ID: 1015712163

View in Genome Browser
Species Human (GRCh38)
Location 6:136154018-136154040
Sequence CTAGTATACCACTCCTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015712160_1015712163 -6 Left 1015712160 6:136154001-136154023 CCCACAGTAAGTCTAAGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG 0: 1
1: 0
2: 1
3: 3
4: 71
1015712161_1015712163 -7 Left 1015712161 6:136154002-136154024 CCACAGTAAGTCTAAGCTAGTAT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG 0: 1
1: 0
2: 1
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015712163 Original CRISPR CTAGTATACCACTCCTATTT GGG Intronic
900845505 1:5097204-5097226 CTAATACACCACTCTTATTTTGG - Intergenic
908925700 1:69251937-69251959 CTATTATACTACTCTTATTCTGG - Intergenic
909832079 1:80204405-80204427 GTTGTATAGTACTCCTATTTTGG + Intergenic
911895322 1:103426367-103426389 CTTGTAATCCACTCCCATTTTGG + Intergenic
916050317 1:161031503-161031525 CAACTATACCACTTCGATTTTGG - Intronic
917376287 1:174351181-174351203 CTAGTAAACTACTCACATTTTGG - Intronic
917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG + Intergenic
921283488 1:213588994-213589016 CTGGTATAGCAGCCCTATTTTGG + Intergenic
921929141 1:220740542-220740564 CTATTATACCACTATTATTGTGG - Intergenic
924905866 1:248451845-248451867 CTAGTAATCCACTGCTACTTGGG - Intergenic
924922023 1:248640191-248640213 CTAGTAATCCACTGCTACTTGGG + Intergenic
1071138588 10:82480554-82480576 CTCATATACCACTCTGATTTGGG - Intronic
1082732419 11:56816226-56816248 TTAGTATAACACTGCTATTGGGG - Intergenic
1083580569 11:63822463-63822485 CTGCTATACCACTCTTAATTTGG + Intronic
1086242609 11:84714028-84714050 CTAGTTTCCCAGTACTATTTTGG - Intronic
1087430587 11:98048193-98048215 CTAGTGTGGCACTCCTTTTTTGG - Intergenic
1087443756 11:98219588-98219610 CTAGTGCACCACTTCAATTTTGG + Intergenic
1088090183 11:106029105-106029127 CTATTATAACAGTCCTATGTGGG + Intergenic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1097762639 12:63485589-63485611 CTAGTTTACTACTCACATTTAGG - Intergenic
1100515261 12:95321293-95321315 CTAATATAACACTGCTAGTTAGG - Intergenic
1101496615 12:105260515-105260537 CCATTATACCACTTTTATTTAGG - Intronic
1111534502 13:89585065-89585087 TTACTATAAAACTCCTATTTGGG + Intergenic
1114721154 14:24883435-24883457 CAAGTATACCACTATTACTTTGG + Intronic
1115056086 14:29128880-29128902 CTAGGATGCCAGTCCTATGTTGG - Intergenic
1118866445 14:69707965-69707987 CTGGTATAAAACTCCTATATAGG - Intronic
1119625795 14:76174244-76174266 CTATTCTACCATTCCTATCTGGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1120697927 14:87665139-87665161 CTAGTTAACCACTCTCATTTGGG - Intergenic
1124130552 15:26981608-26981630 CAAATATACCACTCCTCTCTTGG - Intronic
1125046698 15:35249660-35249682 ATAATATGCCACTCCAATTTTGG + Intronic
1128403929 15:67315816-67315838 CTAGTTTAACACTCCCATTTGGG + Intronic
1133940006 16:10301320-10301342 CTTGTAAGCCACTGCTATTTGGG + Intergenic
1138739002 16:59285688-59285710 TTCGTATACCACTCTTATGTGGG - Intergenic
1148948837 17:51290558-51290580 CTAGTATACCACTCCCATTAGGG - Intronic
1154069941 18:11144985-11145007 CTACTATACCACCCGTCTTTAGG - Intronic
1159521380 18:69529169-69529191 CTGGTATATCACTCCTATTCCGG - Intronic
1167867742 19:52341961-52341983 CCAGTATGCCACTAATATTTTGG + Intronic
928672357 2:33614490-33614512 ATAGTATTCCCCTCCTTTTTGGG + Intergenic
937541689 2:122963393-122963415 CTATTATGCCACTCCTGTGTTGG + Intergenic
937674689 2:124577440-124577462 CTTGTACATCTCTCCTATTTTGG + Intronic
940736118 2:157454304-157454326 ATAGTATACCAGTCATTTTTGGG + Intronic
942481954 2:176398031-176398053 CAAGTATATTATTCCTATTTTGG + Intergenic
1172103642 20:32502169-32502191 CTGGTATTTAACTCCTATTTTGG - Intronic
1177452610 21:21290836-21290858 GTAGTAGGCCACTCCAATTTGGG - Intronic
1177724757 21:24952865-24952887 CTAATATTCCACTCATGTTTAGG + Intergenic
952184099 3:30949831-30949853 ATACTATACCACTCCTTCTTGGG - Intergenic
953266496 3:41394313-41394335 GTAGTATCACACTCCTCTTTGGG + Intronic
954413946 3:50383799-50383821 CTTGTCAACCACTCCTACTTGGG + Intronic
958479053 3:94623489-94623511 CTAGGCAACCTCTCCTATTTTGG + Intergenic
962179623 3:133192276-133192298 CTAGTTTACTCCTCTTATTTTGG + Intronic
963302869 3:143618385-143618407 CTAATATTCTACTCCTATTATGG - Intronic
964531971 3:157678508-157678530 CTAGTCTATAACTCCTATTATGG - Intergenic
964557781 3:157959544-157959566 GTAGTATCCCACTCCTAAATGGG - Intergenic
972501815 4:39684903-39684925 CTAATGTAGCAATCCTATTTCGG - Intergenic
976380987 4:84398448-84398470 CCAGTATTCCATTCCTCTTTTGG - Intergenic
978489447 4:109296598-109296620 CTTGTCCAGCACTCCTATTTTGG + Intronic
979787223 4:124731501-124731523 CTAGAATACCACGCCTACTCAGG - Intergenic
981917113 4:150046547-150046569 CTAGTTCCCCAGTCCTATTTTGG - Intergenic
984119597 4:175725605-175725627 CTAATATAACACTCCTCATTTGG - Intronic
987979960 5:25070405-25070427 CTAGAAAAACCCTCCTATTTAGG - Intergenic
992518018 5:77516488-77516510 CTATTATGGCACTCTTATTTTGG - Intronic
995638055 5:114218771-114218793 CTAATATACCACTCTTGTGTGGG + Intergenic
1000492404 5:161930633-161930655 CTAGTATTACACTAGTATTTAGG + Intergenic
1003779702 6:9410599-9410621 CTAATGTACCATTCATATTTAGG + Intergenic
1010242019 6:73624950-73624972 CTTGGATACCACTGATATTTAGG + Intronic
1015712163 6:136154018-136154040 CTAGTATACCACTCCTATTTGGG + Intronic
1016086475 6:139921132-139921154 CTGATATACCACTCCTACTCTGG + Intergenic
1030492611 7:110256630-110256652 CTAATATACCAATAATATTTGGG + Intergenic
1041442856 8:57916970-57916992 ATAGTCTGCCACTCCTCTTTTGG - Intergenic
1054730979 9:68702844-68702866 CTTGTAGTCCACTCCTATTCTGG - Intergenic
1058667858 9:107336978-107337000 CTAGTGTAGCACTCCTATGATGG + Intergenic
1186548177 X:10473362-10473384 CAAACATACCACTCCTATTAAGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190435026 X:50415743-50415765 CTAGTTCACCATTTCTATTTTGG + Intronic
1198223289 X:134622508-134622530 CTAGTTTACCCATCCGATTTTGG - Intronic