189195 7:129753598-129753620 CTGATAATACATTAAAAAAAAGG - Intronic
1033451734 7:141468083-141468105 TGGATTGTACATGTGAAAAATGG - Intronic
1036043071 8:5107919-5107941 CTGCTGATAAATATGAATAAAGG + Intergenic
1037785846 8:21902732-21902754 CTGTTTCCACATGTGAAAAATGG - Intergenic
1037925303 8:22839466-22839488 CTGATTCTCCACATGCAAAATGG + Intronic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1038497687 8:28015359-28015381 ATTATTATTCTTATGAAAAAGGG + Intergenic
1038891445 8:31729095-31729117 CAGATTATACATGGGAAAAATGG + Intronic
1040297784 8:46169795-46169817 CTGAATCTACATATCACAAAGGG + Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040882982 8:52228687-52228709 TTGATGTTACATATGAGAAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1041490819 8:58431046-58431068 GTGATTACACATGTGATAAAAGG - Intronic
1041529491 8:58848377-58848399 CTTACTATAAATATGAAAATAGG - Intronic
1041602650 8:59738435-59738457 GTGATTTTACATGTCAAAAATGG - Intergenic
1041675478 8:60534288-60534310 CTGATTTTTCATTTGGAAAACGG - Intronic
1042082866 8:65074976-65074998 CTGTTTATTCATATTAAAAGGGG - Intergenic
1042404849 8:68392665-68392687 CAGATTAAATATATAAAAAATGG + Intronic
1042478166 8:69273366-69273388 CTGAACTTACCTATGAAAAATGG + Intergenic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043847685 8:85180334-85180356 TTGATAATACATATTAAAGATGG + Intronic
1043879124 8:85521810-85521832 CTGATAATAAATTTGGAAAATGG - Intergenic
1044217158 8:89625294-89625316 CAGTTTCTACATCTGAAAAATGG + Intergenic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045127656 8:99110860-99110882 CTGATTCTTCATATATAAAATGG + Intronic
1045190909 8:99882700-99882722 CTGATTTTACAGATCTAAAAAGG + Intronic
1045613018 8:103870223-103870245 CAGTTTACACATCTGAAAAATGG + Intronic
1045745392 8:105413405-105413427 CAAAATATACATATAAAAAAGGG - Intronic
1045803474 8:106128560-106128582 CTGTTTACTCATAAGAAAAATGG + Intergenic
1046175954 8:110575315-110575337 CTGATTCTACTTATGGCAAAAGG + Intergenic
1046415011 8:113902047-113902069 CAGATTCTTCATCTGAAAAATGG - Intergenic
1046558777 8:115811896-115811918 CTGATTAAAAAAATGAAAAAAGG + Intergenic
1047584342 8:126253528-126253550 CTGATTTTATCTATGAAATATGG + Intergenic
1047797775 8:128275486-128275508 ATGATTTTACATTTGAAAATGGG - Intergenic
1047806740 8:128368953-128368975 CTCATTTTGCAGATGAAAAAAGG - Intergenic
1048088439 8:131210501-131210523 CAAACTATGCATATGAAAAAAGG - Intergenic
1048179345 8:132180912-132180934 AAGATTATCCATCTGAAAAATGG + Intronic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1050907108 9:11018188-11018210 CTGTTTATAAATATAGAAAAAGG - Intergenic
1051063739 9:13076247-13076269 TGGATTAAACTTATGAAAAAAGG + Intergenic
1051495613 9:17719401-17719423 CAGCTTATAAATATGAAGAAGGG + Intronic
1052391742 9:27886736-27886758 CTCATTAGGCATATAAAAAACGG - Intergenic
1052705074 9:31984742-31984764 CTCCTTATACACATGATAAATGG - Intergenic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1054823781 9:69550002-69550024 CAGTTTCTACATCTGAAAAATGG + Intronic
1056509125 9:87285873-87285895 CAGTTTACTCATATGAAAAATGG + Intergenic
1056785278 9:89588195-89588217 CTGATTGTACAGATGTTAAAAGG + Intergenic
1057246221 9:93456620-93456642 CTGTTTTTACACATGAAAAATGG - Intronic
1058475301 9:105327053-105327075 CTGATTATACATAGGTGGAAAGG - Intronic
1058643920 9:107112817-107112839 ATGAATGTACGTATGAAAAAGGG + Intergenic
1058931846 9:109728282-109728304 CTGTTTCTACATCTGTAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060527154 9:124327143-124327165 CAGTTTCTTCATATGAAAAATGG - Intronic
1060582747 9:124766532-124766554 CTGTTTTTACACATGAAATAAGG + Intronic
1060917549 9:127400051-127400073 CTGTTTACACATCTGTAAAATGG - Intronic
1062239692 9:135529883-135529905 ATTATTATACACATGAAGAAAGG - Intergenic
1203429040 Un_GL000195v1:72497-72519 CAGGCTATACATATGACAAAAGG + Intergenic
1203741283 Un_GL000218v1:3743-3765 CTCATAATACATTTTAAAAAGGG + Intergenic
1203717290 Un_KI270742v1:165370-165392 CTGGTTCAACATATGAAAATCGG - Intergenic
1203533927 Un_KI270743v1:12863-12885 CTGGTTCAACATATGAAAATCGG + Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186785317 X:12951479-12951501 CTGATTATGCCTCTGAAAATTGG - Intergenic
1187663929 X:21582637-21582659 CTTATAATACATATGTAAAGTGG - Intronic
1188143164 X:26577458-26577480 CTTTTTATAGATATAAAAAATGG - Intergenic
1188149893 X:26659930-26659952 CTGAATATTCATGTGCAAAATGG + Intergenic
1189530478 X:41876422-41876444 CTGATAATAGATATGAGACAGGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1190324050 X:49195854-49195876 CTGTTTATTCATCTGTAAAAAGG - Intronic
1194091977 X:89589020-89589042 CTGATTATATAAATGAGAAAAGG + Intergenic
1194690378 X:96977126-96977148 ATGATTAACCATATGAAAAAGGG - Intronic
1195433888 X:104820079-104820101 CTGGTATTAGATATGAAAAATGG + Intronic
1195459658 X:105110012-105110034 CTCACTCTACATATGAGAAATGG + Intronic
1195788581 X:108556187-108556209 CTGATTCTTCATATATAAAATGG + Intronic
1196303493 X:114072822-114072844 CTGTTTATAATAATGAAAAATGG + Intergenic
1197875701 X:131103199-131103221 CTGTTTTTAAAAATGAAAAAAGG - Intergenic
1198731239 X:139731811-139731833 GTGATTATATATTTAAAAAAAGG + Intronic
1198766934 X:140089996-140090018 CCAATTACACATATGGAAAAAGG + Intergenic
1199066335 X:143422891-143422913 CAGATTATACAGGTGACAAAGGG - Intergenic
1200444613 Y:3245083-3245105 CTGATTATATAAATGAGAAAAGG + Intergenic
1201154812 Y:11121200-11121222 CTCATAATACATTTTAAAAAGGG + Intergenic
1201252262 Y:12071295-12071317 CAGTCTATACATCTGAAAAAGGG - Intergenic