ID: 1015701841

View in Genome Browser
Species Human (GRCh38)
Location 6:136044623-136044645
Sequence GTAGATTACAAGTTCTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015701841 Original CRISPR GTAGATTACAAGTTCTCTAT AGG (reversed) Intronic
908701897 1:66911283-66911305 GTAGCTTACATGCTCTCTCTGGG + Intronic
909354843 1:74696769-74696791 GTAGATTACAAGTTCCATCCAGG + Intergenic
913264224 1:117028531-117028553 GTAGATTACAAGTCATCCATAGG + Intronic
913527258 1:119705546-119705568 CTAGACTGCAAGTTCCCTATGGG + Intronic
914748549 1:150516423-150516445 GTAGCTTACAAGTGCTCTCCGGG - Intergenic
916191649 1:162184938-162184960 GTACATCAGAAGTTCACTATGGG + Intronic
916326813 1:163570528-163570550 TTAAATTACAAGTTCCTTATAGG - Intergenic
917630615 1:176887932-176887954 GTAGATTGAAAGCTCTCTAAAGG + Intronic
918271271 1:182902441-182902463 ATAGATTACAAATTATCTAAGGG - Intronic
918615551 1:186540399-186540421 GTTGAATTCAAGTTCTCTCTGGG - Intergenic
919769332 1:201147272-201147294 GTAGAGTTCATGGTCTCTATGGG - Intronic
922236331 1:223725493-223725515 GCAGATTGCACGTTCTCTTTGGG + Intronic
922916598 1:229263157-229263179 CTAGATTATAAGTTCTATAAGGG - Intergenic
923985351 1:239375727-239375749 GTAGGTTTCAAGTTCTCCTTAGG - Intergenic
1062807600 10:435925-435947 GTAGGTTTAAAGTTCTATATAGG - Intronic
1063056396 10:2509479-2509501 GCAGTTTCCAAGTTCACTATGGG - Intergenic
1067958530 10:50820877-50820899 CTAGATTACAAGGTGTCTAAGGG + Intronic
1069399456 10:68027056-68027078 CTAAATTAGAAGTTCTGTATTGG + Intronic
1073265072 10:102222604-102222626 GTAGATAACAAATTCTGTTTGGG + Intergenic
1075433612 10:122413407-122413429 ATAAATTACAAATCCTCTATTGG + Intronic
1077132340 11:979322-979344 GTTTCTTACAAGTTCTTTATTGG + Intronic
1078140271 11:8687428-8687450 CCATATTACAAGTCCTCTATGGG - Exonic
1080251487 11:30238772-30238794 TTAGCTTCCAAGTTTTCTATGGG + Intergenic
1081880188 11:46443371-46443393 GTAGATAACAACTGCTCAATAGG + Intronic
1082677059 11:56118072-56118094 GTAGATTATAAATTCTCAGTGGG - Intergenic
1085047961 11:73364204-73364226 GTAGACCACAAGCTCTCCATTGG - Exonic
1087604310 11:100357850-100357872 GTAGGTTACATATTCTCTTTGGG + Exonic
1088101259 11:106158838-106158860 CTAGATTATAAGTGCTCTCTGGG - Intergenic
1089087416 11:115834344-115834366 CTAGAATACAAGTTCTTTGTAGG - Intergenic
1090825103 11:130379649-130379671 TTAGATTTCAAGGTCTCTCTGGG - Intergenic
1096729814 12:53600106-53600128 TGAGATCTCAAGTTCTCTATTGG + Intronic
1096900902 12:54880837-54880859 CTAGATTATAAATTCTCTAAAGG - Intergenic
1097444780 12:59656980-59657002 GGACAATACAAGTTCTTTATAGG + Intronic
1107761547 13:43684650-43684672 GAAGATTACCTGTTCTCTGTAGG - Intronic
1110937741 13:81313767-81313789 GTAGAATGCAAGTTCACTGTGGG + Intergenic
1113084626 13:106555445-106555467 GTAGATTATAAGTGGTCTGTGGG - Intronic
1113316583 13:109186522-109186544 GTAGTTTACAACTTCACTAGAGG + Intronic
1114503363 14:23188786-23188808 GTAGATGACAAGTTCCCTGAGGG + Intronic
1120224769 14:81778267-81778289 CTAAATTACTATTTCTCTATTGG + Intergenic
1120579522 14:86228507-86228529 CTAGAATACAAGTTCTGTAGAGG + Intergenic
1127668010 15:61168085-61168107 ATACATTACAAGTTTTCTACAGG - Intronic
1130863527 15:87911882-87911904 GTAGCTTAGAAGTTCTTTAAGGG - Intronic
1139749557 16:69101092-69101114 GTAGATTGCAAGTACTGTTTGGG - Intergenic
1145034737 17:19533353-19533375 GTAGATTCTAAGTTCTCTAATGG + Intronic
1146087665 17:29845000-29845022 GTAGATTATACTTTCTCTAAGGG + Intronic
1147010801 17:37445797-37445819 GTAGATCAGTAATTCTCTATTGG + Intronic
1150318258 17:64188016-64188038 GTAGATTACAAGTTCCCCAAAGG + Intronic
1154467491 18:14662812-14662834 GTAGATTCAAAATTCTATATTGG - Intergenic
1156849631 18:41711479-41711501 TTAGTTTACAAATTCTCTCTAGG - Intergenic
925669773 2:6298592-6298614 GGAGATTTCTAGTTCTTTATTGG - Intergenic
925799848 2:7587608-7587630 ATAGATTACAATCTCTCTCTTGG + Intergenic
927270322 2:21201137-21201159 GCAGAATACATGTTCTCTTTAGG - Intergenic
930486779 2:52020224-52020246 GTAAACTGCACGTTCTCTATTGG + Intergenic
933308525 2:80631989-80632011 GTTGATTAGTACTTCTCTATTGG - Intronic
938606923 2:132903918-132903940 GTATATTACAATTTATGTATTGG + Intronic
942820876 2:180113339-180113361 GTAGATTCCAAGTTCAAAATGGG - Intergenic
1169771891 20:9210188-9210210 GTTCATTACAAGTTTTTTATGGG - Intronic
1174572420 20:51511538-51511560 GAAGATTGCAAGTTCTCTTTGGG - Intronic
1177512367 21:22105450-22105472 GTAAATTAAAAGGGCTCTATCGG - Intergenic
1178943636 21:36928183-36928205 TTGGAATACAAGTTCTCTAAAGG - Intronic
957992462 3:87644691-87644713 ATACATTGCAAATTCTCTATAGG + Intergenic
962725984 3:138227339-138227361 GTAGATTAAAAAGCCTCTATTGG - Intronic
963689881 3:148486094-148486116 GTATATTAAAAGTTTTTTATTGG + Intergenic
965509237 3:169549892-169549914 CTAGATTTCAAGCTCTCTAAAGG - Intronic
977750532 4:100604788-100604810 GGAGATGACAAGTTATCTACAGG - Intronic
983384316 4:167038604-167038626 TTAGACCACAGGTTCTCTATAGG - Intronic
983629316 4:169833684-169833706 GGAAATTACAGGTTCTGTATAGG - Intergenic
983804281 4:171974247-171974269 GTAGTTTACAATTTCTCAGTAGG + Intronic
986187428 5:5457979-5458001 CCAAATTACAAGTTTTCTATAGG + Intronic
986848493 5:11782933-11782955 GGACATAACAAGTTCTCTTTTGG + Intronic
993428790 5:87804540-87804562 ATAGATTACTAGTTGTCTAAAGG + Intergenic
993521135 5:88902683-88902705 GTAGATTTAAAGTTATTTATGGG + Intronic
996003374 5:118390146-118390168 GTAGGATACAAATTGTCTATTGG - Intergenic
996132435 5:119797803-119797825 TTATATTACAAATTCTATATAGG - Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999162443 5:149513971-149513993 GTAGATAACAAGTATTCTGTTGG - Intronic
1002647368 5:180666566-180666588 GTAGATTACTGGTTGTTTATTGG + Intergenic
1006248330 6:32759330-32759352 CTAGATTGCAAGTTCTATAAAGG - Intronic
1007326415 6:41064221-41064243 GTATATTTCAAGTCCTCTAAGGG - Exonic
1009405421 6:63306502-63306524 GTAGGTTACAACTTCACTCTTGG - Intronic
1009673161 6:66783044-66783066 GGAGATTCCAAGTTCTCAAAGGG + Intergenic
1015110955 6:129590764-129590786 GTAGAATACAGGTTCTCTAGTGG - Intronic
1015701841 6:136044623-136044645 GTAGATTACAAGTTCTCTATAGG - Intronic
1021819658 7:24484176-24484198 TTATATTACAAGTTCTCCAGAGG + Intergenic
1024390464 7:48806031-48806053 GTAGATTACAAGTTCAAAATGGG + Intergenic
1026094819 7:67337318-67337340 GTAGATTTAAAGTTATTTATGGG - Intergenic
1026402828 7:70033008-70033030 GTAGATTAGTAGTTGTCTAGGGG + Intronic
1028697945 7:93738446-93738468 GTATATTATAAGTACTCTATTGG + Intronic
1033642965 7:143280167-143280189 GAAGATTGCAAGCTCTGTATTGG - Intronic
1036417127 8:8561312-8561334 GAAGATTCCAAGTTCTGGATGGG - Intergenic
1042792693 8:72625847-72625869 GTAGAACACGAGTTCTCCATGGG + Intronic
1048321116 8:133400899-133400921 GGAGATTTCAACTTCTCTAGAGG - Intergenic
1051581602 9:18681726-18681748 TTAGATTAAAAGTTTTCGATGGG + Intronic
1051963471 9:22797292-22797314 GTAGATTAGGAGTTCTTTAAGGG - Intergenic
1056213666 9:84388609-84388631 GTAAGTGACAACTTCTCTATGGG - Intergenic
1058580500 9:106451149-106451171 GTAGAGTACAATTTGTCCATAGG - Intergenic
1058650278 9:107169220-107169242 GTAGATTGGAAGTTTTCTGTGGG + Intergenic
1187833887 X:23411132-23411154 GTAGATTACAACTTCTTCAAAGG - Intergenic
1188994429 X:36865706-36865728 GTATATTACATGTTTTTTATAGG - Intergenic
1191671952 X:63755957-63755979 GCAGATTGCAAGTTCTGTAGAGG - Intronic
1196123760 X:112078487-112078509 CTAGACTTCAATTTCTCTATAGG + Intronic
1196593736 X:117519338-117519360 CTAGATTACAAGCTCTTTAAGGG + Intergenic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1198564417 X:137889683-137889705 TCAGATGCCAAGTTCTCTATGGG + Intergenic
1199725359 X:150574497-150574519 TTAAATTACACATTCTCTATTGG - Intronic