ID: 1015693810

View in Genome Browser
Species Human (GRCh38)
Location 6:135957137-135957159
Sequence GAGACAGGTGTGCCTGGGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015693805_1015693810 3 Left 1015693805 6:135957111-135957133 CCCGTGGGCGAGGAAGCATGGAG 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG No data
1015693806_1015693810 2 Left 1015693806 6:135957112-135957134 CCGTGGGCGAGGAAGCATGGAGA 0: 1
1: 0
2: 0
3: 17
4: 216
Right 1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG No data
1015693804_1015693810 4 Left 1015693804 6:135957110-135957132 CCCCGTGGGCGAGGAAGCATGGA 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG No data
1015693799_1015693810 26 Left 1015693799 6:135957088-135957110 CCTGCGATTGTGAGAAGATGGTC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015693810 Original CRISPR GAGACAGGTGTGCCTGGGTC CGG Intronic
No off target data available for this crispr