ID: 1015695539

View in Genome Browser
Species Human (GRCh38)
Location 6:135976015-135976037
Sequence CTCAGGGAACCCAGAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015695534_1015695539 12 Left 1015695534 6:135975980-135976002 CCTAGGTGATTCTTTACAGAAAA 0: 1
1: 0
2: 4
3: 60
4: 612
Right 1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG No data
1015695533_1015695539 23 Left 1015695533 6:135975969-135975991 CCTTGGAAACTCCTAGGTGATTC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015695539 Original CRISPR CTCAGGGAACCCAGAAATGG TGG Intronic
No off target data available for this crispr