ID: 1015698936

View in Genome Browser
Species Human (GRCh38)
Location 6:136013361-136013383
Sequence TACAGGATTTGGAAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 464}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015698936_1015698940 -6 Left 1015698936 6:136013361-136013383 CCTCTTTCTTTCCAAATCCTGTA 0: 1
1: 0
2: 3
3: 57
4: 464
Right 1015698940 6:136013378-136013400 CCTGTAGACTGGAATAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015698936 Original CRISPR TACAGGATTTGGAAAGAAAG AGG (reversed) Intronic
901392464 1:8955822-8955844 TAGACAATTTGGAAAGAAAGAGG + Intronic
902887763 1:19418547-19418569 TTCAGGAAGTGGGAAGAAAGAGG - Intronic
902952850 1:19900653-19900675 TTTAGTATATGGAAAGAAAGTGG - Intronic
902970001 1:20041409-20041431 TATAGGATTTGGATAGGTAGTGG + Intronic
903329442 1:22589753-22589775 TCCAGAGTTTGGGAAGAAAGAGG - Intronic
903523655 1:23975023-23975045 TACATAATTTGGACAGAAAGTGG - Exonic
903810531 1:26032689-26032711 TACATGATGGGGAAAGACAGAGG + Intronic
904441418 1:30534398-30534420 GACAGAGTTTGGAAAGGAAGAGG + Intergenic
904587826 1:31589643-31589665 AACAGGATGTGGAAAGAAGCCGG + Intergenic
904715073 1:32461617-32461639 GCCAGGATTTGGAAATGAAGTGG + Intergenic
904994953 1:34624395-34624417 GACAGGATTTGGCAACAAATTGG + Intergenic
905285671 1:36878643-36878665 TCAAGCCTTTGGAAAGAAAGAGG + Intronic
905533959 1:38704195-38704217 TTCAGGATTTAGAAAGAAGCTGG + Intergenic
905949723 1:41939336-41939358 TCCAGAATTTGGGAATAAAGGGG + Intronic
905982199 1:42239282-42239304 AACAGGATTTTGAATAAAAGTGG + Intronic
906225237 1:44116648-44116670 TACTGGATTTGGCAAGACGGAGG - Intergenic
907092199 1:51735458-51735480 TGTAGGATTTGGACAGAAATGGG - Intronic
907719868 1:56961614-56961636 TCCTGGATATGGAAAGAAAGAGG - Intronic
907742543 1:57181094-57181116 TACATGCTCTGGAAAGACAGTGG - Intronic
908009285 1:59759241-59759263 TAAAGGAAATGAAAAGAAAGTGG - Intronic
908288559 1:62637852-62637874 AACTGGCCTTGGAAAGAAAGAGG + Intronic
908934539 1:69358544-69358566 TCCATGATTTGGAATAAAAGAGG - Intergenic
909235098 1:73143067-73143089 TACAGGATTTGGTTAGGTAGTGG + Intergenic
910313936 1:85860357-85860379 TAGAGGGGTTGGAAAGAAATGGG - Intronic
910657042 1:89630373-89630395 TAAGGGATTTGGAATGAAATAGG - Intergenic
910785628 1:90995047-90995069 TACATGATATGCAAAGAAAGAGG + Intronic
911372753 1:97013984-97014006 CAAAGGACTTGGAAGGAAAGTGG - Intergenic
912507699 1:110167392-110167414 TACAGGACATGATAAGAAAGTGG + Intronic
912673517 1:111653876-111653898 CAGAGGATTTGGATAGATAGAGG + Intronic
912744293 1:112232416-112232438 TACAGGAAGAGAAAAGAAAGGGG - Intergenic
913039824 1:115011459-115011481 TATAGGATTTGGGTAGATAGTGG + Intergenic
913149846 1:116030308-116030330 TACAGGATTTGGAAACTTAATGG - Intronic
913267384 1:117058532-117058554 TACAGGATTTGCAGAAAGAGGGG - Intergenic
913313744 1:117532347-117532369 TACAAGATATGCAAAGAAACAGG - Intergenic
913336404 1:117712672-117712694 TACAGTAATTGGAAAGAAATTGG + Intergenic
913358506 1:117951648-117951670 CATGGGATTTGGAAAGAAAGTGG - Intronic
913512298 1:119572923-119572945 TACCAGATTGGGCAAGAAAGAGG - Intergenic
914424602 1:147563514-147563536 TTCAGGATATGGAAAGTCAGGGG + Intronic
914688688 1:150005929-150005951 TACAGATTTTGAAAAGAAATTGG + Intronic
915836848 1:159183679-159183701 AATAGTATCTGGAAAGAAAGAGG + Intronic
917092941 1:171372233-171372255 TACAGGATTTGGGTAGGTAGTGG - Intergenic
918131702 1:181635185-181635207 TTCAGGAGTTGGAAAAACAGAGG - Intronic
918271372 1:182904413-182904435 ATCAGGAGTTGGAAAGAGAGAGG - Exonic
919575601 1:199305170-199305192 TAGAGGATATGGAAAGAGATGGG + Intergenic
920016598 1:202915559-202915581 TACAGGCTTTGGAATAAAACTGG - Intronic
923120703 1:230987718-230987740 TCAAGGATATGGAAAGAAAATGG - Intronic
924387933 1:243517365-243517387 TACAGCAATTGGAGAGAAATTGG - Intronic
924407520 1:243766019-243766041 TATGGAATTTGGAAATAAAGAGG - Intronic
924760246 1:246977822-246977844 GACAGGAAATGGAAAGAAACTGG - Intronic
1062995789 10:1865324-1865346 TTAAGGATGAGGAAAGAAAGTGG + Intergenic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1063768097 10:9165912-9165934 CACAGGAAGTGGAAAGAATGAGG + Intergenic
1063812920 10:9734767-9734789 TACAGTACTTGGAAAGAGAGAGG - Intergenic
1063857751 10:10273602-10273624 TTAAGGAGTTGGAAAGGAAGTGG + Intergenic
1064665500 10:17646419-17646441 TAGAGGATTTTGTAAGAAGGTGG - Intronic
1065898372 10:30183996-30184018 TGCAGGATTTGGAAATGAGGGGG - Intergenic
1066687213 10:37992705-37992727 TCCATGATTTTGAAAGTAAGAGG + Intergenic
1067262144 10:44703390-44703412 TACAAGATATGCAAAGAAACAGG - Intergenic
1068929844 10:62578367-62578389 TACAGCATGTGGAAAGAGAGGGG - Intronic
1068989668 10:63137633-63137655 TACAGAAGCTGGAAAGTAAGAGG - Intronic
1069798585 10:71068702-71068724 CACAGGATTAAAAAAGAAAGTGG + Intergenic
1070885081 10:79887345-79887367 GACATGAATTGGAAAGGAAGAGG - Intergenic
1071096060 10:81976218-81976240 TTCTGTATGTGGAAAGAAAGTGG + Intronic
1071476007 10:86025529-86025551 GACAGCATTTGGAAAGCACGTGG - Intronic
1071939081 10:90567945-90567967 TACAAGACTGGGAAGGAAAGCGG - Intergenic
1071998193 10:91167562-91167584 TCCAGGATTTGAGAAGAATGTGG + Intronic
1072390810 10:94984964-94984986 TACAGGAGATGGAAAGTAACAGG - Intronic
1072711304 10:97717361-97717383 TGCATGGTTTGGAAAGGAAGGGG - Exonic
1073074568 10:100815707-100815729 TAAAGGATATGGAAAAGAAGAGG + Intronic
1073512797 10:104053037-104053059 TCCTGGATCTGGAGAGAAAGGGG - Exonic
1074320651 10:112398838-112398860 TAAAGGTTTTGGAAAGAGTGAGG + Intronic
1074941239 10:118237534-118237556 TTCAGTCTTTGGAAAGAAAATGG - Intergenic
1075925208 10:126245789-126245811 CATTGGATTTGGCAAGAAAGTGG + Intronic
1077982691 11:7316775-7316797 TGCAAGAGTTGGAGAGAAAGTGG - Intronic
1078869988 11:15334467-15334489 AACAGGATTTGACAGGAAAGAGG - Intergenic
1078898211 11:15616897-15616919 TGGGGGATTTGGCAAGAAAGAGG - Intergenic
1078983923 11:16570979-16571001 TACAGTATTTGGTATGAAAAAGG - Intronic
1080104378 11:28496514-28496536 TACAGGTTTTGCAAGGACAGAGG + Intergenic
1080242590 11:30143711-30143733 TACAGGCTTTGGAACAAAGGTGG + Intergenic
1083226704 11:61289813-61289835 TAGAACATTTGGAAAGTAAGAGG - Intronic
1084474993 11:69383832-69383854 TACAGGAGTGGGAATTAAAGAGG + Intergenic
1085146412 11:74202185-74202207 TACATGATTTGGAATGACAGAGG - Intronic
1086385678 11:86304931-86304953 TACAGGATTTGTGAATAAGGAGG + Intronic
1087421506 11:97931680-97931702 TACAGACTTTGAAAAGAGAGTGG - Intergenic
1087777432 11:102269109-102269131 GACTGAATTTGGAAAGAAAAAGG - Intergenic
1087840175 11:102912240-102912262 TACAGGATTTGGGTAGGTAGTGG - Intergenic
1088400730 11:109420897-109420919 TGCTGTATTTGTAAAGAAAGAGG - Intergenic
1088417291 11:109603556-109603578 TGCAGCCTTTGGAAAGCAAGAGG - Intergenic
1088577354 11:111284798-111284820 CAGGGGACTTGGAAAGAAAGAGG - Intronic
1088693746 11:112349044-112349066 TTCAGGAGTGGGAAAGAAGGAGG + Intergenic
1089349469 11:117814176-117814198 TATAGGATTTGGGAAGATAATGG - Intronic
1089927822 11:122277627-122277649 TACAGGAGGTGGAAATGAAGAGG - Intergenic
1090847405 11:130542427-130542449 CCCAGGATTTTGAAAGAAATTGG - Intergenic
1092649793 12:10621829-10621851 AACAACATTTGGAATGAAAGAGG + Intronic
1093785280 12:23185395-23185417 TACAGGAATTGGCATGAAGGAGG - Intergenic
1094206277 12:27844092-27844114 TACATGAGTTGGGAAGAAATTGG - Intergenic
1094638303 12:32248222-32248244 TACTGGATTTGGCAAGATGGAGG + Intronic
1094732143 12:33190006-33190028 TACAATATTAGGAACGAAAGTGG + Intergenic
1095255036 12:40024757-40024779 TACAGCATTTAGAAATAAAGAGG + Intronic
1095287464 12:40431077-40431099 TACAGGATGGGGAAAGTAAGAGG + Intronic
1097407837 12:59212711-59212733 TATAGGAAATGGAAGGAAAGAGG + Intergenic
1098294422 12:68990029-68990051 TCCATGATTTGGAATAAAAGAGG + Intergenic
1099491273 12:83291797-83291819 TACAGGATTTGGAGAGGAGGTGG + Intergenic
1100099182 12:91081457-91081479 ATAAGGATTTGGGAAGAAAGAGG - Intergenic
1100238777 12:92688768-92688790 AACAGGATTTGGAAAAAAATAGG - Intergenic
1100440051 12:94608659-94608681 TACAGGATCTGGACAGAGACAGG - Intronic
1100664236 12:96733518-96733540 CACAGGATTTTGAAAGAAAGAGG - Intronic
1101933008 12:109030419-109030441 AACAAGTTTTTGAAAGAAAGGGG + Intronic
1104625811 12:130353493-130353515 TACAGGATATGGTAGGAAAGAGG + Intronic
1105248022 13:18670230-18670252 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1105315785 13:19261033-19261055 TAAAGTATTTAGAAATAAAGAGG + Intergenic
1105537479 13:21281785-21281807 TAAAGTATTTAGAAATAAAGAGG - Intergenic
1105683683 13:22754694-22754716 AAACGGATTTGGGAAGAAAGAGG - Intergenic
1106593367 13:31116874-31116896 TTCAGGATTAGGGAGGAAAGGGG + Intergenic
1106643179 13:31607463-31607485 TATAGGATTTGGGTAGATAGTGG + Intergenic
1107746968 13:43520688-43520710 GTGAGGATTTGAAAAGAAAGTGG + Intronic
1107800592 13:44104648-44104670 TTCTGGATTTGTAAAGAAAGGGG + Intergenic
1107933447 13:45325383-45325405 CACAGGATTTGCTAAGAAATTGG + Intergenic
1108035817 13:46289890-46289912 TAAAGAACTTGGAAAGAAGGTGG + Intergenic
1108300093 13:49064817-49064839 TACAGGGTTTGGGAAAAAACAGG + Intronic
1108603963 13:52018698-52018720 TACAGGAATTGGAACTAAAGGGG + Intronic
1109110165 13:58307351-58307373 TACAGGATATGTAAAGAGATTGG + Intergenic
1109875816 13:68403320-68403342 AAAAGGATTTGTAAACAAAGGGG - Intergenic
1111159005 13:84368577-84368599 AACAAAATTTGGGAAGAAAGAGG + Intergenic
1111571525 13:90093437-90093459 ATCAGGATGTGGGAAGAAAGAGG + Intergenic
1111917871 13:94380623-94380645 TAGAGGATTTAAAATGAAAGGGG - Intronic
1112007022 13:95262457-95262479 TACAGGATTTGTCACTAAAGAGG - Intronic
1112824840 13:103380499-103380521 TGCAAGATTTGGTCAGAAAGAGG - Intergenic
1113535521 13:111063269-111063291 TACAGGATTTGGGTAGGTAGTGG - Intergenic
1114151819 14:20048997-20049019 TACAGGACTGGGAGAGAAATAGG + Intergenic
1114541647 14:23464892-23464914 TAGAGGGTTGGGAAAAAAAGGGG + Intergenic
1114785289 14:25590275-25590297 CAGAGAATTTGGCAAGAAAGGGG - Intergenic
1114897804 14:27013522-27013544 TGCAAGATTTTGAAAGAAAATGG + Intergenic
1115441758 14:33443756-33443778 TACAGGAAGTGGCAGGAAAGTGG + Intronic
1115848365 14:37563825-37563847 TAAATTATCTGGAAAGAAAGTGG - Intergenic
1116865548 14:50028785-50028807 TATAGGATTTGGGAAGGTAGTGG - Intergenic
1117325540 14:54665841-54665863 TTCAGGCTTTTGAAAGAAAGGGG + Intronic
1117389094 14:55246337-55246359 TATAGCATTTGGGAAGAAATTGG - Intergenic
1117625253 14:57630103-57630125 TACATAATTTGGACAGAAAGTGG + Intronic
1120064752 14:80027928-80027950 CACAGGATTGGGAGAGAGAGTGG - Intergenic
1120433160 14:84444880-84444902 TACAGGATTTAAAAAAAAAAAGG - Intergenic
1121251251 14:92500902-92500924 TACAGGAGTTGCTAAGGAAGGGG + Exonic
1121591450 14:95115372-95115394 TTCAGGATTTAGAAAAAAATTGG + Intronic
1121623026 14:95363268-95363290 TAAAGCAGTTGGAAAAAAAGGGG - Intergenic
1121846265 14:97174944-97174966 ACCGGAATTTGGAAAGAAAGTGG - Intergenic
1122731463 14:103802007-103802029 TACAGAATTTGGAATAAAACAGG + Intronic
1122869493 14:104630179-104630201 AACAGAATTTGGAAAGAAAAAGG + Intergenic
1124420839 15:29520014-29520036 TACAGGATTTGGGTAGGTAGTGG - Intronic
1124494454 15:30177891-30177913 TGGAGGATTTGTAGAGAAAGAGG + Intergenic
1124749116 15:32360754-32360776 TGGAGGATTTGTAGAGAAAGAGG - Intergenic
1124903239 15:33843976-33843998 AACAGGATTTGGAAAGAGAGGGG + Intronic
1125227803 15:37414648-37414670 TACAGGTTTTGGAAAGTAATAGG + Intergenic
1126360454 15:47840445-47840467 GACAGGTTTGTGAAAGAAAGAGG - Intergenic
1126423883 15:48504778-48504800 TACGGGATTAGGGAAGAAAAGGG + Intronic
1126463829 15:48942240-48942262 TAAATGCTTTGGAAATAAAGGGG - Intronic
1127165019 15:56235656-56235678 TACTGATTTTGGAAAGAAAAAGG + Intronic
1127231108 15:56996520-56996542 TACAGGATTTGTAAAGTCTGAGG - Intronic
1129089640 15:73135548-73135570 TACATAATTTGGAAAAAAACTGG + Intronic
1129176004 15:73840103-73840125 CACAGGATATTGAAAGAATGGGG - Intergenic
1129926351 15:79367702-79367724 TACAGGATTTTTAAAGGCAGGGG + Intronic
1130120067 15:81040322-81040344 AACATGATTTGGGAAGAAAAAGG - Intronic
1130305102 15:82708253-82708275 TACAGGATTTGGGTAGGTAGTGG - Intronic
1130796454 15:87214825-87214847 CTCAGGAATTGTAAAGAAAGAGG + Intergenic
1132628009 16:901464-901486 ACCAGGATGGGGAAAGAAAGGGG + Intronic
1132769618 16:1554033-1554055 TTCAGGCTCTGGAAAGAGAGGGG + Intronic
1133701914 16:8316795-8316817 CACAGGCTCAGGAAAGAAAGTGG + Intergenic
1133924875 16:10183926-10183948 TTCAGGCCTTGGAAGGAAAGGGG + Intergenic
1135080747 16:19432610-19432632 AAAAGGATTGGGAAAGAGAGAGG - Intronic
1136645401 16:31609325-31609347 TACAGGATTTGGGTAGGTAGTGG - Intergenic
1136774125 16:32862480-32862502 TAAAGAATGTGGAAAGAAAGGGG - Intergenic
1136896486 16:33999034-33999056 TAAAGAATGTGGAAAGAAAGGGG + Intergenic
1137542108 16:49371134-49371156 TACAAGATATGCAAAGAAACAGG + Intergenic
1137884457 16:52087640-52087662 TCCTGGATCTGGAAAGGAAGGGG - Intergenic
1138314656 16:56059477-56059499 AACATGAATTGGAAATAAAGGGG + Intergenic
1138805593 16:60085578-60085600 TACAGGATTTGGGAAGGTAATGG + Intergenic
1139209925 16:65067381-65067403 TACAAGAGTGTGAAAGAAAGAGG + Intronic
1203076549 16_KI270728v1_random:1124599-1124621 TAAAGAATGTGGAAAGAAAGGGG - Intergenic
1144259542 17:13504733-13504755 TACAGAAATTGGAAACATAGTGG - Intronic
1145742045 17:27282957-27282979 AAAAGGATATGGAAAGAAAGTGG - Intergenic
1145943399 17:28756077-28756099 TACAGTATGTGGATAGAATGGGG + Exonic
1146142083 17:30377217-30377239 GACAGGATCTGGAGACAAAGAGG - Intergenic
1146622243 17:34407999-34408021 AACTGGATAGGGAAAGAAAGAGG - Intergenic
1147019256 17:37518136-37518158 GACAAGATTTGGAAAGGCAGTGG - Exonic
1147199337 17:38789492-38789514 AACAGGATTTGCAAGGAAAGTGG - Intronic
1148560970 17:48605852-48605874 AACAGACTTTGGATAGAAAGAGG - Intergenic
1148921738 17:51042033-51042055 GAGAGGATTTGGGAAGAAATGGG - Intronic
1149221196 17:54416646-54416668 TACAGGATTTGGGTAGGAAGTGG - Intergenic
1149409381 17:56389465-56389487 TAAAGGATTTAGAGAGAAAAGGG + Intronic
1150485201 17:65538345-65538367 TACAGGACGTGGAAAGGAAAGGG + Intronic
1151696792 17:75721909-75721931 TCCAGGGTTTGCAAAGAAGGTGG + Intronic
1152273511 17:79339966-79339988 TACAGGACTCTGAAAGACAGAGG - Intronic
1154440831 18:14388898-14388920 CAGAGGTTCTGGAAAGAAAGTGG - Intergenic
1155325390 18:24659591-24659613 TGCAGGATTTGGAAAATCAGAGG + Intergenic
1155876606 18:31097702-31097724 CACAGGAATTGGAAAAGAAGAGG + Intronic
1156094391 18:33511242-33511264 TCCAGGTATTGGAAAGAATGTGG - Intergenic
1157096287 18:44688157-44688179 TAAAGGATTTGGGATGAAAAAGG + Intronic
1157112868 18:44837377-44837399 TAAATGATTTAGAAAGAAAAAGG - Intronic
1157228375 18:45889230-45889252 TGGTGGCTTTGGAAAGAAAGAGG + Intronic
1157730992 18:50004139-50004161 TACAAGATGTGGAGAAAAAGTGG + Intronic
1158576278 18:58641355-58641377 TGCAGGATTTGGGTAGACAGTGG + Intergenic
1159305233 18:66632682-66632704 TACAAGATATGGGAAGAAAAAGG + Intergenic
1160429212 18:78800114-78800136 TCCGGGATTTGGAGAGACAGCGG - Intergenic
1162193771 19:8967649-8967671 TTAAGGATTTGAGAAGAAAGAGG + Intronic
1162266790 19:9582491-9582513 TATAGGATTTGGGTAGATAGTGG - Intronic
1162873757 19:13605548-13605570 TATAGGATTTCGAAAGAAACCGG - Intronic
1163781949 19:19255172-19255194 CACAGGATGGGGGAAGAAAGAGG + Intergenic
1164142488 19:22485394-22485416 TAGAGGAATTAGAAAGAAGGTGG + Intronic
1164743238 19:30592396-30592418 TTTAGGATGTGGAAAGAAAATGG + Intronic
1165301621 19:34973390-34973412 GACAGCATTTTGACAGAAAGGGG - Intergenic
1166398472 19:42460222-42460244 TACAGGATTTGGGTAGGTAGTGG - Intergenic
1166411376 19:42557636-42557658 TACAGGATTTGGGTAGGTAGTGG - Intronic
925097525 2:1219168-1219190 AGCAGGAGTTGGAAGGAAAGAGG - Intronic
925490706 2:4389942-4389964 TATAGGATTTGGGTAGATAGTGG + Intergenic
926874654 2:17461708-17461730 TATGGCAATTGGAAAGAAAGAGG - Intergenic
926924533 2:17973775-17973797 TACAGGAGTATGAAAGACAGTGG + Intronic
928048069 2:27958349-27958371 AAAAGGATTAGGAAAGAAATGGG + Intronic
928241886 2:29593462-29593484 TACAGGGTATAGAATGAAAGGGG - Intronic
928323294 2:30300955-30300977 GACAAGATTTGGAAAGAAATCGG + Intronic
928556211 2:32427781-32427803 TACAAGACATGCAAAGAAAGAGG - Intronic
929153505 2:38769368-38769390 TTCATGGTTTGAAAAGAAAGGGG - Intronic
929182310 2:39055087-39055109 GACAGGATCTGGAAACAAATTGG - Intronic
929745659 2:44655367-44655389 TCCAGGCTTTGAAAAGAATGAGG - Intronic
929842650 2:45485844-45485866 AATAGGAATTGAAAAGAAAGTGG + Intronic
931635106 2:64333674-64333696 TCCTGGGTCTGGAAAGAAAGAGG + Intergenic
932281602 2:70497673-70497695 TCCAGGTTTTGAAAAGACAGTGG + Intronic
933044969 2:77524409-77524431 TGCAGAATTTACAAAGAAAGTGG + Intronic
933185805 2:79278207-79278229 TACAGGAACTGGCAAGAATGAGG + Intronic
933682020 2:85110383-85110405 CACAGTAATTGAAAAGAAAGAGG - Intergenic
934713303 2:96529240-96529262 TAAAGGAATTGGGAAGGAAGAGG - Intergenic
934865567 2:97807153-97807175 GACAGGATTTGGTAATATAGAGG + Intronic
935198689 2:100836799-100836821 TACAGGGTTTGGGAGGAATGGGG + Intronic
935580122 2:104749420-104749442 TAGAGAATTTGGGAAGAAAGGGG - Intergenic
935980517 2:108621651-108621673 TAAAGGATTTGTGAAGAAATGGG - Intronic
936075122 2:109396924-109396946 TACAGGATTCAGAAAGGAAGAGG - Intronic
936473802 2:112822525-112822547 CACTGAATTTGGCAAGAAAGAGG - Intergenic
937154784 2:119711179-119711201 TTGAGGCTTTGAAAAGAAAGTGG + Intergenic
937602653 2:123757453-123757475 TACAACATTTCGAAAGCAAGAGG - Intergenic
938244654 2:129767263-129767285 CACAGGATTTGGAAGGCAAGAGG + Intergenic
939102704 2:137914000-137914022 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
939875080 2:147568478-147568500 TACAGGATCTGCAAATAATGAGG - Intergenic
942064879 2:172261275-172261297 TAGAGGCTTTGGAAAGACAACGG - Intergenic
942573057 2:177332893-177332915 TGTAGGATTTGGAAATAAAATGG + Intronic
942674682 2:178414133-178414155 TATAGCATTTGGCTAGAAAGTGG + Intergenic
943062056 2:183049499-183049521 TACAGGATTTGGGTAGGTAGTGG - Intergenic
943572191 2:189586595-189586617 ATCAGGGTTTGGAAAGAAAATGG + Intergenic
943600456 2:189913242-189913264 TACAGAACTTGGAAAGGAAAAGG - Intronic
943694155 2:190905707-190905729 TACAGGAATTCAAAAGAAAAGGG + Intronic
943874746 2:193050972-193050994 TTTAGGATGTGGAAAGAAATAGG + Intergenic
944026093 2:195169723-195169745 TGAATGCTTTGGAAAGAAAGTGG - Intergenic
945555220 2:211267498-211267520 TACAGGATTTGGGTAGGTAGTGG - Intergenic
945857863 2:215090152-215090174 TATAGGATTTGGGTAGATAGTGG - Intronic
946974846 2:225136967-225136989 TATTGGATTTGGAAATAAAGAGG + Intergenic
947355644 2:229292394-229292416 TAGAGGATGTGGAGAAAAAGAGG - Intergenic
1168747210 20:253831-253853 TCCTGGATCTGGAAAGGAAGGGG + Intergenic
1169552666 20:6717114-6717136 GACATGATATGGAAAGAATGAGG - Intergenic
1169647670 20:7832101-7832123 TACATAATTTGGACAGAAAGTGG - Intergenic
1170656730 20:18293730-18293752 TAATGGATTTAGAATGAAAGGGG + Intronic
1170656744 20:18293904-18293926 TAATGGATTTAGAATGAAAGGGG + Intronic
1171888065 20:30676127-30676149 CACAGCATTTAGAAAGGAAGAGG - Intergenic
1172524070 20:35587017-35587039 TATAGGAATTGGTAAGAAAGAGG - Intergenic
1172638822 20:36428614-36428636 TGGAGGATGTGCAAAGAAAGGGG - Intronic
1172874891 20:38158254-38158276 CCCAGGATCTGGGAAGAAAGGGG - Intronic
1173654690 20:44691496-44691518 AACAGAATCTGGAAAGACAGAGG + Intergenic
1175877630 20:62238033-62238055 TTCAGGATTTGGTAGGACAGTGG + Intronic
1176455223 21:6902286-6902308 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1176833395 21:13767334-13767356 CAGAGGTTCTGGAAAGAAAGTGG + Intergenic
1177021019 21:15858214-15858236 AAAAGGATTTGGAAAGGAAGTGG - Intronic
1177684111 21:24415136-24415158 TAAAGGAGTAGGAAAGAAAGAGG - Intergenic
1177861120 21:26455339-26455361 AACAGGATTGGGAAACAAAAAGG - Intergenic
1177952518 21:27556383-27556405 TGCAGGATTTGGGAAAAATGGGG - Intergenic
1178095778 21:29213243-29213265 TACACGATTTAGAAAGAACAAGG + Intronic
1178498098 21:33103806-33103828 AACTGGAGTTGGAAAGAAAAAGG + Intergenic
1179021163 21:37642320-37642342 TCCAGGATGTTGAAAGAGAGAGG + Intronic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1179996729 21:44977681-44977703 TTCAGGTTGTGGAAAGCAAGGGG + Intergenic
1180130266 21:45822571-45822593 GACAGGATTAGGAGAGCAAGGGG + Intronic
1182203901 22:28603233-28603255 TTCATCATTTGGAAAGAAATGGG + Intronic
1183807654 22:40225234-40225256 TACAGGATTTTGAGAGATGGAGG + Intronic
949592475 3:5508850-5508872 TATAGGATTTGGGTAGATAGTGG + Intergenic
949758382 3:7439865-7439887 CAAAGTATTTGGAAAGACAGAGG + Intronic
951814842 3:26742974-26742996 TTCAGGATCAAGAAAGAAAGGGG - Intergenic
952234756 3:31467510-31467532 TGCAGGCTTTAGAAAGAATGAGG + Intergenic
953905237 3:46865315-46865337 AACAGTATTGAGAAAGAAAGGGG + Intronic
954111914 3:48438593-48438615 TCCTGGATTTGGAAAGCCAGGGG - Intronic
954367278 3:50153309-50153331 TACTGGGTTGGGAAGGAAAGAGG - Intergenic
955180884 3:56668336-56668358 TAAAGGATTTGGTAACAAACAGG + Intronic
955651220 3:61196147-61196169 TACATTATTTAGAAAGAGAGAGG + Intronic
955985764 3:64572728-64572750 CACAGGATCTGGCCAGAAAGAGG + Intronic
956358323 3:68418272-68418294 TATAGGATTTGGGTAGAAAAAGG + Intronic
956658899 3:71581331-71581353 TTCAGATTTAGGAAAGAAAGAGG + Intronic
957311449 3:78524687-78524709 TACAAGATATGCAAAGAAACAGG + Intergenic
957370464 3:79287749-79287771 TGCTGAATTTGAAAAGAAAGGGG + Intronic
957394578 3:79621288-79621310 TATAGGATTTGGGTAGATAGTGG - Intronic
958265059 3:91428780-91428802 TACATGAATTGGAAAGAAGAGGG - Intergenic
958493196 3:94805235-94805257 TAAAGGTTTGGGAAAGAAAAGGG - Intergenic
959181905 3:102991958-102991980 TGCAGTATCTGGAATGAAAGAGG - Intergenic
959868814 3:111303132-111303154 CACTAGATTTGAAAAGAAAGAGG + Intronic
960054590 3:113268119-113268141 TACAGGAGTTTGTAAGAATGTGG - Intronic
960309654 3:116105490-116105512 TATAGGATTTGGAAAGGTAATGG + Intronic
960328330 3:116324839-116324861 TACAGCCTATGAAAAGAAAGAGG - Intronic
960771192 3:121194183-121194205 TGCAAGGTTTGGAGAGAAAGGGG - Intronic
960898441 3:122530281-122530303 TCCTGGATTTGGAAGGACAGAGG + Intronic
961038533 3:123660654-123660676 GAGAGGATCTGAAAAGAAAGTGG + Intronic
961695621 3:128702251-128702273 TAGAGGATTCAGAAACAAAGAGG - Intergenic
962201878 3:133406788-133406810 TATAAGAATTGGAAAGAAAGAGG + Intronic
962246082 3:133794953-133794975 TCCATGATTTGGAATAAAAGAGG + Intronic
962250302 3:133832184-133832206 TACTGTATTTGGGTAGAAAGTGG + Intronic
963221044 3:142812268-142812290 TACAGCTTTTCAAAAGAAAGAGG - Intergenic
963522110 3:146367822-146367844 TACAGGATTTGGGTAGATAAAGG - Intergenic
964200070 3:154109065-154109087 TAAAGCATCTGGGAAGAAAGGGG - Intergenic
965104777 3:164342308-164342330 TACAGGATTTGGGTAGATAAAGG + Intergenic
966586126 3:181627165-181627187 CACAGGAGTTAGGAAGAAAGGGG + Intergenic
967740159 3:192995904-192995926 TACAGGATTTGGGTAGATAAAGG - Intergenic
970260566 4:14220094-14220116 TTCAGAATTTGGGAAGAAAGAGG + Intergenic
971150676 4:24028204-24028226 CACAGGGTTTGGAAATAAATGGG + Intergenic
971394792 4:26217951-26217973 CAAAGGTTTTGGAAAGAGAGAGG + Intronic
971426117 4:26517333-26517355 TGCAGCCTTTGGAAAGAATGAGG - Intergenic
971677790 4:29656349-29656371 TACATGAGTAAGAAAGAAAGGGG + Intergenic
971826870 4:31634770-31634792 TACAGAGTTGGAAAAGAAAGTGG - Intergenic
971855276 4:32034781-32034803 TACAGGATTGTCAAAGAAAAAGG - Intergenic
972290575 4:37686568-37686590 TGCGGGGTTTGGAAAGGAAGCGG - Intergenic
972290629 4:37686758-37686780 TGCTGGGTTTGGAAAGGAAGCGG - Intergenic
972876350 4:43365793-43365815 TACAGAATGTGGGAAGTAAGAGG + Intergenic
974458334 4:62156969-62156991 TCCTGGATTGGGAAGGAAAGTGG + Intergenic
974816095 4:67005334-67005356 AGCAGGATTAGGAAATAAAGAGG - Intergenic
974923889 4:68274591-68274613 TACAGGATTTGGGTAGGTAGTGG + Intergenic
975478923 4:74856324-74856346 TAGAGCATTCGGAAAGCAAGTGG - Intergenic
975791574 4:77958556-77958578 TACATAATTTGGACAGAAAGTGG - Intergenic
976347663 4:84023916-84023938 TTCAGGAGCTGGGAAGAAAGGGG - Intergenic
976966323 4:91045920-91045942 TACAGGATTTGGGTAGATAATGG + Intronic
977263460 4:94825758-94825780 TGCAGAATGTGGAAAGAAAATGG + Intronic
978282774 4:107036905-107036927 TAGAGGGTCTGGAAGGAAAGGGG + Intronic
979667220 4:123325519-123325541 TACTGGATTGGGAAAGAATGTGG - Intergenic
980267994 4:130545007-130545029 TACAGTATTTTCAAAGTAAGTGG - Intergenic
981657960 4:147133472-147133494 TACAGGAGTTGAGAAGAAAGGGG - Intergenic
981739418 4:147986351-147986373 GACAGGCTTTGGAAACAGAGTGG - Intronic
982306096 4:153932573-153932595 TACAGTTTTGGGAAATAAAGTGG + Intergenic
982318528 4:154056800-154056822 TATAGGATTTGGGTAGATAGTGG - Intergenic
982536405 4:156611947-156611969 AACTGGATTTGTCAAGAAAGAGG - Intergenic
983135301 4:164071870-164071892 TGCAGAATTTTGAAAGAAAAAGG - Intronic
986153498 5:5150175-5150197 AACAAGATTTGGCAAGAATGTGG - Intronic
986362997 5:7000013-7000035 TTCAGGGTTTGGAAATATAGTGG - Intergenic
986688532 5:10295039-10295061 TACAGGATCTGCAAACAATGAGG - Intronic
986830673 5:11573806-11573828 TGAAGGAGTTGGAGAGAAAGAGG - Intronic
987284224 5:16439903-16439925 TTCAGCATTTGGGAAAAAAGTGG - Intergenic
987655949 5:20806238-20806260 TTAAGGATCAGGAAAGAAAGTGG + Intergenic
987757450 5:22114909-22114931 CAGAGGATTTGAAAACAAAGAGG + Intronic
987794680 5:22611656-22611678 TACAGTCTTTGGAAAGAATAAGG + Intronic
988047701 5:25979691-25979713 TAAAGAATTTCTAAAGAAAGAGG + Intergenic
988171020 5:27655713-27655735 TCCAGAATTTGGAGAGTAAGTGG - Intergenic
988767604 5:34397670-34397692 TTAAGGATGAGGAAAGAAAGTGG - Intergenic
988906011 5:35789796-35789818 TATAGAATTTGGAGAAAAAGAGG + Intronic
988972240 5:36481152-36481174 TATAGGTTTTGGAAAGTAGGTGG - Intergenic
989265321 5:39466695-39466717 GACAAGCTTTGGAAAGAAAGAGG - Intergenic
989405348 5:41054987-41055009 TTAAAGATTTGGAAACAAAGAGG - Intronic
989632468 5:43499801-43499823 TACAGTAGTTGAAAAGAATGAGG - Intronic
990614274 5:57491190-57491212 AACTGGATGTGAAAAGAAAGAGG - Intergenic
990711820 5:58590306-58590328 ATCAGTATTAGGAAAGAAAGGGG - Intronic
990746730 5:58966160-58966182 TACAGCATCTGGGAAGAGAGTGG - Intergenic
990786507 5:59426474-59426496 TAAAGGATTTAGAAAAACAGAGG + Intronic
991123810 5:63046822-63046844 TTTAGGATGTGGAAAGAAACTGG + Intergenic
991159451 5:63480158-63480180 TACAAAATTGGGAATGAAAGTGG + Intergenic
991993858 5:72367946-72367968 CACAGGCTGTGGAATGAAAGGGG - Intergenic
992079146 5:73217726-73217748 AATAGGATGAGGAAAGAAAGAGG - Intergenic
992251733 5:74882908-74882930 TACAGGATTTGGGTAGGTAGTGG + Intergenic
992507721 5:77404556-77404578 TTCATGATTTGAAAAGAAAGTGG + Intronic
992754497 5:79891417-79891439 TAGAGGCTTCGGAAGGAAAGAGG - Intergenic
993200174 5:84805667-84805689 TACTGGATTTGAGAAGAAGGAGG + Intergenic
993278505 5:85893885-85893907 TGCAGTATTTGAAGAGAAAGTGG - Intergenic
993383919 5:87241030-87241052 TTCAGGATGTGGGAAGAAACTGG + Intergenic
993914062 5:93720019-93720041 GACAGGATTTGAAAAGGAAACGG - Intronic
994324557 5:98434800-98434822 TATAGGATTTGGGTAGATAGTGG - Intergenic
994413343 5:99437627-99437649 CACTGGAATAGGAAAGAAAGAGG - Intergenic
994532088 5:100984423-100984445 TATAGGATTTGGAAAGGTAATGG + Intergenic
994749090 5:103716488-103716510 TAGGGGATATGGAAAGAAGGGGG - Intergenic
994781720 5:104097356-104097378 TACAGGGTGTGGATACAAAGAGG + Intergenic
995073639 5:107954708-107954730 GACAGCAGATGGAAAGAAAGTGG + Intronic
995890504 5:116945757-116945779 TACAGGATTTGGGTAGATAAAGG + Intergenic
995898898 5:117046547-117046569 TACAGGATTTGGGAAGGTAATGG + Intergenic
995899741 5:117051946-117051968 TACAGGATTTGGGAAGGTAATGG + Intergenic
996021595 5:118596631-118596653 TATAGCATTTGGAAAAGAAGTGG + Intergenic
996111888 5:119575362-119575384 TACTGGCTTAAGAAAGAAAGGGG + Intronic
997110841 5:131072815-131072837 TGGAGGATTTGAAAATAAAGTGG - Intergenic
997363163 5:133308180-133308202 CACAGGATTTGCAAATAAAGTGG - Intronic
997522719 5:134533568-134533590 TACAGGATTGCAAAAGAAAATGG + Intronic
997620477 5:135287751-135287773 CACACAAATTGGAAAGAAAGGGG - Intronic
997845758 5:137284474-137284496 CACAGGATTTAGAAGGAGAGGGG + Intronic
998467803 5:142359374-142359396 TACAGGCGTTGGAAATACAGTGG + Intergenic
1001807439 5:174599876-174599898 TGCAGGAGTGGGAAGGAAAGAGG + Intergenic
1001855119 5:175004092-175004114 GACAAGATCTGGAAAAAAAGTGG - Intergenic
1002863444 6:1100428-1100450 TTTAGGATTTGGAAAAACAGAGG - Intergenic
1003764921 6:9224692-9224714 TCTAGGATTTGGAAGGCAAGAGG + Intergenic
1004807068 6:19214239-19214261 TATAGGATTTGGATAGGTAGTGG + Intergenic
1004834772 6:19517842-19517864 CACAGGATTTGGACAAAAACTGG + Intergenic
1005284638 6:24312171-24312193 TACAGGATTTGGGTAGGTAGTGG - Intronic
1005354185 6:24966981-24967003 TCCAGGATATTGAAAGAAAGTGG - Intronic
1006925611 6:37653005-37653027 CACAGCATTTGGAAAGAAAAAGG + Intronic
1006972456 6:38060538-38060560 TCCAGGAGTAAGAAAGAAAGAGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008583819 6:52930722-52930744 TTCTAGGTTTGGAAAGAAAGGGG + Intergenic
1010187030 6:73156776-73156798 TTCAAGGTTTGGAAAGAATGAGG + Intronic
1010471047 6:76229019-76229041 ATCAGGGCTTGGAAAGAAAGTGG + Intergenic
1010757587 6:79684193-79684215 TACAGGATTTGGTAATCAACTGG - Intronic
1011226305 6:85111444-85111466 TACAATATTTGGGAAGACAGGGG + Intergenic
1011597892 6:89033794-89033816 TACAGGTTTTGGAAAGAAAAAGG - Intergenic
1011739756 6:90348004-90348026 GGAAGGATTTGGAGAGAAAGAGG + Intergenic
1013660307 6:112289190-112289212 TAGAGGATTGGGTAAGAGAGAGG - Intergenic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1014759596 6:125341865-125341887 TAGAGGATTTGGAGGGAGAGTGG + Intergenic
1015286880 6:131495672-131495694 TACAGGATTTAGGAAGGAAGAGG + Intergenic
1015329801 6:131963649-131963671 CACTGGATTTGGCAACAAAGAGG - Intergenic
1015685591 6:135855978-135856000 CACAGAATTTGGAAAGAAAAAGG - Intronic
1015698936 6:136013361-136013383 TACAGGATTTGGAAAGAAAGAGG - Intronic
1015950133 6:138544635-138544657 TTCAAGTTTTGGAAATAAAGTGG - Intronic
1017402120 6:154076639-154076661 TTCAGGATCTGGAAAGGAAGAGG - Intronic
1018412113 6:163560504-163560526 GGTAGGATTTGGAAAGAGAGAGG + Intronic
1018494389 6:164334745-164334767 TGTAAGGTTTGGAAAGAAAGAGG + Intergenic
1018619872 6:165719761-165719783 GACAGCATTTGGAAAAAAATAGG + Intronic
1018884945 6:167927473-167927495 TGCAGGATTTAGAACAAAAGAGG + Intronic
1020601856 7:10285428-10285450 TTCAGATTCTGGAAAGAAAGTGG + Intergenic
1020617125 7:10473479-10473501 TTCAGGTTTTGGTAAGAAGGAGG - Intergenic
1021311718 7:19105933-19105955 TACAGGACTTGAAAAGAGAAGGG + Intronic
1021741627 7:23691832-23691854 TATAGAATTTAGAAAGCAAGTGG + Intronic
1021991212 7:26143147-26143169 TACATCATTTGGAAGCAAAGGGG - Intergenic
1022377830 7:29831119-29831141 TACAAAATTTGGAAAAAATGTGG - Intronic
1022493152 7:30836211-30836233 GACAGGACTGGGAAAGAAAATGG - Intronic
1023662816 7:42488217-42488239 TACAAGTTTTTGAAAGGAAGGGG + Intergenic
1023757853 7:43436497-43436519 TACAGGATTTGGGTAGACAGTGG + Intronic
1023807279 7:43881876-43881898 TACAGGATTTGGCAACAGATTGG - Intronic
1024020350 7:45362811-45362833 TTCAGGTATTGGAAAGAGAGTGG + Intergenic
1024881654 7:54092637-54092659 TACAGAATATTGAAAGAAATTGG - Intergenic
1024894795 7:54245642-54245664 GACAGGAGTTTGAAAGGAAGAGG - Intergenic
1026397346 7:69969022-69969044 CACAGGATTGGGAAAGATTGTGG + Intronic
1027288879 7:76680163-76680185 TACAGTAATTGGAAAACAAGTGG - Intergenic
1027776439 7:82471278-82471300 AACAGGATTGGGAAGGAGAGAGG + Intergenic
1027855246 7:83502656-83502678 TACAGGATATGAAAAGATAATGG - Intronic
1027959330 7:84924125-84924147 TACAGGACTTTGAAATAAATGGG + Intergenic
1028573165 7:92314914-92314936 TACTGGAGATGGAAAGAATGAGG + Intronic
1028757982 7:94459833-94459855 TATATGTGTTGGAAAGAAAGAGG - Intergenic
1028772945 7:94647844-94647866 TAGAGGATTTGGCCAGATAGGGG - Intronic
1028971619 7:96865243-96865265 GACAGTATTTGGAAAGAAGTTGG - Intergenic
1029306890 7:99626161-99626183 AACAGGATTTGGAATCACAGAGG + Intronic
1030439985 7:109577150-109577172 TACAGCAAATGGAAACAAAGTGG + Intergenic
1031251396 7:119387471-119387493 TACAGGATTTGAAAAGGAGTAGG - Intergenic
1031804099 7:126287215-126287237 TAAAGGATTTAGAAGTAAAGAGG + Intergenic
1032624856 7:133580980-133581002 TACAGCACTCGGAAGGAAAGAGG - Intronic
1032948416 7:136878713-136878735 TTCAAGATTTAGAAAGAAAAAGG - Intronic
1033462898 7:141563483-141563505 AACAGGACTTAGAAAGAAAATGG - Intronic
1033616368 7:143019092-143019114 TACAAGATATGCAAAGAAACAGG + Intergenic
1035092133 7:156321882-156321904 AACAGTATTTGGAAAGAACCTGG + Intergenic
1035681879 8:1494383-1494405 TGCAAGGTTTGGGAAGAAAGAGG - Intergenic
1035843882 8:2842334-2842356 GACAGGTTCTGGAAAAAAAGTGG + Intergenic
1036573249 8:10000330-10000352 TTCAGGATGCAGAAAGAAAGAGG - Intergenic
1037171055 8:15892592-15892614 TCCAGGAATGGGAAAGTAAGTGG - Intergenic
1037628512 8:20629913-20629935 GACAGGATTGGGTAAGAAATTGG + Intergenic
1037994263 8:23341196-23341218 TTCAGGTTCTGGGAAGAAAGAGG + Exonic
1038824814 8:30988988-30989010 CAAAGGATTGGGAAAGAAGGTGG - Intergenic
1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG + Intergenic
1039499266 8:38003830-38003852 TATAGGATTTGGGTAGATAGTGG + Intergenic
1039743598 8:40404170-40404192 GACAGAATTAGGAAAGAGAGAGG + Intergenic
1040571676 8:48616864-48616886 AAGAGGATTTGGAAGGAAAGAGG + Intergenic
1040648611 8:49426174-49426196 TATAGGATTTGGGTAGATAGTGG - Intergenic
1040724687 8:50368745-50368767 AACAGGATATGGAAACAAAGAGG + Intronic
1040728180 8:50408867-50408889 TATAGGATTTGGATAGCAAAGGG + Intronic
1041566647 8:59286138-59286160 TCCATGACTTGGAAAAAAAGAGG - Intergenic
1041657251 8:60366013-60366035 TAGAGGATTTGGGAGGAAACGGG + Intergenic
1041906880 8:63042618-63042640 AACAAGATTAGAAAAGAAAGAGG - Intergenic
1042947446 8:74169449-74169471 TTAAGGAATGGGAAAGAAAGAGG - Intergenic
1043160404 8:76839873-76839895 TACAGGGTTTCCAGAGAAAGTGG + Intronic
1043223261 8:77693156-77693178 TATTGGATTTGGCAAGAAGGAGG - Intergenic
1044258150 8:90090357-90090379 TATAGGATTTGGAAAGGAAATGG + Intronic
1044258928 8:90095568-90095590 TATAGGATTTGGAAAGGTAATGG + Intergenic
1044888953 8:96811899-96811921 TGGAGGAAGTGGAAAGAAAGAGG + Intronic
1044900890 8:96943132-96943154 TAGAGGCTTTCCAAAGAAAGAGG - Intronic
1045279216 8:100735203-100735225 TACAAGTTTTGAAAAGAAAAAGG - Intergenic
1046306543 8:112374321-112374343 TACAGGATATGGAAAAAGAGAGG - Intronic
1046702460 8:117417040-117417062 TAGAGGATTTTAAAAGAGAGAGG - Intergenic
1046852158 8:118986876-118986898 TATAGGATGTGGAAGGAATGGGG + Intergenic
1049497118 8:142941279-142941301 ACCAGGATTTGGAGAGGAAGAGG + Intergenic
1049957690 9:708595-708617 TCCAACATTTGGGAAGAAAGCGG + Intronic
1050040703 9:1490321-1490343 AATTTGATTTGGAAAGAAAGAGG - Intergenic
1053220977 9:36312864-36312886 GACAAGTTTTGGAAAGAATGTGG + Intergenic
1054730416 9:68697379-68697401 AACAGGATGGGGAAAGCAAGAGG - Intergenic
1054848713 9:69823752-69823774 TATAGGATTTGGATAGATAAAGG + Intronic
1056974794 9:91242422-91242444 TCCTTGATTTGGAAAGAATGAGG - Intronic
1057013776 9:91632351-91632373 TACAGCATTTTGAAAGGCAGAGG - Intronic
1058175713 9:101734824-101734846 TAAAGGATTCGAGAAGAAAGTGG - Intronic
1058319627 9:103612670-103612692 TACAGGTTTTGGAGAGGATGTGG - Intergenic
1058510239 9:105710554-105710576 TATATAATTTGGACAGAAAGTGG - Intronic
1058722306 9:107775266-107775288 CACAGTAATTGAAAAGAAAGAGG + Intergenic
1060513678 9:124252255-124252277 TAGAGGATCTGGGAAGAATGAGG - Intergenic
1060630442 9:125152966-125152988 TACAGTACTTGAAAGGAAAGGGG + Intronic
1061480352 9:130895074-130895096 AACTGGATTTGGGTAGAAAGTGG - Intergenic
1062726618 9:138077703-138077725 AACAGGATATGGAGAGAGAGAGG + Intronic
1185871507 X:3668649-3668671 TACAGAACTTGGAAGGCAAGAGG - Intronic
1186088001 X:6012345-6012367 TACATTATTTGGAAGCAAAGAGG + Intronic
1186814451 X:13222539-13222561 TAGAGGTTGTGGAAAGAAAGGGG - Intergenic
1186953867 X:14658597-14658619 AACTAGATTTGGAAAGAAAAAGG - Intronic
1187952469 X:24484565-24484587 AACAGGATTTCTAAAGAGAGGGG + Intronic
1188431535 X:30109100-30109122 TACAGGATTTGGGTAGATAAAGG - Intergenic
1188670503 X:32876222-32876244 TAAAGGATGTGGCAAGAATGAGG - Intronic
1188774306 X:34194231-34194253 AGCAGGATTTGGAGAGAGAGAGG - Intergenic
1188821262 X:34778099-34778121 TAAAGTATTGGGAGAGAAAGAGG - Intergenic
1189459665 X:41229386-41229408 TGCAGGATTTGGTAAGCAACAGG - Exonic
1191615557 X:63166623-63166645 TTCAGGATTTGGGAGGACAGAGG - Intergenic
1191620741 X:63212300-63212322 TTCAGGATTTGGGAGGACAGAGG + Intergenic
1191875194 X:65788451-65788473 TTCAGGATATGGAAAGTGAGGGG + Intergenic
1192618105 X:72648977-72648999 GGCAGGATTTGGAGAGGAAGAGG + Intronic
1192859108 X:75047207-75047229 TACAAGACATGGAAAGAAACAGG - Intergenic
1193131895 X:77929075-77929097 TACAGGAAATGGTAAGGAAGTGG + Intronic
1194993071 X:100565803-100565825 TACAAGTGTTGGAAAGAATGTGG + Intergenic
1195043209 X:101032950-101032972 TAAAGCATTTGGGAAGAAATTGG + Intronic
1195327160 X:103767062-103767084 TACAGGATTTGGGTAGGTAGTGG + Intergenic
1196295169 X:113988671-113988693 TACAGGATTTGGGAAGGTAATGG - Intergenic
1196774189 X:119323173-119323195 TACAGGATTTGGGAAGGTAATGG + Intergenic
1197612086 X:128651183-128651205 TCCAGGAGTTGGAAAAACAGAGG - Intergenic
1197793374 X:130277581-130277603 TACAGGATTTGGACAGGTAGCGG - Intergenic
1198034718 X:132789911-132789933 TTAAGGATTAGCAAAGAAAGTGG + Intronic
1198498523 X:137218788-137218810 TCCATGATTTAGAAAAAAAGAGG + Intergenic
1198924957 X:141779412-141779434 TAAAGGATTTAGAAACAAAAGGG + Intergenic
1199183794 X:144891203-144891225 TCCAGGCTTTAGAAAGATAGGGG - Intergenic
1199497451 X:148468776-148468798 AAGTGGAGTTGGAAAGAAAGAGG + Intergenic
1199668332 X:150120034-150120056 AACAGGTTTTGAAAAGGAAGAGG + Intergenic
1200309353 X:155061878-155061900 TTCAGGATTTGAAAAAGAAGAGG - Exonic
1200585071 Y:4998983-4999005 TACAGGATAAGCACAGAAAGTGG + Intergenic