ID: 1015705482

View in Genome Browser
Species Human (GRCh38)
Location 6:136083193-136083215
Sequence GAGAACAGTCGGAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 2, 2: 0, 3: 9, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015705477_1015705482 14 Left 1015705477 6:136083156-136083178 CCTATCAGTGATGAACTCACTGA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG 0: 1
1: 2
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015705482 Original CRISPR GAGAACAGTCGGAAGACTGA GGG Intronic
905271516 1:36790624-36790646 GAGAACTGACTGAAGAGTGAAGG + Intergenic
906237958 1:44223163-44223185 CAGAACAGTGGAAAGACAGATGG + Intronic
906562435 1:46768989-46769011 GACAAGGGTCGGAAGACAGAGGG - Intronic
908194291 1:61733903-61733925 GAGAACAAGGGGAAAACTGAAGG - Intergenic
909834269 1:80233513-80233535 TAGCATAGTCTGAAGACTGAAGG + Intergenic
922799094 1:228356121-228356143 GAAAACAGTCGGAATAGCGAGGG - Intronic
1063026412 10:2183358-2183380 GAGTAGATTCTGAAGACTGAAGG + Intergenic
1064346866 10:14540534-14540556 GAGAACAGGGGGAGGACAGAGGG - Intronic
1067079832 10:43206587-43206609 GAGGACAGTCTGAGGACTCAGGG + Intronic
1070356211 10:75642822-75642844 GGGAACACTAGGAAGCCTGAGGG - Intronic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1076310739 10:129505858-129505880 GAGAGCAGTGTGAAGCCTGAGGG + Intronic
1076983166 11:216057-216079 TGGAACAGTCTGAGGACTGAAGG - Exonic
1079328008 11:19511176-19511198 GAGAACAGTCGGGAGACACATGG + Intronic
1081634478 11:44711730-44711752 GAGAACTGGCAGAAGACAGAAGG + Intergenic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1085685619 11:78619645-78619667 GACAAAAGTGGAAAGACTGATGG - Intergenic
1086431509 11:86741090-86741112 GATATCAGGCGGAAGAGTGAAGG - Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088574076 11:111252708-111252730 GAGGACAGAGGGAAGACTAATGG - Intergenic
1089384150 11:118057062-118057084 GAGAGCAGCCGGAAGCCTCAAGG + Intergenic
1089759607 11:120713419-120713441 GAGAGCAGGAGGAAGACAGAGGG + Intronic
1090048805 11:123359263-123359285 CAGAATAGGCGTAAGACTGATGG - Intergenic
1090113657 11:123943161-123943183 GAGAACAGTGGCAAGAATGCAGG + Exonic
1090549900 11:127808442-127808464 GAGAATAGCCGGAAAACCGAGGG - Intergenic
1090655165 11:128837672-128837694 AAGAACAGTGGGAAGTCTGATGG - Intronic
1092875078 12:12840818-12840840 GTCTACAGTCAGAAGACTGAAGG - Intergenic
1093525427 12:20099562-20099584 GAAAACAGTCAGCAGAGTGAGGG + Intergenic
1095536707 12:43257402-43257424 GAGAACAGTTTGAATAATGATGG + Intergenic
1106603171 13:31204528-31204550 GAGAAAGGACGGAGGACTGAAGG + Intronic
1106980978 13:35279723-35279745 AAGGACAGACTGAAGACTGATGG - Intronic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1118055367 14:62074248-62074270 GAGAAAAGTGTGGAGACTGAAGG + Intronic
1118253955 14:64188859-64188881 GAGAACAGTTGGAAGAGAGGAGG + Intronic
1121547953 14:94776300-94776322 GAGATAAGTTGGGAGACTGAGGG + Intergenic
1123435984 15:20254814-20254836 GAGAACAGTGGGGAGGGTGAGGG - Intergenic
1124642655 15:31405837-31405859 GAAAACAGTCACAAGACAGAAGG + Intronic
1125045197 15:35237398-35237420 GACAACAGTCGGTCGAATGAAGG + Intronic
1128532742 15:68465633-68465655 GAGAACTGGCTGAAGACTGGTGG - Intergenic
1128577725 15:68787879-68787901 GACAACAGTCGGTCGAATGAAGG - Exonic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1131519789 15:93105542-93105564 GAGAACATTTGCAAGAATGAGGG + Intergenic
1136848615 16:33596173-33596195 GAGAACAGTGGGGAGTGTGAGGG + Intergenic
1140550924 16:75864687-75864709 TAGAACACTCTGAAGAGTGAAGG + Intergenic
1203110322 16_KI270728v1_random:1444822-1444844 GAGAACAGTGGGGAGTGTGAGGG + Intergenic
1144060977 17:11583256-11583278 AAGCACAGGAGGAAGACTGAGGG - Intergenic
1147879302 17:43643630-43643652 GAGAACAGAGGGAAGCCGGAGGG - Exonic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1153046967 18:865044-865066 GAGAGAACTCGGATGACTGACGG + Intergenic
1154099306 18:11455098-11455120 GTCAACAGGCGGTAGACTGAAGG - Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1158603100 18:58871553-58871575 GAGCACAGTTGGTGGACTGAGGG + Intronic
1159662091 18:71110267-71110289 GGGAACAGTGGCAGGACTGACGG - Intergenic
1159973789 18:74685589-74685611 GAGAACAGCCGGAATAGTCAGGG - Intronic
1162120861 19:8466922-8466944 GAAAACAGTAGAAAGACTCATGG - Intronic
1163532079 19:17855878-17855900 GTGAAAATTCGGAAAACTGATGG - Intergenic
1164773949 19:30836202-30836224 GAAAACAGACGGAACACTCAAGG + Intergenic
1164907634 19:31980308-31980330 TGGAACAGTCGGAAGAATGATGG - Intergenic
1165032136 19:33005684-33005706 GAGAACAGTGGGGAGTGTGAGGG - Intronic
925460386 2:4057919-4057941 GACAAAAGTGGGAAGGCTGATGG - Intergenic
928676488 2:33656230-33656252 GAGAAAAGCCAGAAGTCTGATGG - Intergenic
929872852 2:45773184-45773206 GAGCAGAGTTGGAAGACTGTGGG - Intronic
931777924 2:65556134-65556156 GAAGACAGACGGAAGGCTGATGG + Intergenic
934886468 2:98029723-98029745 GAGAAAAGGCGGAAGACAGAAGG + Intergenic
935598722 2:104900525-104900547 GAGAAGAGTAGGAAGGCTGGGGG - Intergenic
935610383 2:105017610-105017632 GAGAACAGTCTCAATATTGATGG + Intergenic
939894801 2:147778109-147778131 GTGAATACTCAGAAGACTGAAGG + Intergenic
939988189 2:148852831-148852853 GTGAACAGTCAGAAGAGTAAAGG - Intergenic
942777403 2:179599779-179599801 AATAACATTCTGAAGACTGATGG + Intronic
943171916 2:184412515-184412537 GAGAACATTCAGAAGACTTTTGG + Intergenic
944660717 2:201919373-201919395 GAGAACAGTCTGAACACAGAAGG - Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1170153955 20:13252856-13252878 GAGAGAAGTGGGAAGACAGAAGG - Intronic
1175287907 20:57850079-57850101 GAGAAGAATCGGAAAACTCAGGG - Intergenic
1175883561 20:62274577-62274599 CTCGACAGTCGGAAGACTGAAGG - Intronic
1175886703 20:62296009-62296031 AAGAACGGTAGGAAGGCTGATGG + Exonic
1177325625 21:19584717-19584739 GAGCAGAGTGGGAAGAGTGAGGG - Intergenic
1179214010 21:39350240-39350262 GGGAAAAGTGGGAAGATTGAGGG + Intergenic
1181417211 22:22769068-22769090 AAGGACAGTGGGAAGCCTGAAGG - Intronic
1182615047 22:31582339-31582361 GAGAACAGTTTGAACACGGAAGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
954574579 3:51668780-51668802 AGGAACAGAAGGAAGACTGATGG + Intronic
954901283 3:54022168-54022190 GAGAACAGAAGGAAGAGTCAGGG + Intergenic
955012204 3:55029084-55029106 GAGAACAGTCTAAAGACTTGTGG - Intronic
955086677 3:55709569-55709591 GAGAACTGTGGGAGGACGGAAGG + Intronic
956226765 3:66968956-66968978 GAGAAAAGTTGGGAGACTTAAGG + Intergenic
956273351 3:67471218-67471240 GAGAACCCTGGGAAGTCTGAAGG + Intronic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
958789181 3:98631137-98631159 GAGAAAAGTGGAAAGGCTGATGG + Intergenic
960130382 3:114049603-114049625 GAGAAGAGGAGAAAGACTGAAGG + Intronic
964337605 3:155672963-155672985 GACAACAGTTTGGAGACTGATGG - Intronic
966170659 3:177076346-177076368 GAGAACAGTGTGAAGACACAGGG - Intronic
969656162 4:8499711-8499733 GAGAACAGTGGGCAGAAAGAGGG + Intergenic
975061315 4:70005135-70005157 AGGAACAGTAGGAAGAGTGATGG - Intergenic
975064510 4:70043486-70043508 GAGAAGAGTCAGAACACTGAAGG - Intergenic
979786573 4:124722348-124722370 GAGAGCAAGAGGAAGACTGAGGG - Intergenic
982548225 4:156761091-156761113 AAGAGCAGTCTGAAGACAGAAGG + Exonic
983144578 4:164197617-164197639 GACAACAGTCGGTCGAATGAAGG - Intronic
983334613 4:166375840-166375862 GAGGACAGTGGGTAGTCTGAAGG + Intergenic
985575599 5:672127-672149 GGGAACAGTCCGAAGACTTTAGG + Intronic
986666527 5:10109383-10109405 CAGAACAGTTCGTAGACTGAAGG - Intergenic
987991867 5:25223333-25223355 GAGTACAGTCAGTTGACTGATGG + Intergenic
988266048 5:28952411-28952433 GAGATCAGTCTAACGACTGATGG + Intergenic
995084385 5:108090301-108090323 GAGAAAATGTGGAAGACTGAGGG - Intronic
995446924 5:112254873-112254895 GAGAACAGACTGAGGAGTGAGGG - Intronic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
996719939 5:126620083-126620105 GAGAACAGCCAGAAAACTTAAGG - Intronic
997269990 5:132528304-132528326 AAGAACAGCAGGAAGACAGATGG - Intergenic
997584290 5:135035269-135035291 GAGAGAAGCTGGAAGACTGAGGG - Intronic
998999169 5:147900969-147900991 GAGAACATTGGGAAGACTCTGGG + Intronic
1000896866 5:166865814-166865836 GAGAAAAGTGGGAAGAGAGATGG + Intergenic
1001430791 5:171660418-171660440 GAGAAAACTGGGAAGTCTGATGG + Intergenic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1005731906 6:28705848-28705870 GAGAAAAGTCTGAAGAGTTAAGG + Intergenic
1007093205 6:39197166-39197188 GAGAAGAGACAGAAGAGTGAGGG + Intronic
1013301304 6:108807522-108807544 GAGAAAAATTGAAAGACTGAAGG - Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1017695529 6:157011740-157011762 GACAACAGTAGGAAGTCTTATGG - Intronic
1020210444 7:6154456-6154478 GAGAGCAGGAGCAAGACTGAGGG + Exonic
1024278501 7:47698437-47698459 CAGAAGAGTGGGAAGACAGAAGG + Intronic
1024586857 7:50849596-50849618 GAGAACAGGCTGAAGATAGAGGG - Intergenic
1025017446 7:55450259-55450281 GAGAAGAGGCGGAGGACTGGTGG - Intronic
1025061495 7:55812420-55812442 GAGGAAAGTGGGGAGACTGAGGG + Intronic
1026447136 7:70494659-70494681 GAGAACAGACTGGAGACTGCTGG + Intronic
1031893116 7:127318275-127318297 GAGAATAGTAGGAGGACAGAAGG + Intergenic
1032187807 7:129742428-129742450 GGGCAGAGTCGGAAGACTGCTGG - Intronic
1032578060 7:133076612-133076634 GAGATGAGTGGGAAGACTGTAGG - Intronic
1032684078 7:134213032-134213054 CAGAATAGTCAGCAGACTGATGG + Intronic
1032808097 7:135378648-135378670 GAAAACACTCAGTAGACTGATGG + Intronic
1039039621 8:33395092-33395114 GAGCACTGTAAGAAGACTGAAGG + Intronic
1040605902 8:48930842-48930864 GAGAACAGTCAGAACACCTATGG + Intergenic
1044057300 8:87587021-87587043 GACAACAGGCTGAAGACTCAGGG + Intronic
1044688935 8:94857439-94857461 GAGAACATTGGGAAAAATGAAGG + Intronic
1044768698 8:95605976-95605998 GAAAGCAGCTGGAAGACTGAAGG - Intergenic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1051513216 9:17903185-17903207 GAGAAATATAGGAAGACTGAGGG + Intergenic
1052554280 9:29993707-29993729 GAGAACTGTAGGAAGAGAGATGG + Intergenic
1052848994 9:33364553-33364575 GAAAACAGAAGGATGACTGACGG - Intronic
1053535374 9:38920334-38920356 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054207595 9:62144738-62144760 GAGATGAGTGGGAAGACTCAGGG - Intergenic
1054630757 9:67443616-67443638 GAGATGAGTGGGAAGACTCAGGG + Intergenic
1058466815 9:105237167-105237189 GAAAGCATTCCGAAGACTGAAGG + Intergenic
1058811012 9:108639536-108639558 GAGAACATTCGGAGGTATGAAGG + Intergenic
1061162919 9:128906080-128906102 GGGAACACTCGGAAGACCAAAGG - Intronic
1186933364 X:14419369-14419391 TTGAATAGTCAGAAGACTGAGGG - Intergenic
1191226376 X:58048759-58048781 GAGAAAGGTGGGAAGACTGATGG - Intergenic
1191630430 X:63315773-63315795 GACAACAGTGGAAAGGCTGATGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1197044127 X:121975880-121975902 GAGAAAAGTGGAAAGGCTGATGG - Intergenic
1197162924 X:123344374-123344396 GAGACAAGTCAGAAGAGTGAGGG + Intronic
1197637191 X:128928378-128928400 GAGAACATCCCAAAGACTGAGGG - Intergenic
1198799352 X:140433177-140433199 AAGAAGAGTCGGGAGAATGAGGG - Intergenic