ID: 1015712152

View in Genome Browser
Species Human (GRCh38)
Location 6:136153869-136153891
Sequence GAGCAGAGATGGACAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015712152 Original CRISPR GAGCAGAGATGGACAGCAGA GGG (reversed) Intronic
900638254 1:3676096-3676118 GAGGACAGAGGGACAGGAGACGG + Intronic
901247400 1:7743470-7743492 GGGCAGAGACGGACTGCAGATGG - Intronic
901256336 1:7830440-7830462 GGGCAGAGATGGACTGGTGAGGG - Intronic
901866563 1:12110366-12110388 GGGCAGAGGTAGACACCAGAGGG + Intronic
901872344 1:12145426-12145448 GATCAGAGAGGGACAGCAAGTGG + Intergenic
902509532 1:16958662-16958684 GGGCAGAGAAGGAGAGCAGGCGG + Exonic
902512862 1:16975618-16975640 GAGCACAGATGGGCAGCTGTCGG - Intronic
902666423 1:17942361-17942383 GATAAGAAATGGGCAGCAGAAGG - Intergenic
903376812 1:22871602-22871624 GAACATAGATGGACAGTACATGG + Intronic
904442319 1:30539776-30539798 GCACAGAGATGCCCAGCAGAGGG + Intergenic
904555992 1:31364647-31364669 GAGCAGAGACTGGCAGCAGGAGG + Exonic
904981171 1:34503485-34503507 GAGCAGAGATGTCCATCAGAGGG - Intergenic
905218336 1:36426332-36426354 GAGAAGAAAAGGCCAGCAGAGGG - Intronic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905761866 1:40565483-40565505 GAGAACACATGGACACCAGAAGG + Intergenic
906509965 1:46405345-46405367 GAGGAGGGATGGGCACCAGAAGG - Intronic
906949537 1:50323275-50323297 GAGCAGGGATGGAGCCCAGACGG + Intergenic
907672148 1:56485414-56485436 GAGCAGGCAGGGACAGAAGAGGG + Intergenic
908366098 1:63425234-63425256 CAGCAGAGAAGGAAAGCTGATGG + Intronic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910047364 1:82933799-82933821 GCACAGAGATGGCCTGCAGAAGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
912712695 1:111961044-111961066 GAGAAGAGAGGTACAGCACAGGG + Intronic
913961150 1:143338952-143338974 GAGCATGGGTGGACATCAGAGGG - Intergenic
914055504 1:144164525-144164547 GAGCATGGGTGGACATCAGAGGG - Intergenic
914123642 1:144801837-144801859 GAGCATGGGTGGACATCAGAGGG + Intergenic
914785664 1:150827315-150827337 GAGCAGAGATTGACTGCAGATGG - Intronic
914877859 1:151525611-151525633 GGGGAGAGTTGGACACCAGAAGG - Intronic
915165555 1:153946194-153946216 GTGCAGTGAGGGACAGCAGCTGG + Intronic
915537347 1:156544978-156545000 GGGCAGAGATGGTGAGCACACGG - Intronic
915565157 1:156708840-156708862 GAATAGAGATGGGCAGGAGAGGG + Intergenic
915802238 1:158806786-158806808 GAGCAGAGATGGAAAGGTGTTGG - Intergenic
915850347 1:159314875-159314897 GAGCAGAGATAGTGATCAGAAGG + Intergenic
915907804 1:159891716-159891738 AAGCAGAGATGGGCACCAGGTGG - Intronic
916115236 1:161480375-161480397 CAGCACAGAGGGATAGCAGAGGG - Intergenic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917920263 1:179744343-179744365 GAGCAGAGCGGGCAAGCAGAAGG + Intronic
919738793 1:200970318-200970340 CAGCAGGGCTGGACAGCTGAGGG + Intronic
920655632 1:207872547-207872569 GGGCAGAGATAGAGAGCATAGGG - Intergenic
920910071 1:210208207-210208229 GAGAAGACAAGGATAGCAGAAGG + Intergenic
922067344 1:222157146-222157168 GAGAGGAGAGGGACAGGAGAGGG - Intergenic
922745726 1:228042491-228042513 GATTAGAGATGGACAGATGATGG + Intronic
923425897 1:233869229-233869251 GAACAGAGATGGAAAGAAAATGG + Intergenic
923549798 1:234954527-234954549 AAGCAGAGATGGAGAGCTGGCGG - Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924430110 1:243989441-243989463 TAACAGAGATGGAAAGCAGTGGG + Intergenic
924940810 1:248811589-248811611 GAGCAGAAAGGGAAAGCAAAGGG + Exonic
1063338750 10:5243295-5243317 GAGGAGAGATTGCCTGCAGATGG + Intergenic
1064114391 10:12565832-12565854 GAGAACACAGGGACAGCAGACGG - Intronic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1064740818 10:18432334-18432356 GAGCAGATCAGGACATCAGAAGG - Intronic
1064969615 10:21051375-21051397 GAGTAGAGATGTAAAGCAGTAGG + Intronic
1065526877 10:26631730-26631752 GAGCAGAGAGGGATAGCATTAGG - Intergenic
1066663533 10:37759997-37760019 GAGCAGAGCTGTCCAGAAGAGGG + Intergenic
1067284767 10:44899480-44899502 GAGGAAGGATGGAGAGCAGATGG + Intergenic
1067440698 10:46307893-46307915 GAGCAGAGAGGGACATCTCAGGG - Intronic
1067512604 10:46908366-46908388 GAGCAGAATTGGCCAGCACAGGG - Intergenic
1067576939 10:47415013-47415035 GAGCAGAGAGGGACAGCTCCGGG - Intergenic
1067649640 10:48143456-48143478 GAGCAGAATTGGCCAGCACAGGG + Intergenic
1067811155 10:49428525-49428547 GAGCAGAGAGGGACTCCAGTGGG - Intergenic
1067973207 10:50993889-50993911 GAAGAGAGAAGGACAGAAGAAGG - Intronic
1068390388 10:56388357-56388379 TACCAGAGATAGACACCAGAAGG - Intergenic
1068792940 10:61047062-61047084 GAGAAGACATAGACAGCAGCAGG - Intergenic
1068974532 10:62994267-62994289 GAGCAGAGAGTGACAGGTGAAGG - Intergenic
1070485319 10:76924932-76924954 GAGCAGGGATGGGCATCAGCAGG - Intronic
1070726704 10:78796798-78796820 CAGCAGTGATGGACAGAAGGAGG + Intergenic
1071143526 10:82540733-82540755 GAGAAAAGATTGACAGCATATGG + Intronic
1071983993 10:91032459-91032481 GAACAAGGAAGGACAGCAGAAGG + Intergenic
1072250935 10:93581832-93581854 CAGCAGAGGTGGACAGCATCTGG - Intronic
1072844710 10:98816993-98817015 AAGCAGAGAAGGAGAGCACAAGG - Intronic
1073333865 10:102689975-102689997 GAGCAGAGATGGAAAAGACAGGG + Intronic
1073429036 10:103474328-103474350 GAGAAGAGATGGATAGATGATGG - Intronic
1073618184 10:105019475-105019497 GAGAAGAGATGGAAAGAGGAAGG - Intronic
1073625525 10:105091815-105091837 GAGCATAGAAGGACAGGAGGAGG + Intronic
1073632449 10:105162181-105162203 GAGCAGAGAAGGATAGCACTGGG + Intronic
1073719673 10:106153256-106153278 GAACTGAAATGGACAGCATATGG + Intergenic
1074131283 10:110579446-110579468 GGGCCTAGATTGACAGCAGACGG - Intronic
1074493810 10:113961027-113961049 GGGCAAAGGTGGAGAGCAGAGGG - Intergenic
1075078951 10:119370047-119370069 GGGCTGAGATGGACAGGACATGG - Intronic
1075265719 10:120998466-120998488 GAGCAGCGCTGGCCAGCAGCAGG - Intergenic
1075570751 10:123541016-123541038 GAGCAGACATGCACAGCTGGTGG - Intergenic
1075719146 10:124574865-124574887 GAGTGGAGAAGGACAGCAGTGGG - Intronic
1076061433 10:127417056-127417078 GGGCAGAGATGAACAGCGAATGG - Intronic
1076131299 10:128015829-128015851 GGGGAGAGCTGGAGAGCAGATGG + Intronic
1076436398 10:130447081-130447103 AAGCAAAGATGGAAAGAAGAGGG - Intergenic
1076497687 10:130907804-130907826 GACCACAGATGGGAAGCAGAGGG - Intergenic
1076854307 10:133108432-133108454 AAGCAGGGAGGGACACCAGAAGG + Intronic
1077113037 11:870267-870289 GAGCACAGCTGGACAGCAGGTGG - Intronic
1077559693 11:3251659-3251681 GAGCACACTTGGACAGGAGAGGG - Intergenic
1077565585 11:3297462-3297484 GAGCACACTTGGACAGGAGAGGG - Intergenic
1078049055 11:7945978-7946000 GAGCAGAGCGTGACAGCAGCTGG + Intergenic
1079096796 11:17516339-17516361 GAGCATCCATGGGCAGCAGATGG + Intronic
1079105380 11:17568865-17568887 GAGCAGAGATGGAACCCAGATGG - Intronic
1079660849 11:23035193-23035215 GTGCTGAAATGGACAGGAGACGG + Intergenic
1080201820 11:29680479-29680501 GAGCCAAGGTGGACAGCAAAGGG - Intergenic
1081668301 11:44929289-44929311 CATCAGAGATGGCCAGGAGAAGG + Exonic
1082879945 11:58027749-58027771 AAGGAGAGAGGGACAGCCGACGG - Intronic
1083553729 11:63609659-63609681 GAGGAGGGATGAACAGCAGCTGG + Intronic
1084322206 11:68379765-68379787 GAGGAGAGGAGGACAGCAGGTGG - Intronic
1084431456 11:69113770-69113792 GCACAGAGAGAGACAGCAGAGGG - Intergenic
1084570877 11:69959215-69959237 GAGCAGTGTGGGAGAGCAGAGGG - Intergenic
1085017357 11:73183535-73183557 GAGGAGAGATGGGTAGGAGACGG - Intergenic
1085290576 11:75396362-75396384 GAGCAGAGAGAGATAACAGATGG + Intergenic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086955588 11:92931790-92931812 GACCAGAGATGGAGAGAACAAGG - Intergenic
1086955669 11:92932504-92932526 GACCAGAGATGGAGAGAACAAGG - Intergenic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1088299764 11:108344616-108344638 GAACTGAGATGAACAGCAGTAGG + Intronic
1088377087 11:109152859-109152881 GAGCAGATAGGGAAAGCAGGTGG - Intergenic
1088870524 11:113886598-113886620 GAGCACAGATGGGAAACAGAGGG + Intergenic
1088920172 11:114254839-114254861 AGGCAGAGATGGCCAGGAGAGGG + Intergenic
1090473162 11:126997816-126997838 GAGATGTGTTGGACAGCAGATGG + Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092871646 12:12810904-12810926 GAGCTGAGTTGCACAGCAGGAGG + Intronic
1093066428 12:14663193-14663215 GAGCAGAGATGCACAGAGGTGGG + Intronic
1093744384 12:22722917-22722939 GAGCAAAAATGGAAAACAGAGGG + Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095387250 12:41665653-41665675 GAGAACACATGGACACCAGAAGG + Intergenic
1095405634 12:41864009-41864031 GAGCAGAGAGGGACATTAGGTGG - Intergenic
1096863809 12:54549526-54549548 GAGAAGGGAGGGAGAGCAGAGGG + Exonic
1097530335 12:60792110-60792132 GAGAACACATGGACACCAGAAGG - Intergenic
1097562848 12:61229960-61229982 GAGAGTAGAAGGACAGCAGAGGG - Intergenic
1097893574 12:64802382-64802404 TACCCGAGATGGCCAGCAGAGGG + Intronic
1099330190 12:81275137-81275159 GACCAAAGATGGACCCCAGAAGG - Intronic
1100866245 12:98860364-98860386 GAGCAGAGATAGACAACAAAGGG - Intronic
1102047994 12:109841649-109841671 GAGCAGTGGAGGACAGCAAAAGG - Intergenic
1102689870 12:114751910-114751932 GAGAAGAGAAGGAAAGGAGAAGG - Intergenic
1103241052 12:119413749-119413771 GAGCAGAGGTGGACAAGGGACGG - Intronic
1103260772 12:119586510-119586532 GAGCAGAGTTGGTCTGGAGAGGG - Intergenic
1103340764 12:120220040-120220062 GAGCAGAGCTGGACAGCCCCGGG + Intronic
1103379100 12:120480074-120480096 GAAGACAGAAGGACAGCAGAAGG + Intronic
1103510993 12:121474084-121474106 GAGCAGGGAGTGACAGCTGATGG + Intronic
1103701872 12:122852310-122852332 GATCTGACATGGAGAGCAGAGGG + Intronic
1103840248 12:123857877-123857899 GAGCAGAGGTTGCCAGCGGAGGG - Intronic
1104114981 12:125740878-125740900 GAGCAGAGATGGGCAAGAGAGGG - Intergenic
1104590974 12:130084474-130084496 CAGGAGAAATGCACAGCAGAAGG + Intergenic
1104730378 12:131102475-131102497 GAGCAGAGATGGGCAGCACTGGG + Intronic
1104760376 12:131294500-131294522 ATGGAGAGATGGACAACAGATGG + Intergenic
1104760388 12:131294636-131294658 ATGGAGAGATGGACAACAGACGG + Intergenic
1104819391 12:131666147-131666169 ATGGAGAGATGGACAACAGATGG - Intergenic
1105892053 13:24688994-24689016 GAGCAGGGAGTGACGGCAGAGGG + Intronic
1106179970 13:27362136-27362158 GAACAGCGATGGCCAGCAGATGG + Intergenic
1107461358 13:40606762-40606784 GAGGATGGAGGGACAGCAGAGGG - Intronic
1107922187 13:45220650-45220672 AAGCCGAGATGGACAGAAAAAGG + Intronic
1109314484 13:60734132-60734154 GAGCAGGAATGGTCAGCAGAGGG + Intergenic
1109800252 13:67367679-67367701 GAGCAGAGATGTACAAAAGCAGG + Intergenic
1111489372 13:88951055-88951077 GAGAAGACATGGACACAAGAAGG + Intergenic
1112145728 13:96698175-96698197 GAGCAGGGAGGGACAGCATTGGG - Intronic
1112162320 13:96881168-96881190 GAGCTGAGATGCAGAGCAGAGGG - Intergenic
1112473495 13:99710385-99710407 GGGCAGAGAAACACAGCAGACGG - Intronic
1112836889 13:103526424-103526446 AAGAAGAGAAGGACAGCAGAGGG + Intergenic
1112875430 13:104032498-104032520 GAGGAGAGAGGGATAGAAGAGGG + Intergenic
1113101297 13:106722171-106722193 GAGCAGGGAGGGACAGCATTAGG + Intergenic
1113139460 13:107130906-107130928 GAGCAGACATGGGGAGAAGACGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115633689 14:35270201-35270223 GAACACAGATGGAAAGCTGAGGG - Intronic
1118504938 14:66400904-66400926 AGGCAGACATGGACAGCAAACGG - Intergenic
1118731626 14:68670865-68670887 CAGCAGAGATGAGCAGGAGATGG - Intronic
1119122446 14:72091700-72091722 GAGCAGAGGTGGAGAGTGGAAGG + Intronic
1119929537 14:78531567-78531589 TGGCACAGATGGATAGCAGAAGG - Intronic
1121096479 14:91221103-91221125 GAGCAGAGATGGAGCAGAGAGGG - Intronic
1122269487 14:100562164-100562186 GACAAGAGATGGAGAGCAGGGGG + Intronic
1123715038 15:23021889-23021911 GAGGAGTGATAGACAGCTGATGG - Intronic
1123953716 15:25311978-25312000 GAGCAGGGAGGGACAGCATTAGG - Intergenic
1125050709 15:35295227-35295249 GGTCAGAGATGGGTAGCAGATGG - Intronic
1125330209 15:38574824-38574846 GAAAATAGATGGGCAGCAGAAGG - Intergenic
1125530431 15:40409758-40409780 GAGGTGAGCTGTACAGCAGAGGG - Intronic
1127262350 15:57335557-57335579 AAGCAGGGCTGGAGAGCAGAGGG - Intergenic
1127289794 15:57559986-57560008 TAGCCGAGGTGGACAGCAGGGGG + Intergenic
1127461594 15:59204246-59204268 GCGCAGGGATGGAGAGCAGAGGG + Intronic
1128992707 15:72273758-72273780 GAGCAGAGGGGGACATCAAAAGG - Intronic
1129608260 15:77035254-77035276 GTGCTGAGATGGCCTGCAGAGGG + Intronic
1129966166 15:79737737-79737759 GAGAAGAGAGGGAAAGGAGAAGG - Intergenic
1130545480 15:84855117-84855139 GAGCAGACAAGGAGAGGAGATGG - Intronic
1131873341 15:96781898-96781920 TAGCAGAGCTGGCCAGCAGGAGG + Intergenic
1131885895 15:96912377-96912399 CAGCAGATATGGCCAGCTGATGG + Intergenic
1132638417 16:965479-965501 GAGCAAAGGTGGAGAGCAGGAGG + Intronic
1133339404 16:5027048-5027070 GGGCAGAGATGGACCTCACAGGG + Intronic
1133416182 16:5608860-5608882 GAGCAGAGATGCATTTCAGAAGG - Intergenic
1133520695 16:6553722-6553744 GAGGAGAGAAGGACAGCAAAAGG + Intronic
1133569319 16:7025771-7025793 GAGAGGAGATGGCCAGCAGATGG + Intronic
1134824090 16:17270519-17270541 GTACAGAGATACACAGCAGAGGG + Intronic
1135177431 16:20243000-20243022 GAGGAGAGAGGGTCAGCAGGTGG - Intergenic
1135996348 16:27252281-27252303 GAGAAGAGAGGGACTGGAGATGG + Intronic
1136103645 16:28013342-28013364 GAGGAGAGCTGGCGAGCAGAGGG + Intronic
1137571494 16:49569117-49569139 TAGCAGAGGTGGAAAGGAGAGGG - Intronic
1137748643 16:50842019-50842041 GAGGAGAGAAGGACCGCACACGG + Intergenic
1137756942 16:50909991-50910013 GGGCAGAGAATGACAGCAGCCGG - Intergenic
1138405216 16:56787519-56787541 GAGCAGGAAAGGATAGCAGAGGG - Intronic
1138446556 16:57067793-57067815 GCTCAGAGAGGGACAGCAGGAGG - Exonic
1139292436 16:65870813-65870835 GAGGAGGGAGGGACAGGAGAGGG + Intergenic
1139846594 16:69925577-69925599 GGGGAGAGATGGAAAACAGAGGG - Intronic
1139846817 16:69927315-69927337 CAGCAGAGAGGGACACCAGCAGG - Intronic
1141516073 16:84545975-84545997 GAGGACAGATAGCCAGCAGAGGG - Intronic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1144132684 17:12263369-12263391 GAGAACAGATGGACACAAGAAGG + Intergenic
1144630489 17:16869687-16869709 GAGCAAAGATGGCCAGTAGTGGG - Intergenic
1144707719 17:17380522-17380544 GAGCAGAGGTGAACAGGAGGGGG - Intergenic
1146335231 17:31963939-31963961 AAGCAGAGTTAGAAAGCAGAGGG - Intronic
1146630046 17:34463268-34463290 GTGCAGAGATGAACAGGTGAAGG - Intergenic
1147586248 17:41655359-41655381 CAGCAGAGAAAGAGAGCAGAGGG - Intergenic
1147833803 17:43315633-43315655 GAGCAGAGCTGGACCGCAGCGGG + Intergenic
1148203348 17:45764374-45764396 GAGCAGAGCTGGACAGGAAGAGG - Intergenic
1148461453 17:47841158-47841180 GAGAAGGGTTGGACAGAAGAGGG - Intronic
1149140451 17:53426973-53426995 CATCAGATATGGACAGCAAATGG + Intergenic
1150339838 17:64357515-64357537 GAGAGCAGATGGTCAGCAGATGG + Intronic
1150742153 17:67787953-67787975 GAGCAGAGATTGAGAGTACAAGG - Intergenic
1151377918 17:73704052-73704074 GAGCAAAGAAGGAAAGAAGAAGG - Intergenic
1151744137 17:76002434-76002456 GAGGAGAGAGGGGCAGCAGGAGG + Intronic
1151973540 17:77471364-77471386 GAGCTGATCTGCACAGCAGAAGG + Intronic
1152361960 17:79836974-79836996 GAGGAGAGATGGAAGGCAGCGGG + Intronic
1152661549 17:81544628-81544650 GAGCTGAGCTGGACAACAAATGG + Intronic
1153931330 18:9882300-9882322 GAACAAAGAAGGACACCAGAAGG - Intergenic
1153985136 18:10344486-10344508 GAGGAACGAGGGACAGCAGAGGG - Intergenic
1155045632 18:22100666-22100688 GTGTGGAGATGGACACCAGAGGG + Intergenic
1155127356 18:22891374-22891396 GAGCAGAGAGGGATAGCATTGGG + Intronic
1155172177 18:23275163-23275185 GTGCAGGGAGGGGCAGCAGAGGG + Intronic
1155844457 18:30688033-30688055 TAGCTGAGATGGAAAGAAGATGG - Intergenic
1156493443 18:37510512-37510534 GAGCAGAGACGGATTGCACAGGG - Intronic
1157550970 18:48581797-48581819 AGGCAGGGAGGGACAGCAGACGG + Intronic
1158888065 18:61847821-61847843 GAGCAGAGATTCCAAGCAGAGGG - Intronic
1159341493 18:67140028-67140050 GAGCACAGATAGACACAAGAAGG - Intergenic
1160366446 18:78329872-78329894 GAGCAGAACTGGAGAGCAGGTGG + Intergenic
1160389160 18:78517538-78517560 GAACAGAGAGCCACAGCAGAAGG - Intergenic
1160555741 18:79723805-79723827 GTGCAGGGAGGGACAGCAGGTGG - Intronic
1161480049 19:4505891-4505913 GAGCAGACAAGGAGAGCAGGGGG - Intronic
1164292272 19:23879381-23879403 GAGGAGAGAAGGAGAGGAGATGG + Intergenic
1164406813 19:27955902-27955924 GAGCAGAGTTTTGCAGCAGAAGG + Intergenic
1164990555 19:32679492-32679514 GGGCAGAGGTGGATAGCAGAAGG + Intergenic
1165069695 19:33248267-33248289 GAGCTGACCTGGACACCAGAGGG - Intergenic
1165245796 19:34497788-34497810 GAGCAGGGATGGTCTGCAGAGGG + Intronic
1166142966 19:40815232-40815254 GAGAAGAGATGGAGAGGAAAAGG - Intronic
1166257551 19:41617423-41617445 GAGGAGTGATGGACAGAACAAGG + Intronic
1166345439 19:42162454-42162476 GAACAGAGAGGGGCAGCAGCTGG + Intronic
1167172742 19:47844026-47844048 GGGAAGAGATGGAAAGCAAAGGG - Intergenic
1167288840 19:48613725-48613747 GAGCAGAGATGGCCAGCTGATGG - Intronic
1167310490 19:48735033-48735055 GAGTAGAGATTCACAGGAGAGGG - Intronic
1167435231 19:49475109-49475131 GAGGGGAGATGGACAGGAGGGGG + Intronic
1167846590 19:52170314-52170336 GAGCAGAGAGGGAGCTCAGATGG - Intronic
1202645590 1_KI270706v1_random:137483-137505 AACCAGAGATGGACAACAGTAGG - Intergenic
1202694987 1_KI270712v1_random:117202-117224 GAGCATGGGTGGACATCAGAGGG - Intergenic
925159728 2:1675682-1675704 TAGAAGAGATGGACAGGAGCAGG - Intronic
926164413 2:10510837-10510859 GAACAGAGATGGACTGCAGGTGG + Intergenic
926706511 2:15841433-15841455 GAGCAGATGTGGCCAGCAGGAGG - Intergenic
927464920 2:23329649-23329671 GAGCAGAGACGAAAAGCAGAAGG + Intergenic
928232242 2:29508497-29508519 GAGAACACATGGACACCAGAAGG + Intronic
928946318 2:36775076-36775098 GAGCAGAGATGGTAAGCAGTGGG - Intronic
928955413 2:36861964-36861986 GAGTATACATGGACAGAAGAAGG - Intronic
929132391 2:38590277-38590299 GATCAGAGATGTCCAGCAGAGGG - Intronic
930115620 2:47715790-47715812 TAGCAAAGATGTACAGCAGTTGG + Intronic
931218056 2:60264430-60264452 GAGCAGGGAGAGGCAGCAGATGG - Intergenic
932024415 2:68119215-68119237 GAGAAGAGAGGGAAAGCCGAAGG - Intergenic
932197486 2:69797021-69797043 GAACAGACATGGCCAGCTGAAGG - Intronic
933485498 2:82917387-82917409 GAGAAGTGAGGGACAGCTGAGGG - Intergenic
934276156 2:91574250-91574272 GAGCATGGGTGGACATCAGAGGG - Intergenic
934906637 2:98210710-98210732 GAGCAGAGACTGACAGCCTAAGG - Intronic
934987626 2:98899376-98899398 GAGCAGACATAGACAGTTGAAGG + Intronic
935019353 2:99215259-99215281 AGGCTGAGCTGGACAGCAGAGGG - Intronic
935449068 2:103188892-103188914 GAGTAGAGATGAACAAAAGAAGG + Intergenic
935719244 2:105965809-105965831 GAGCAGAGCTGGAAAGTCGATGG - Intergenic
935816889 2:106854116-106854138 AAGCACAGGTGGCCAGCAGATGG + Intronic
937120862 2:119439251-119439273 GAGCTTAGAGGGGCAGCAGATGG + Intergenic
937356620 2:121201915-121201937 GGGCAGGGATGGTCACCAGAAGG + Intergenic
937357719 2:121208845-121208867 GGGCAGGGACGGTCAGCAGAAGG + Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
937789629 2:125944528-125944550 AAGGTGAGATGGATAGCAGAAGG + Intergenic
938408567 2:131046013-131046035 GAACAGGGAGAGACAGCAGAGGG - Intronic
939004002 2:136765439-136765461 GCGCAGAGGTGTACAGCAGATGG + Intergenic
941221431 2:162786922-162786944 AAGAAAAGATGCACAGCAGATGG + Intronic
941976998 2:171416257-171416279 GTGTAGAGATGACCAGCAGAGGG - Intronic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
943488009 2:188512634-188512656 GAGCAGTGTTGGACATCATATGG - Intronic
945833343 2:214810782-214810804 GAGCAGAGACGGAGAGAAAATGG - Intergenic
946069053 2:217015372-217015394 AAGCAGAGGTGGACAGAAGGTGG - Intergenic
946636262 2:221730865-221730887 CAGCAAAGATGAAAAGCAGAAGG + Intergenic
947581384 2:231321320-231321342 GAGCGGGGATGGAAAGCAGCTGG + Intronic
948493399 2:238328961-238328983 AAGCAGAGATCGAAAACAGAAGG + Exonic
948835415 2:240623955-240623977 GAGGAGTGATGCCCAGCAGAGGG + Intronic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
1170561829 20:17565101-17565123 GAGTGGAGATTGACTGCAGAGGG - Intronic
1171419702 20:25009756-25009778 GTGCACAGATGCACAGCAAATGG + Intronic
1171895556 20:30756399-30756421 AACCAGAGATGGACAACAGTAGG - Intergenic
1172445844 20:34993068-34993090 GGGCAGAGCTGGTCAGGAGAGGG - Intronic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173565449 20:44035277-44035299 CAGCAGGGATGGACAGCAAAAGG - Intronic
1173752984 20:45491283-45491305 GAGCAGAGATGGGTATCACATGG - Intergenic
1174455459 20:50645624-50645646 TGGCAGGGATGGACAGCAGCTGG - Intronic
1175025131 20:55893915-55893937 GAGCAGAGAGAGAAAGCAGGAGG - Intergenic
1176141897 20:63548535-63548557 GAGGAGAGAGAGACTGCAGATGG - Intronic
1176192071 20:63816282-63816304 GAGCAGAGATGGAGCCAAGAGGG - Intronic
1176606295 21:8835265-8835287 AACCAGAGATGGACAACAGTAGG + Intergenic
1178974733 21:37210945-37210967 GAGGAGAGAAGGAAAGAAGAAGG + Intergenic
1179417278 21:41208745-41208767 AGGCAGAGATGGGGAGCAGAGGG - Intronic
1180002059 21:44999649-44999671 GAGCAGAGCTGGAAAACAGAGGG + Intergenic
1180356369 22:11844963-11844985 AACCAGAGATGGACAACAGTAGG + Intergenic
1180381891 22:12147363-12147385 AACCAGAGATGGACAACAGTAGG - Intergenic
1180984887 22:19898355-19898377 GAGCCGGGATGGACAGCACATGG - Intronic
1181869432 22:25886257-25886279 CAGCTGGGATGCACAGCAGAGGG + Intronic
1182350858 22:29698702-29698724 AAGCAGTGAGAGACAGCAGAGGG - Intergenic
1182745188 22:32600417-32600439 AAACAGAGCTGCACAGCAGAAGG - Intronic
1182886287 22:33776939-33776961 ATGCAGAGATGGTCAGCACATGG + Intronic
1182954459 22:34408550-34408572 GAGAACACATGGACACCAGAAGG - Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183584605 22:38745729-38745751 GGGCAGCGAAGGACAGCAGGAGG - Exonic
1183876707 22:40789062-40789084 AAGTAGAGATGGTCAGAAGATGG - Intronic
1184089060 22:42283040-42283062 GAGCGGAGAATGACAGGAGAAGG - Intronic
1184922258 22:47613976-47613998 GACCAGAGATGAACAGGAGGAGG + Intergenic
1184927946 22:47657290-47657312 CAGCAGAGGGGGACAGCAAAGGG - Intergenic
1185069203 22:48647048-48647070 GAGAGGAGAAGGACAGCAGAGGG + Intronic
1185177426 22:49336074-49336096 GTGCAGTGATGGAGAGCAGCTGG - Intergenic
950081454 3:10225089-10225111 GACCAGAAAAGGGCAGCAGAGGG - Intronic
950086507 3:10262184-10262206 GACCAGAGCAGGACAACAGAGGG - Intronic
950317428 3:12016171-12016193 GGGAAGAGAGGGACAGAAGAGGG - Intronic
950328664 3:12138198-12138220 GAGCCAAGATGGCCGGCAGATGG - Intronic
951629478 3:24703695-24703717 AAGCAGAGATCGACCACAGAGGG + Intergenic
952604510 3:35128595-35128617 GAGGAGAGAGGGATAGCATAAGG + Intergenic
952753327 3:36843512-36843534 CAGAAGGGATGGACAGCAGGTGG - Intronic
953039873 3:39246387-39246409 GAGCACAGATGGACACAAAAAGG - Intergenic
953338894 3:42117425-42117447 GAGGAGAGAAGAACAGGAGAGGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954798548 3:53173932-53173954 GGGTAGAGATGGACGGAAGACGG - Intronic
955350289 3:58188648-58188670 GAGCATAGAGGGGCAGCAGGAGG + Intergenic
955693702 3:61614895-61614917 GAGCTGAGATGTACAAGAGAAGG - Intronic
956160384 3:66345441-66345463 GGGCAGAGAAGGAAAGGAGAGGG - Intronic
958522826 3:95213022-95213044 GAGCAGAAATTAACAGCAGCTGG - Intergenic
960156119 3:114298564-114298586 GAGGACAGATGGAAAGCACAGGG - Intronic
960279811 3:115768625-115768647 GACAAGAGATGGAAAGTAGATGG + Intergenic
960722613 3:120639606-120639628 GAGCTGAGATGTGCAGCAGAAGG + Intronic
961020148 3:123498439-123498461 GAACAGAGCTGCACAGCAGGAGG + Intronic
961389718 3:126545111-126545133 GTGCAGAGCTGGACAACACAGGG + Intronic
961532033 3:127545881-127545903 GAGCAGGGCAGGACACCAGAGGG - Intergenic
962392986 3:134988935-134988957 GAGCAGACGTGAACAGGAGAAGG - Intronic
962622650 3:137195199-137195221 GAGCAGAGAAGGACAAGAAATGG + Intergenic
962945570 3:140166010-140166032 GAGAAGAAATGGACCCCAGATGG - Intronic
963044135 3:141090082-141090104 GAGAAGAGAGGGAGAGAAGAGGG - Intronic
965148457 3:164938369-164938391 GAGCAAAGATGGAGAGCATCAGG - Intergenic
967483206 3:189999003-189999025 GAGCGGGGCTGCACAGCAGAAGG - Intronic
967830192 3:193912152-193912174 AAGCAGAGATGGCAGGCAGAAGG - Intergenic
968075609 3:195814530-195814552 GAGGGGAGCTGGAAAGCAGAAGG - Intergenic
968143178 3:196275375-196275397 TACAAGAGATGGACAGAAGAGGG + Intronic
968310753 3:197681450-197681472 GGGCAGAGAGGGACAGCCAATGG + Intronic
968615788 4:1577216-1577238 GAGCACACAGGGAGAGCAGAGGG + Intergenic
968869331 4:3233640-3233662 GAGCAGAGAATGAGAGCCGATGG - Intronic
970230156 4:13901458-13901480 GAGGAGAGATGGGCAGGAGCTGG + Intergenic
971787858 4:31128447-31128469 TAGAAGAGATGAATAGCAGAAGG - Intronic
972281347 4:37604610-37604632 AAGGAGAGATGGAATGCAGATGG + Intronic
972634418 4:40870582-40870604 GAGCAAAGCTGGGTAGCAGAAGG + Intronic
973371813 4:49255901-49255923 AACCAGAGATGGACAACAGTAGG - Intergenic
973389191 4:49539416-49539438 AACCAGAGATGGACAACAGTAGG + Intergenic
973674797 4:53253690-53253712 GAGAACACATGGACACCAGAAGG + Intronic
973927276 4:55751569-55751591 GAGCAGGGATGCTCAGAAGAGGG + Intergenic
975619633 4:76283102-76283124 TAGCAGGGATGGGCAGCACAAGG + Intronic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
977520173 4:98072409-98072431 GTGCAGAGAGGGACAGCATCAGG + Intronic
978243227 4:106540991-106541013 AAGCAGTGATGGACAGCACCTGG - Intergenic
978867949 4:113537797-113537819 GAGCAGACATTTTCAGCAGAAGG + Intronic
979965392 4:127070645-127070667 GAGCAGAGAAGGGCAGCATGTGG - Intergenic
980508566 4:133756124-133756146 GAGAAGACATGGACAGAAGGAGG - Intergenic
983075528 4:163321206-163321228 GAACAGACCTGGACTGCAGATGG + Intergenic
985228853 4:187793243-187793265 GAGCAAATATGGAAAGAAGATGG - Intergenic
985819109 5:2147907-2147929 GAGCAGAGGGTGACAGCAGGAGG - Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
986508138 5:8473921-8473943 GAGCGGAGATTGATAGCAGCAGG - Intergenic
987012900 5:13785314-13785336 GAGCAGGGCTGCACAGCAGGAGG - Intronic
987018825 5:13848856-13848878 GAACAGGGCTGCACAGCAGAAGG - Intronic
987385272 5:17323061-17323083 GAACAGAGAGTGACTGCAGATGG - Intergenic
988542649 5:32125509-32125531 GAGCAGGGGTGGCCAGAAGAAGG + Exonic
990336141 5:54774627-54774649 GAGCAGAGCTGGCCAGCTGAAGG - Intergenic
992233923 5:74688857-74688879 GAGCAGAGATGGAAAGAATATGG - Intronic
992526391 5:77615051-77615073 GAGCAGGGATTGACTGCAAATGG + Intronic
993062480 5:83055339-83055361 CAGCAGAGCTGGACAACAGATGG + Exonic
993120571 5:83769144-83769166 GAGCATAGATGGAAGGCAAAAGG - Intergenic
993550762 5:89271016-89271038 GAGCAAAAACGGAGAGCAGATGG - Intergenic
993592953 5:89818145-89818167 GAGAACAGATAGAAAGCAGATGG + Intergenic
993803881 5:92379468-92379490 GAACAGGGATGAACTGCAGAGGG + Intergenic
993904520 5:93607931-93607953 GAGCACAGAAGGACAGGGGATGG - Intergenic
994155977 5:96504761-96504783 GAGCAGAAATCAACAGCAAATGG - Intergenic
994182526 5:96783177-96783199 AAGCAGACATGGACAGACGAGGG - Exonic
994213238 5:97109003-97109025 GTGCAGAGATAGTCAACAGAGGG - Intronic
994303154 5:98171217-98171239 GATCAGGGATGCACAGCAGGAGG - Intergenic
994965870 5:106670085-106670107 GAGCAGAGAAAGAGAGAAGAGGG - Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995832055 5:116364155-116364177 TAGCAGATATGGATGGCAGATGG + Intronic
996086417 5:119310055-119310077 AATCAAAGATGGACAGAAGAAGG - Intronic
997665771 5:135628481-135628503 GAGGAGAGAAGAACAGAAGACGG + Intergenic
998369115 5:141649883-141649905 GCGGTGAGATGGACAGCAGGTGG - Exonic
999383902 5:151140885-151140907 GAGCGGGGCTGGAGAGCAGAGGG - Intronic
999704783 5:154262301-154262323 GAGCTGAGAGGGACAGAAGGAGG - Intronic
999844633 5:155465762-155465784 GAGCAGAGCTGGATAAGAGATGG - Intergenic
1000616327 5:163432058-163432080 GAGAAGAGAGAGACAGAAGAGGG - Intergenic
1001211095 5:169811046-169811068 GATCAGATATGGACAGCAAAGGG + Intronic
1001237394 5:170041891-170041913 GAGGAGAGATGGAAAGGACAGGG + Intronic
1001676737 5:173524741-173524763 AGGCAGAGAGGGACAGCAAAAGG + Intergenic
1002181274 5:177432317-177432339 GAGCAGCGATGGAGAGATGATGG + Intronic
1002326639 5:178414132-178414154 GAGGAGAGCGTGACAGCAGAGGG - Intronic
1002925327 6:1602403-1602425 GAGGAGGGATGGGCAGCAGGAGG - Intergenic
1002938955 6:1699322-1699344 GAGGAGGGATGTACAGGAGATGG + Intronic
1003772805 6:9325861-9325883 GTGCAGAGATTGACCGCAAAAGG - Intergenic
1003847385 6:10187231-10187253 GAGAACAAATGGACACCAGAAGG + Intronic
1004476224 6:15975041-15975063 GAAGAGAGGTGGACAGCTGAGGG - Intergenic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005438746 6:25842228-25842250 GAGCACATATGAAGAGCAGAAGG + Intronic
1005725945 6:28648932-28648954 GGGCACAGATGGAAACCAGAAGG + Intergenic
1005806592 6:29479011-29479033 GCGCAGAGACAGAAAGCAGATGG - Intergenic
1006146178 6:31961148-31961170 GAACAGAGATGGACATGACAAGG + Intronic
1006180700 6:32151922-32151944 GCGCAGAGATGGAGAGATGAAGG + Exonic
1006360826 6:33586080-33586102 GCCCAGACATGGACAGCAGTTGG + Intergenic
1006627803 6:35409972-35409994 GAGCAGGGAGAGAGAGCAGAAGG + Intronic
1006831840 6:36972811-36972833 AAGCAGAGATGAGCAGGAGAGGG + Intronic
1007096490 6:39216383-39216405 GTGCAGAGCTGGGCAGCAAAGGG + Intronic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1007768635 6:44176555-44176577 GAGCAGAGATGGGCGGTGGAAGG - Intronic
1008907612 6:56696901-56696923 GAGCACAGATGGAGAAGAGATGG - Intronic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1009345759 6:62611656-62611678 GAGGAGAGAAGGAAAGAAGATGG + Intergenic
1009524671 6:64728891-64728913 GAGGGGAGCTGGAAAGCAGATGG + Intronic
1010461445 6:76118649-76118671 AAGCAGTGATGGACAGCACCTGG - Intergenic
1010469166 6:76205632-76205654 GAGCAGACATGGTTAGCAGCTGG - Intergenic
1011092413 6:83620260-83620282 AAGAAGAGATGGAGATCAGAAGG - Intronic
1011564782 6:88663325-88663347 GAGGTGAGATGGCCATCAGAAGG + Intronic
1011569301 6:88716828-88716850 GAGCAGGGAGGGACAGCATTAGG + Intronic
1013677452 6:112481182-112481204 GAGCAGAGCTGAAGAGCAGCAGG + Intergenic
1014912473 6:127111396-127111418 GGGGAGAGCTGGAAAGCAGAAGG + Intergenic
1015454521 6:133410944-133410966 GGGCAGGGAGGAACAGCAGAGGG - Intronic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1015954981 6:138589740-138589762 GATCAGAGGTTGTCAGCAGAGGG - Intronic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016487416 6:144556844-144556866 GATCAGAGAGGTACAGCAGAAGG + Intronic
1016852055 6:148630479-148630501 AAGCAGAGATGAACTGCAAATGG - Intergenic
1017032786 6:150238687-150238709 GTGCTGAGATGCAGAGCAGAAGG - Intronic
1017747723 6:157461708-157461730 GAACAGAGCTGGGCAGCAGAGGG + Intronic
1017832177 6:158140507-158140529 GGAGAGGGATGGACAGCAGATGG - Intronic
1017868010 6:158461532-158461554 GAGGAGAGAGGGTCAGCACAAGG - Intronic
1018683617 6:166284663-166284685 GGGCAGAGATGGGCTGGAGATGG - Intergenic
1018950606 6:168376344-168376366 GAGCAGAGCCGCACAGCAGCGGG - Intergenic
1019653115 7:2171477-2171499 CAGCAGAGAAGGACAGCAGCCGG + Intronic
1020106777 7:5425861-5425883 GAGCAAAGACGGAGAGGAGAGGG + Intergenic
1021029829 7:15717789-15717811 GAGCAGGCACAGACAGCAGAAGG + Intergenic
1021388894 7:20068053-20068075 AAGCAGTGACGGACAGCACATGG + Intergenic
1021917680 7:25451439-25451461 GAGCAGGGAGGGATAGCAGTAGG + Intergenic
1022806245 7:33825294-33825316 GAGCAGAGAGAGACAGCACAAGG + Intergenic
1022955466 7:35376289-35376311 GCTCAGAGAGGGACAGAAGAAGG + Intergenic
1023151046 7:37201763-37201785 GAGCAGAAATAGCCACCAGATGG - Intronic
1023604140 7:41912444-41912466 AAGCAGAGAAGCAAAGCAGAAGG - Intergenic
1023841306 7:44099834-44099856 GAGTAGAGGTTCACAGCAGATGG + Intergenic
1024181011 7:46894882-46894904 GAGCACACATGGACAGAAGGGGG - Intergenic
1024469137 7:49749042-49749064 AAGCAAAGAAGGACACCAGAAGG + Intergenic
1025945145 7:66099378-66099400 GAGGAGAGAAGGAGAGGAGAAGG + Intronic
1026239708 7:68562301-68562323 GAGCAGGGCTGGAGAGCACACGG - Intergenic
1028210578 7:88069247-88069269 AAGGAGAGAAGGAAAGCAGAAGG - Intronic
1028621964 7:92835603-92835625 GAGCAGAGACAGAAAGCAGAAGG - Intronic
1028969387 7:96840543-96840565 GTGCAGAGTTTGACAGAAGAAGG - Intergenic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029477304 7:100792579-100792601 CAGCAGAGGTGGACGGCAGAGGG - Intronic
1029538703 7:101170670-101170692 GGGCAGAGGTGGACACCAGCAGG - Exonic
1029857265 7:103529979-103530001 GAGCAGAAATGGCCAGCAAGGGG - Intronic
1029936644 7:104432122-104432144 GAGCAGCCAGAGACAGCAGAGGG - Intronic
1030566533 7:111164488-111164510 GCTCAGAGATTGACACCAGATGG + Intronic
1031965870 7:128027941-128027963 GAGCAGAGAAGGACGGGAGCTGG - Exonic
1032279960 7:130492225-130492247 GTGCAGAGCTGGCCAGCAGCGGG - Exonic
1032370222 7:131341897-131341919 GAACTGAGATGCACAGCAGGAGG - Intronic
1032560385 7:132884788-132884810 GGACAGAGATGGACAAAAGAAGG - Intronic
1032662695 7:134003297-134003319 GAGTAGGGATTGACTGCAGAGGG + Intronic
1032792910 7:135255518-135255540 GAACACAGCTGCACAGCAGAGGG + Intronic
1032807752 7:135374161-135374183 GAGTTTAGATGGGCAGCAGAAGG - Intronic
1033899197 7:146115817-146115839 GAGGAGAGAAGGAAAGGAGAAGG + Intergenic
1035322644 7:158043391-158043413 GATCAGGGATGAACATCAGAGGG + Intronic
1035322655 7:158043444-158043466 GATCAGGGATGAACATCAGAGGG + Intronic
1035937194 8:3853730-3853752 GAGCAGGGAAGGACAGCATTAGG + Intronic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036428700 8:8669823-8669845 TGGCAGAGATGGGCAGGAGAGGG - Intergenic
1037601581 8:20400768-20400790 AAGCAATGATGGACAACAGAAGG - Intergenic
1038403367 8:27303565-27303587 GAGCAGAGATGGGCAGTAGCAGG + Intronic
1038419290 8:27422148-27422170 GAGCAGGGATGGAGAGCACGAGG - Intronic
1038459844 8:27706559-27706581 GAGGAGAGAAGGACACGAGATGG + Intergenic
1039426244 8:37488640-37488662 GAGCTGAGATCGGCTGCAGAAGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1042119263 8:65466815-65466837 GAGAACACATGGACACCAGAAGG + Intergenic
1042427105 8:68661198-68661220 TAGCAGACATGGGGAGCAGATGG + Intronic
1042674873 8:71308921-71308943 GGCCAGAGATGGAAAGCAAATGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043859348 8:85297999-85298021 TAGCAGAGGTAGACTGCAGAGGG - Intergenic
1044320239 8:90792832-90792854 GAGAAGAGATAGGCAACAGACGG - Intronic
1047661038 8:127037136-127037158 AGGCAGAGAGGGACAGCAGCGGG + Intergenic
1047758867 8:127939331-127939353 GAGCAGAGGTGGACAGGGTATGG + Intergenic
1048550673 8:135431016-135431038 GAGCAGGAAAGGACTGCAGATGG - Intergenic
1048550927 8:135433044-135433066 GAACAGAGGAGGACTGCAGACGG + Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049362811 8:142220329-142220351 AGGCAGAGCTGGGCAGCAGAGGG - Intronic
1049651965 8:143773907-143773929 GAGCTGAGAAGGGCAGCAGCTGG + Intergenic
1049701053 8:144012829-144012851 GAGCAGAGAGGGCAAGGAGAAGG - Intronic
1050860166 9:10418812-10418834 CAACAGAGATAAACAGCAGAGGG + Intronic
1051358812 9:16264161-16264183 GAGCAGAGATGGTCTCGAGAAGG - Intronic
1051897303 9:22001050-22001072 GTGCATAGATAGACGGCAGATGG + Intronic
1053279072 9:36805768-36805790 GAGCAGACACTGGCAGCAGAAGG + Intergenic
1053533163 9:38901444-38901466 GAGCAGTGATCGGCAGCAGTGGG + Intergenic
1054205389 9:62125873-62125895 GAGCAGTGATCGGCAGCAGCGGG + Intergenic
1054353092 9:64036373-64036395 AACCAGAGATGGACAACAGTAGG + Intergenic
1054632972 9:67462497-67462519 GAGCAGTGATCGGCAGCAGCGGG - Intergenic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1055640631 9:78316343-78316365 GATCAGAAGTGGAGAGCAGATGG - Intronic
1056566306 9:87775726-87775748 AAGCAGAGATGGACAGATTAGGG + Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1057294013 9:93824980-93825002 GAGCACAGCTGGGCTGCAGAGGG - Intergenic
1057557620 9:96100307-96100329 GAGCAGAGAAGGGCGGGAGAGGG + Intergenic
1057900891 9:98947372-98947394 AAGCAGAGATTGACTGCAAAGGG + Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1059703683 9:116800180-116800202 GTACAGAGACAGACAGCAGAAGG - Intronic
1060721980 9:125985660-125985682 GTGCAGAGATGGACAACACCTGG - Intergenic
1060927956 9:127468376-127468398 CAGGAGAGATGCACAGCAGAAGG + Intronic
1061010086 9:127949675-127949697 GAGCAGAGCTGGGCAGGAGGTGG - Intronic
1061010440 9:127951290-127951312 GAGCAGAGCTGGGCAGGAGGTGG - Intronic
1061650148 9:132041055-132041077 CAGCAGAGAAGAAGAGCAGAAGG + Intronic
1203696251 Un_GL000214v1:100962-100984 AACCAGAGATGGACAACAGTAGG - Intergenic
1203741426 Un_GL000218v1:5483-5505 AACCAGAGATGGACAACAGTAGG + Intergenic
1203701612 Un_KI270742v1:64-86 AACCAGAGATGGACAACAGTAGG + Intergenic
1203553688 Un_KI270743v1:187102-187124 AACCAGAGATGGACAACAGTAGG + Intergenic
1203640022 Un_KI270751v1:3101-3123 AACCAGAGATGGACAACAGTAGG + Intergenic
1186145088 X:6616696-6616718 GAGCAGAGATGGACAGGGATTGG + Intergenic
1186661028 X:11667110-11667132 GAGAAGAGATGGACAGCGATGGG - Intergenic
1186800563 X:13088339-13088361 GAGCAGAGTTGGAGAAGAGATGG - Intergenic
1188019993 X:25146554-25146576 GAGCAAAGATGGAGAGAGGATGG - Intergenic
1188083544 X:25875363-25875385 GATTAGAGATGGAAATCAGAAGG + Intergenic
1188382616 X:29515406-29515428 AAGGAGAGAGTGACAGCAGAAGG - Intronic
1189033439 X:37472299-37472321 GAACAGAAATGGATAGGAGATGG - Intronic
1189413177 X:40791592-40791614 GAAATGAGATGGACAGGAGACGG - Intergenic
1191936128 X:66428926-66428948 GAGCAGGGATGGATAGCATTGGG + Intergenic
1193946996 X:87750761-87750783 GAGCTGTGATGGCCTGCAGAAGG - Intergenic
1194601291 X:95924331-95924353 GAGCAGAGAAAGACATCAGGTGG - Intergenic
1195538969 X:106040562-106040584 AAGCAGAAATGAACAGCAGTAGG - Intergenic
1195562774 X:106302975-106302997 GAGCAGGGATGGACTGCAAATGG - Intergenic
1195751669 X:108165604-108165626 GACCAGAGAACGCCAGCAGAGGG + Intronic
1196377290 X:115047330-115047352 GAGCAAAGCAGGACACCAGAGGG - Intergenic
1198216780 X:134562795-134562817 GAGGAGATAAGGACAGCAGATGG - Intergenic
1199146328 X:144372471-144372493 CAGCAGAGAGAGAGAGCAGAAGG - Intergenic
1199599763 X:149534982-149535004 GAAGAAAGAAGGACAGCAGATGG - Intergenic
1199642952 X:149881467-149881489 GAGCAGGGCTGGTTAGCAGAGGG + Intronic
1199844367 X:151680075-151680097 GAGCTGAGATGGAGAACATAAGG - Intergenic
1199900163 X:152165304-152165326 GAGCAGAGATGAAGAACAAAAGG + Intergenic
1200108853 X:153728853-153728875 GAGCAGCGCAGGACAGCAAAAGG - Intronic
1200769758 Y:7112885-7112907 GAGAAGAGATGGACAGCGATGGG + Intergenic
1201154955 Y:11122937-11122959 AACCAGAGATGGACAACAGTAGG + Intergenic
1201304943 Y:12542153-12542175 GGGCAGACATGGAGAGCAGCAGG + Intergenic
1201349380 Y:13023195-13023217 GAGCAGCAATGGGCAGTAGATGG + Intergenic
1202379263 Y:24261501-24261523 GAGGGGAGAGGGGCAGCAGAAGG - Intergenic
1202491519 Y:25408620-25408642 GAGGGGAGAGGGGCAGCAGAAGG + Intergenic