ID: 1015697249

View in Genome Browser
Species Human (GRCh38)
Location 6:135994423-135994445
Sequence GATGGAGTCAAATGTATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015697249_1015697250 -8 Left 1015697249 6:135994423-135994445 CCAAAGATACATTTGACTCCATC 0: 1
1: 0
2: 1
3: 17
4: 159
Right 1015697250 6:135994438-135994460 ACTCCATCCTACCTAGAGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015697249 Original CRISPR GATGGAGTCAAATGTATCTT TGG (reversed) Intronic
901766762 1:11504949-11504971 TTTGGAGTCAGATATATCTTGGG + Intronic
901989266 1:13099477-13099499 GATGAAGTCAAAACTATATTTGG + Intergenic
901992547 1:13127287-13127309 GATGAAGTCAAAACTATATTTGG - Intergenic
904720610 1:32504961-32504983 GATGGAGATAACTGAATCTTGGG + Intronic
905900398 1:41577764-41577786 GATGCAGTCCAATTCATCTTTGG - Intronic
908558197 1:65279045-65279067 TATGCAGTCAAATGATTCTTAGG - Intronic
908840703 1:68277325-68277347 TATGGAGCTAAATGTATTTTTGG + Intergenic
908962222 1:69711870-69711892 ACTGGAGTCAAATGCAGCTTGGG + Intronic
909800371 1:79799146-79799168 AATGGAGTAAAATGAATCCTGGG + Intergenic
911194064 1:94976081-94976103 GATGGAGACAAATGTGACTGAGG + Exonic
913698041 1:121346916-121346938 GAAGGAGTCAAATGCATTTGAGG - Intronic
914139509 1:144933136-144933158 GAAGGAGTCAAATGCATTTGAGG + Intronic
919506812 1:198409346-198409368 TATGGAGACTAATTTATCTTGGG + Intergenic
920485438 1:206365566-206365588 GAAGGAGTCAAATGCATTTGAGG - Intronic
1063931494 10:11032924-11032946 GATAAACTCAAATGTATGTTGGG + Intronic
1064797631 10:19031178-19031200 GATGGAAGCAAAAGTAGCTTAGG + Intergenic
1064951632 10:20857557-20857579 AATGGAGCCAAATGTGTCTTAGG + Intronic
1065285287 10:24181716-24181738 GATGGATTCAAATGATTCTTAGG + Intronic
1065964454 10:30759720-30759742 GATGGATGCAAATGTAGCTCGGG + Intergenic
1066806064 10:39255345-39255367 CATAGAGTTAAATATATCTTTGG - Intergenic
1068586528 10:58805902-58805924 GATGTAGTCAAGTGTATGTGAGG - Intronic
1069050823 10:63791245-63791267 GATGAAGTCCAATGTTTCGTTGG - Intergenic
1069144797 10:64877460-64877482 AATTGAGGCAAATGTATTTTAGG + Intergenic
1070230584 10:74562431-74562453 GATGGATTCAAGAGTATATTGGG + Intronic
1077990440 11:7405346-7405368 GATAGTGTCAAATGTCTCGTTGG + Intronic
1079703702 11:23586005-23586027 AATGCAGTCAATAGTATCTTGGG - Intergenic
1082941887 11:58714596-58714618 GATGGAGACAATTGAATCATTGG + Intronic
1086027344 11:82309803-82309825 TATGGAGTGACATGTACCTTAGG + Intergenic
1086536477 11:87853085-87853107 GATGGAGTAGAATGTCTATTTGG + Intergenic
1087865387 11:103219733-103219755 TATGGAGTAAAATATATCATTGG + Intronic
1088029314 11:105227251-105227273 GATGGATTTAAATGTATCTTTGG - Intergenic
1089081023 11:115776319-115776341 GGTTGAATAAAATGTATCTTGGG + Intergenic
1094132264 12:27086999-27087021 CATAAAGTCAAATGGATCTTAGG - Intergenic
1094181749 12:27599027-27599049 CATCAAGTCAAATGGATCTTAGG - Intronic
1094864033 12:34507472-34507494 CATGGAGTTAAACGTTTCTTTGG - Intergenic
1095054706 12:37585271-37585293 GATAGAGTCAAACCTTTCTTTGG - Intergenic
1097949598 12:65412983-65413005 GATGGAGTTAACTGAATCGTGGG - Intronic
1098115265 12:67169197-67169219 GATGGAGACAATTGAATCATGGG - Intergenic
1098319479 12:69226941-69226963 GATTAAGTCCAATGTTTCTTTGG - Intergenic
1098352150 12:69574167-69574189 GAAGGAGTCAAATTTGTTTTAGG + Exonic
1098983820 12:76988304-76988326 TTTGGAGTCAGATGTATTTTTGG + Intergenic
1101373613 12:104152370-104152392 GAGGGATTTAAATGTATTTTGGG + Intergenic
1104263859 12:127212313-127212335 GATGGAGATAAGTGAATCTTGGG - Intergenic
1104451485 12:128872306-128872328 GATGGAGTCACATCTTACTTGGG - Intronic
1105793268 13:23823969-23823991 GAAGGTGTCAACTGTATCCTTGG + Intronic
1108582975 13:51842867-51842889 CATGGAGAGAAATGTCTCTTAGG - Intergenic
1110061062 13:71038763-71038785 GATGTTGTCAAATCTTTCTTGGG + Intergenic
1110554525 13:76843426-76843448 GATGAAGTTAAATTTATGTTTGG - Intergenic
1110822765 13:79935787-79935809 GGTGAAGTCCAATGTATCCTTGG - Intergenic
1110980034 13:81885679-81885701 GATGGAGGCAATTGGATCATGGG - Intergenic
1111483699 13:88866964-88866986 GATGGAGACAGAGGCATCTTGGG + Intergenic
1113025548 13:105937282-105937304 GGTGAAATCAAATGTATCTTGGG + Intergenic
1114905495 14:27121352-27121374 GCAGAAGTCAAATGGATCTTGGG - Intergenic
1115340334 14:32287080-32287102 GATGGAGATAAATGAATCATGGG + Intergenic
1119991592 14:79204025-79204047 TATGCAGTCAAATGGCTCTTGGG + Intronic
1130336347 15:82960138-82960160 GATGGAGTCATATATAGCTGAGG + Intronic
1131345563 15:91644681-91644703 GAGGGAGTCAAAAGTATTTGTGG + Intergenic
1131911192 15:97204688-97204710 GATTGAGTGAAATTTATCTCAGG + Intergenic
1132056793 15:98657330-98657352 GATGCAGTCAATTGGATCATGGG - Intronic
1133935042 16:10262260-10262282 GAAGGACTCTAATGTGTCTTGGG - Intergenic
1135039096 16:19104219-19104241 GATGGGGCCAAATGGATCTGGGG - Intergenic
1135630067 16:24029306-24029328 GGTGGAGGCAATTGAATCTTGGG + Intronic
1136243969 16:28962703-28962725 GATGTTGTCAAATATATATTTGG - Intronic
1138402601 16:56759446-56759468 GATGGACTAAAATGGTTCTTAGG - Intronic
1138714252 16:59003620-59003642 GATGGACTCAAATCATTCTTTGG - Intergenic
1141437556 16:84008986-84009008 GATGGACTCAAATGGTCCTTTGG - Intergenic
1145209159 17:21000477-21000499 GATGGAGTCACATGGATTTTTGG - Exonic
1147856019 17:43480680-43480702 GCTGGGGTAAAATGGATCTTAGG - Intergenic
1148199061 17:45736291-45736313 AATGGAATCATATGTAACTTTGG + Intergenic
1150946218 17:69748855-69748877 GATGGAGATAACTGAATCTTGGG - Intergenic
1159658506 18:71062286-71062308 GGTGGAGTCACTTGTATCATTGG + Intergenic
1159953730 18:74504933-74504955 AATGGAGGCAAATCAATCTTAGG - Intronic
1161599146 19:5170305-5170327 GAGTGAGTCAAGTGTATATTTGG + Intronic
1162002876 19:7758559-7758581 GATGGAGACAATTGAATCATGGG + Intergenic
931229399 2:60361393-60361415 GATGGAGTCAAATGCAAAATTGG - Intergenic
937170019 2:119856383-119856405 GAGGGTGTGAAATTTATCTTTGG + Intronic
937757146 2:125553963-125553985 GATAAAAGCAAATGTATCTTTGG + Intergenic
939368898 2:141272449-141272471 GATAGAGTCCAATTTATGTTTGG - Intronic
940041620 2:149367549-149367571 GATGGAGTCACATATCTCCTTGG - Intronic
942309160 2:174638141-174638163 TTTGGAGTACAATGTATCTTGGG - Intronic
943989818 2:194673615-194673637 GATGGTGCCTAATGTATTTTAGG - Intergenic
947935964 2:234003860-234003882 GACTGAGTACAATGTATCTTTGG - Intronic
948293049 2:236841672-236841694 GATGGAGGCAAATGTCTCAATGG - Intergenic
1168736945 20:148698-148720 CCTGGAGTAAAATGTATCTAGGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1169780944 20:9309778-9309800 GAAGGATTCAAATGAATCTCTGG - Intronic
1171527552 20:25827034-25827056 GATAGAGTCAAACCTTTCTTTGG + Intronic
1171549274 20:26028850-26028872 GATAGAGTCAAACCTTTCTTTGG - Intergenic
1172614747 20:36275682-36275704 GATGGAGTAAGATGGATATTTGG + Intergenic
1173201529 20:40958753-40958775 GATGGTGTCAAATGTCTCCTGGG + Intergenic
1175244313 20:57572451-57572473 GTTGGAGTCACATGGTTCTTCGG + Intergenic
1178691961 21:34757612-34757634 GAGGGAGTCGCATGTATCTTGGG - Intergenic
1179201902 21:39232177-39232199 CATGGAGAAAAATGGATCTTAGG - Exonic
1179937310 21:44613727-44613749 GATGGAGACAAAAGCATCATGGG + Intronic
1181341806 22:22186966-22186988 AATGGAGTTAAATGTATTCTTGG + Intergenic
1181824200 22:25500845-25500867 GGTGGAGGCAAATGGATCATGGG - Intergenic
1183087314 22:35494278-35494300 GATGGAGGCACATGTAACTAGGG - Intergenic
952504393 3:33995049-33995071 GATGGAGATAATTGAATCTTGGG - Intergenic
953266318 3:41392559-41392581 TATGGGGTCAAACATATCTTGGG + Intronic
953427734 3:42809297-42809319 GACAGAGTCACCTGTATCTTTGG - Intronic
955850023 3:63210371-63210393 GATGGAATCAAATTTCTTTTAGG - Intergenic
958031612 3:88117764-88117786 GATAGAATCAAATGTATTTTTGG + Intronic
958090323 3:88869362-88869384 GGTGGAGATAATTGTATCTTGGG - Intergenic
958722491 3:97861574-97861596 GATGAAGGCATATGTATCTTTGG - Intronic
958904019 3:99922329-99922351 GTCTGAGTCAAATGTTTCTTTGG + Intronic
961313156 3:126016616-126016638 AATGGAGTGAAATGTAGCTGTGG - Intronic
963757611 3:149251991-149252013 AATGTAGTCAAATGAATATTTGG + Intergenic
964212909 3:154247759-154247781 GATTCAGTCAAATGTTTTTTAGG + Intronic
965294150 3:166921779-166921801 ATTGGATTCAAATGAATCTTTGG - Intergenic
967042672 3:185707958-185707980 GATGAAGTCTAATGTTTCTGAGG + Intronic
971681617 4:29707728-29707750 GATGGAGGTAATTGTATCATAGG - Intergenic
974843256 4:67322309-67322331 GAGGGAGGTAAATGAATCTTTGG + Intergenic
975081806 4:70289641-70289663 TATGAAGTCAAAATTATCTTAGG - Intergenic
975903352 4:79180038-79180060 GATGGAGGTAAATGAATCATGGG - Intergenic
976960069 4:90959646-90959668 AATGGTGTCAAATTTATCTTTGG - Intronic
976965031 4:91027531-91027553 GATGAAGTGAAATGTCTTTTTGG + Intronic
980316372 4:131206982-131207004 GATGGAGACAATTGTATACTGGG - Intergenic
985967716 5:3350361-3350383 CATGGAGTCAAATGTGGCTGCGG + Intergenic
986926118 5:12754214-12754236 GATGGAGGCAGATGTCTATTTGG - Intergenic
987053640 5:14169744-14169766 GATGGATTCAAATCTACCTTTGG + Intronic
991449281 5:66734382-66734404 GATGGAGTCCAGGGTATCATAGG + Intronic
991483868 5:67113348-67113370 GATACTGTCAAATGTATTTTTGG - Intronic
992550515 5:77855390-77855412 GATGGCGACAAATGTTTCCTGGG - Intronic
993238180 5:85343751-85343773 GGTGGAGACAACTGAATCTTAGG + Intergenic
994064983 5:95529257-95529279 GATGGAGAAAAATGTATGGTGGG - Intronic
994257052 5:97609972-97609994 GATGGAATAAAATGTCTTTTAGG + Intergenic
997499796 5:134364460-134364482 GAAGGAGTCAAAGGTCTCTGAGG - Intronic
999355340 5:150924135-150924157 GATGAAGTAAAATTTATCTTTGG - Intergenic
1004179568 6:13369351-13369373 AATGCAGTCAAAACTATCTTTGG - Intronic
1005927891 6:30459719-30459741 GATCAAGTCCAATGTTTCTTTGG - Intergenic
1007410922 6:41660941-41660963 GGTGGAGTCAATTGGATCATGGG - Intergenic
1008080374 6:47188429-47188451 GCTGAAGCCAAATGCATCTTTGG - Intergenic
1010620861 6:78072560-78072582 TATGGAATCAGATATATCTTAGG - Intergenic
1012546022 6:100420420-100420442 GATGTAGAAAAATGCATCTTGGG - Intronic
1012906566 6:105073670-105073692 AATGGAAAAAAATGTATCTTAGG - Intronic
1014208826 6:118687111-118687133 GATTGAGTCAAATGAATATTAGG - Intronic
1014838398 6:126186248-126186270 GATAAAGTCAGATGTATCTTGGG + Intergenic
1015697249 6:135994423-135994445 GATGGAGTCAAATGTATCTTTGG - Intronic
1016215262 6:141592304-141592326 GATATAGTCCCATGTATCTTGGG + Intergenic
1016868007 6:148788223-148788245 GAGGGAGACAATTGAATCTTGGG - Intronic
1017049577 6:150377806-150377828 AATGGTGTCAAAAGTATCATTGG + Intronic
1020577582 7:9953955-9953977 GTTTGATTAAAATGTATCTTGGG + Intergenic
1020704363 7:11525073-11525095 GATGGCTTAAAATGTAGCTTTGG - Intronic
1021784305 7:24136863-24136885 GATGGACTCACTTGTATTTTGGG - Intergenic
1021900199 7:25277698-25277720 GATGGTTTCAAATGGATCTGCGG + Intergenic
1022862061 7:34377416-34377438 CATGGAGTCAAATGTTATTTTGG + Intergenic
1023457637 7:40358976-40358998 CATAGTGTAAAATGTATCTTTGG - Intronic
1024382234 7:48710570-48710592 ATTGGAGACAAATGTATTTTCGG + Intergenic
1024840987 7:53587341-53587363 GATGGAGTCAGAGGAATATTGGG + Intergenic
1025298093 7:57792835-57792857 GATAGAGTCAAACTTTTCTTTGG - Intergenic
1025584206 7:62761503-62761525 CACAGAGTTAAATGTATCTTAGG - Intergenic
1029915037 7:104199908-104199930 GGTGGAGGTAAATGAATCTTGGG + Intronic
1031326450 7:120404961-120404983 TATAGAGTCAAATGTAACTTTGG - Intronic
1031715399 7:125102980-125103002 GATTGAGTCCCATATATCTTTGG + Intergenic
1036741776 8:11369303-11369325 TATGTGGTCAAATTTATCTTCGG + Intergenic
1039250214 8:35655570-35655592 GAAGGAATGAAATCTATCTTTGG - Intronic
1042660119 8:71145203-71145225 AATGGAGTCAAATGTTTGTCTGG + Intergenic
1058007464 9:99933226-99933248 TATGGAGTTACATGCATCTTTGG - Intronic
1059742531 9:117166000-117166022 CATGGAGTAAAAAGTATCTCTGG + Intronic
1059777516 9:117490297-117490319 TATGCATTCAAATATATCTTGGG + Intergenic
1062703394 9:137919901-137919923 GGCGGAGTCAAATGGAGCTTTGG + Intronic
1185682870 X:1902871-1902893 GATGGAGGGAAAAGTATCTCAGG - Intergenic
1188053754 X:25517720-25517742 GATTGATTCAAATATATCTTTGG - Intergenic
1188989722 X:36802979-36803001 GAGGGTGTCAAATGTCTCTTTGG - Intergenic
1189859729 X:45260049-45260071 GATTGAGTCACATGTCTCTCAGG + Intergenic
1191263617 X:58358325-58358347 GATGGAGTTAAACTTTTCTTTGG + Intergenic
1191268688 X:58432876-58432898 GATGGAGTTAAACCTTTCTTTGG - Intergenic
1191269225 X:58441329-58441351 TATGGAGTTAAATCTAACTTTGG - Intergenic
1191756162 X:64594671-64594693 GATAGAGTCAAAGGTCTCTGAGG - Intergenic
1192853993 X:74987784-74987806 GATGAAGTCAACTTGATCTTGGG + Intergenic
1193928523 X:87522036-87522058 GATAGGGTCAAATGTATTGTAGG + Intronic
1194888118 X:99344214-99344236 GATGAAGTCAGATGTTTCTTTGG + Intergenic
1197690534 X:129495708-129495730 GATGAAATCAATTCTATCTTAGG - Intronic
1198040773 X:132849712-132849734 GATGGATGCTAATGTACCTTTGG - Intronic
1198484173 X:137069932-137069954 GATGGAGTGAAATCTATGTGTGG - Intergenic
1198886610 X:141345239-141345261 TATGCGGTCAAATGTCTCTTGGG - Intergenic
1199492433 X:148415217-148415239 GAATGAGTTAAAGGTATCTTTGG - Intergenic
1201261437 Y:12162764-12162786 GGTGGAGGCAATTGTATCATGGG - Intergenic