ID: 1015708766

View in Genome Browser
Species Human (GRCh38)
Location 6:136116786-136116808
Sequence ATGAGCCATCTGGCCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015708764_1015708766 0 Left 1015708764 6:136116763-136116785 CCACTTGGGAATCATAATCATTC 0: 1
1: 0
2: 1
3: 17
4: 149
Right 1015708766 6:136116786-136116808 ATGAGCCATCTGGCCAGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015708766 Original CRISPR ATGAGCCATCTGGCCAGAAC AGG Intronic
900148173 1:1167287-1167309 CAGAGCCATCTGGCCCGGACGGG - Intergenic
903740665 1:25556642-25556664 GTGTGCCAACTGGCCAGAAGGGG - Intronic
904183006 1:28680096-28680118 GTGAGCCATCTGGCCAGGAGGGG - Intronic
904305942 1:29590296-29590318 AGGAGCCATCTGCCCAGACATGG - Intergenic
914851288 1:151316188-151316210 ATGATCCACCTGCCCAGATCAGG - Exonic
918188011 1:182144542-182144564 TTAAGAGATCTGGCCAGAACTGG - Intergenic
918219120 1:182419539-182419561 ATTTACCAACTGGCCAGAACAGG - Intergenic
924097548 1:240569267-240569289 TAGATCCATCTGGCGAGAACTGG - Intronic
1065965197 10:30765222-30765244 ATGAGGCATTTGGCCGGAAAGGG + Intergenic
1066068142 10:31777329-31777351 ATGAGCCACCAGGCCTGGACTGG + Intergenic
1067297650 10:44984024-44984046 AGGAGCCATCGCCCCAGAACGGG + Exonic
1069542923 10:69309024-69309046 ATGAGCCACCATGCCAGACCAGG - Intronic
1073052137 10:100674263-100674285 ATGAGCCACCTCGCCTGACCTGG + Intergenic
1074598008 10:114885110-114885132 ATGAGCCACCTCGCCAGGCCGGG - Intronic
1074853454 10:117456737-117456759 TTGAGCCTTCTGACCAGAAGGGG + Intergenic
1075332420 10:121583396-121583418 ATGAGCCATCTCAGCAGAGCAGG - Intronic
1076372893 10:129966573-129966595 AGCAGCCATCTGGCCCGAAATGG + Intergenic
1083788473 11:64968542-64968564 ATGAGCCATCAGGCCAGGCATGG + Intronic
1084616168 11:70237346-70237368 CTCAGCCATCTGGACAGAAGGGG + Intergenic
1084903385 11:72327274-72327296 ATAGGGCATCTGGCCAGAAGAGG - Intronic
1085502279 11:77034874-77034896 ATGAGCCATCTCGCCTGGCCAGG - Intronic
1086933393 11:92718275-92718297 ATGAGCTTTCTGGGGAGAACAGG + Intronic
1089467004 11:118691921-118691943 AAGAGCCCACTGGCCAGAGCCGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093263211 12:16966773-16966795 GTGAGCCATCTGGCCCGGCCTGG - Intergenic
1097750367 12:63345923-63345945 ATGTCTCATATGGCCAGAACAGG + Intergenic
1102230200 12:111256992-111257014 AAGAGCTATGTGGCTAGAACAGG + Intronic
1102467612 12:113139103-113139125 CTGAGCCCTCTGACCAGGACTGG + Intergenic
1102595180 12:113986728-113986750 AGGAGGCATCTGCCCAGCACTGG - Intergenic
1103048566 12:117759823-117759845 ATGAGCCATCATGCCCGACCTGG - Intronic
1103314809 12:120044282-120044304 GTGAGCCATATGACCAAAACAGG + Intronic
1103470395 12:121175648-121175670 ATGAGTCATCTGACGAGTACAGG + Intronic
1103613165 12:122136178-122136200 AGGAGCCAACAGGCCAGATCAGG + Intronic
1108960194 13:56217345-56217367 ATGAGCCATCTTGTCACAATGGG + Intergenic
1110336076 13:74331781-74331803 AAGAGAGAACTGGCCAGAACAGG + Intergenic
1112880835 13:104104651-104104673 ATGAGCCATCTCTCCAGGTCAGG - Intergenic
1117729315 14:58705638-58705660 ATTAATTATCTGGCCAGAACTGG + Intergenic
1118455453 14:65942071-65942093 ATGAGCCCTCTGGCCAGTGATGG - Intergenic
1118893355 14:69926731-69926753 ATGTGCCATTTGGCTACAACAGG - Intronic
1119169236 14:72520829-72520851 AAGAGCCAACTGGCCAGAGATGG - Intronic
1119222429 14:72919882-72919904 TTTAGCCATCAGGCCAGGACAGG + Intergenic
1119235020 14:73012298-73012320 ATGAGTCACCAGGCCAGAATGGG + Intronic
1119523285 14:75302060-75302082 ATGAGCCACCAGGCCTGACCAGG - Intergenic
1125438713 15:39677327-39677349 ATGAGCTTTCTGGAGAGAACAGG + Intronic
1128877302 15:71212917-71212939 ATGTGCCATCTGGGCAGCATGGG + Intronic
1131229829 15:90651713-90651735 AGGAGCCATCTAGCCAGGTCCGG + Intergenic
1132351611 15:101142860-101142882 CTGAGTGATCTGGCCAGAGCTGG - Intergenic
1132748777 16:1447797-1447819 ATGGGAAATCTGGCCGGAACAGG - Intronic
1139534849 16:67565282-67565304 GTGAGCCATCTCGCCAGGCCAGG + Intronic
1139893712 16:70271244-70271266 GTGAGCCACCGTGCCAGAACTGG - Intronic
1140580811 16:76228766-76228788 CTGAGTCATCTTGGCAGAACAGG + Intergenic
1140640289 16:76964333-76964355 ATGTCTCTTCTGGCCAGAACAGG + Intergenic
1141155311 16:81593092-81593114 TTGAGCCATGTGGCCATAAAAGG + Intronic
1141579795 16:84989411-84989433 ATGAGCCATCGCGCCTGACCAGG - Intronic
1146341893 17:32026709-32026731 ATGAGCCACCAGGCCAGGCCAGG + Intronic
1148336600 17:46846190-46846212 ATGAGCCATCTGTACTGAAACGG - Intronic
1148798581 17:50209571-50209593 CTGAGCCATGTGGCCAGAGGGGG + Intergenic
1149542326 17:57476977-57476999 ATGAGACAGCTGGCCAGACGGGG - Intronic
1151048327 17:70947880-70947902 AGAAGCCTCCTGGCCAGAACAGG + Intergenic
1153432219 18:5030090-5030112 ATGAGCCACCGTGCCAGGACAGG - Intergenic
1159599605 18:70416295-70416317 GTGAGCCATCTGGCCTGGCCTGG - Intergenic
1161463296 19:4412232-4412254 GTGAGCCATTTAGCAAGAACGGG + Intronic
1162578952 19:11516102-11516124 ATGAGCCAACTGGTCAGCACAGG + Intronic
1163583267 19:18150771-18150793 ATGACCCCTCTGCCCAGATCCGG - Exonic
1163665058 19:18599386-18599408 ATGAGCCACCTTGCCCGACCGGG + Intronic
1165455240 19:35907067-35907089 ATGGGACATCTGTCCAAAACTGG - Intronic
1167580100 19:50336391-50336413 ATGAGCCACCGTGCCTGAACTGG + Intronic
927901219 2:26820185-26820207 ATGAGCCACCTCACCTGAACTGG + Intergenic
929903125 2:46023180-46023202 GTTGGCCAACTGGCCAGAACAGG - Intronic
930601111 2:53444231-53444253 ATGACCCACCTGGAGAGAACAGG - Intergenic
930681445 2:54260787-54260809 ATGAGCCAACAGGCCAGGATGGG + Intronic
931290751 2:60870954-60870976 GTGAGCCATCGGGCCCGACCTGG - Intergenic
931747151 2:65300363-65300385 ATGAGGCTTCTGCCCAGAGCTGG - Intergenic
933699074 2:85241725-85241747 ATGAGCCATCGGGCCCAACCTGG + Intronic
938142868 2:128811165-128811187 ATGGGCCATCTGACCATACCAGG + Intergenic
941366857 2:164621020-164621042 GTGAGCCATGTGCCCAGAGCTGG - Intronic
944955050 2:204798819-204798841 ATGATGCATCTTGCCAGGACTGG - Intronic
946670622 2:222099942-222099964 CTGGGCCATCTGCTCAGAACTGG - Intergenic
947626403 2:231621771-231621793 ATGAGCCTTCTCCCCAGAGCTGG + Intergenic
947982337 2:234421077-234421099 ATGAGCCGCCTTGCCGGAACTGG - Intergenic
948802625 2:240439777-240439799 CTGAGCCACCTGGACAGGACAGG - Intronic
1169584263 20:7062202-7062224 AAGAGCCATATGGCCAGACAGGG - Intergenic
1170245833 20:14220532-14220554 AGAAGCCTCCTGGCCAGAACTGG - Intronic
1173423573 20:42924143-42924165 ATGTGCCATCTGGCCGGACATGG - Intronic
1175362248 20:58421782-58421804 TTGATCCCTCTGGCCAGCACAGG - Intronic
1175383180 20:58577520-58577542 CTGTGCCTTCTGGCCAGAAGAGG - Intergenic
1177195661 21:17901193-17901215 AGAAGCCTCCTGGCCAGAACTGG - Intergenic
1177527835 21:22319622-22319644 ATGAGCCGAGTGGGCAGAACAGG + Intergenic
1180671606 22:17557907-17557929 GTGAACCTTCTGGCCAGTACTGG + Intronic
1182028407 22:27138204-27138226 AGGAGCCATCTGGCCAGGCAGGG + Intergenic
949604112 3:5634695-5634717 AGAAGCCTCCTGGCCAGAACTGG - Intergenic
954012742 3:47656630-47656652 ATGAGCCACCATGCCAGACCTGG - Intronic
954415424 3:50391099-50391121 AAGAGCCAGCTGGACAGGACAGG - Intronic
954788566 3:53113527-53113549 ATGGGCTTTCTGCCCAGAACAGG - Intronic
959172119 3:102855756-102855778 ATGAGGAATCTGTTCAGAACTGG - Intergenic
959997198 3:112693117-112693139 AGAAGCCTCCTGGCCAGAACTGG + Intergenic
960204227 3:114875657-114875679 ATGAGGCATGTGGAAAGAACTGG + Intronic
960264446 3:115604381-115604403 ATGGGCCATCTGCTAAGAACTGG + Intergenic
962124724 3:132604659-132604681 TTGAGCCATATGTCCAGTACTGG + Intronic
963891058 3:150636468-150636490 ATGAGCCATCAGATCAGATCTGG + Intergenic
965827286 3:172743875-172743897 ATGAGCCATGAGGCCAGGAATGG + Intergenic
969234388 4:5855389-5855411 ATGAGCGATCTGTCCAGAAAGGG - Intronic
972214445 4:36879559-36879581 CTGGGCCATCTTACCAGAACTGG - Intergenic
976279268 4:83311024-83311046 ATGAGCCATAGCGCCAGACCTGG - Intronic
976856409 4:89609914-89609936 AGAAGCCTCCTGGCCAGAACTGG + Intergenic
978466540 4:109015015-109015037 TAGAGCCATCTGGCCAAACCAGG + Intronic
981597357 4:146442405-146442427 ATGACCCAGCTGGTCAGAAAGGG - Intronic
984472529 4:180194551-180194573 ATGAGCCACCTTGCCAGGCCTGG - Intergenic
984777346 4:183493328-183493350 AGGAGCTATCTGGCCATTACAGG + Intergenic
990307941 5:54511236-54511258 ATGAGCCATCGTGCCTGACCTGG + Intergenic
991117349 5:62969906-62969928 AGAAGCCTCCTGGCCAGAACTGG + Intergenic
991593228 5:68276350-68276372 ATGAGCCATCTGGCAATGTCTGG - Intronic
993952034 5:94187705-94187727 ATGAGCCACCGCGCCAGACCGGG + Intronic
994215231 5:97130243-97130265 ATGAGCCTTCTGGCAAGGCCAGG + Intronic
995930105 5:117431304-117431326 ATTAACCATCTGGCCAGTCCAGG - Intergenic
996036255 5:118762388-118762410 TAGAGCCAGCAGGCCAGAACAGG - Intergenic
998804375 5:145904329-145904351 ATCAACCATCAGGCCAGATCCGG - Intergenic
999464950 5:151794043-151794065 ATGAGACATCTGGCAATATCTGG - Intronic
1000323170 5:160151152-160151174 TTGAGCCAGCTGGGCAGAATAGG + Intergenic
1001465821 5:171965241-171965263 ATGAGCCATCTTGCCTGGATGGG - Intronic
1002964581 6:1950831-1950853 ATGAACCATCTGGACAGGACAGG + Intronic
1002964589 6:1950887-1950909 ATGAACCATCTGGACAGGACAGG + Intronic
1003431526 6:6043186-6043208 ATGAGCCAGGTGGGCAGCACAGG + Intergenic
1007097614 6:39223562-39223584 AAGAACCAGTTGGCCAGAACTGG - Intronic
1010736897 6:79453375-79453397 AAGAGCCATCTGGGCATAAGAGG - Intergenic
1015313713 6:131793507-131793529 ATGAGCCACCATGCCAGACCTGG - Intergenic
1015708766 6:136116786-136116808 ATGAGCCATCTGGCCAGAACAGG + Intronic
1018001170 6:159579860-159579882 ATGAACCATCTGCCCAGCAGCGG + Intergenic
1019500621 7:1362729-1362751 ATGAGCCATCGCGCCAGGCCAGG - Intergenic
1020152213 7:5691359-5691381 AGGAGCAATCCAGCCAGAACAGG - Intronic
1028490028 7:91400853-91400875 ATCAGCCATCTGGCCAGGCGTGG + Intergenic
1029476000 7:100784984-100785006 ATGTGCCATCAGCCCAGACCTGG - Intronic
1033380984 7:140818593-140818615 ATGAGCCAACACGCCAGCACCGG + Intronic
1037503292 8:19505841-19505863 ATCAGCCATGCGTCCAGAACCGG + Exonic
1041787322 8:61649336-61649358 ATAAGCAATCTGGGGAGAACTGG + Intronic
1042785843 8:72546050-72546072 ATGTGCCCTATTGCCAGAACAGG - Intronic
1043240858 8:77933588-77933610 ATGTGCCAACTGCCAAGAACTGG - Intergenic
1045272376 8:100672922-100672944 ATGAGCCATGTGGCCACCAGGGG - Intergenic
1049455580 8:142684672-142684694 ATGTGCCACGTGGCCAGAGCAGG - Intergenic
1050584860 9:7100112-7100134 ATGAGCCATCACGCCACAACCGG - Intergenic
1051198691 9:14593481-14593503 GTGTGACATCTGGCCAGCACAGG - Intergenic
1052524971 9:29605165-29605187 TTGAGCCATCTGGGCATACCTGG + Intergenic
1053097226 9:35339229-35339251 AGGAGCTAGCTGGGCAGAACTGG - Intronic
1055436392 9:76296245-76296267 ATGAGCCACCTCGCCCGACCTGG + Intronic
1056571001 9:87814588-87814610 ATAAGGCATCTCGCCAGCACTGG + Intergenic
1057119568 9:92559123-92559145 AGAAGCCTCCTGGCCAGAACTGG - Intronic
1057191219 9:93088649-93088671 ATGTGCCATGTGGCCAGCAAGGG - Intergenic
1059282226 9:113144684-113144706 ATGAGCCATCGCGCCCGATCTGG + Intergenic
1059424369 9:114211426-114211448 ATGAGCAAACTGGACAGAGCCGG - Intronic
1060565908 9:124591465-124591487 ATGAGCCATCTGGGCAACAGGGG + Intronic
1061849206 9:133404717-133404739 AAGAGCCTTCTGCCCAGGACGGG - Intronic
1185794445 X:2952937-2952959 ATGAGCCACCTTGCCTGAGCTGG + Intronic
1187455814 X:19440376-19440398 ACGAGGCATCTGGCCAGAGCAGG - Intronic
1192785569 X:74331656-74331678 CTGAACCATCTGCTCAGAACTGG + Intergenic
1193742322 X:85232216-85232238 ATGATTCATCTTGCCAGGACTGG - Intergenic
1195485647 X:105402662-105402684 ATGAGACATATGTTCAGAACTGG - Intronic
1195745375 X:108112288-108112310 ATGAGCCATTTGGGAAAAACTGG - Intronic
1198010474 X:132547979-132548001 ATGAGCCTTTTAGCCAGGACTGG + Intergenic
1202337377 Y:23826155-23826177 ATAAGCCAATAGGCCAGAACAGG - Intergenic
1202533389 Y:25843916-25843938 ATAAGCCAATAGGCCAGAACAGG + Intergenic