ID: 1015712678

View in Genome Browser
Species Human (GRCh38)
Location 6:136159381-136159403
Sequence GCTGGGGTTCAGATTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015712678_1015712686 -1 Left 1015712678 6:136159381-136159403 CCATCCCCAATCTGAACCCCAGC 0: 1
1: 0
2: 3
3: 32
4: 407
Right 1015712686 6:136159403-136159425 CCTTCCCTGCAGACAGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015712678 Original CRISPR GCTGGGGTTCAGATTGGGGA TGG (reversed) Intronic
900179145 1:1303736-1303758 GCTGGGGCTGAGAAAGGGGAGGG - Intronic
900899080 1:5504582-5504604 CCTGGGTCTGAGATTGGGGAAGG + Intergenic
901043279 1:6378793-6378815 GCTGGTGTTCAGCAAGGGGAGGG + Intronic
903271394 1:22190561-22190583 GCCGGGGCACAGGTTGGGGATGG + Intergenic
903441394 1:23390590-23390612 GCTGGAGGTCAGATTGTGGAAGG + Intronic
903950045 1:26991436-26991458 GCTGGGGCTCAGTAGGGGGAAGG - Intergenic
904361592 1:29976729-29976751 ACTGAGGTTCAGAGAGGGGAAGG - Intergenic
904945251 1:34194382-34194404 GCCTGGCTTCAGGTTGGGGAGGG + Intronic
905304122 1:37005868-37005890 GATGGGGGCCAGATTGTGGAAGG + Intronic
905346937 1:37317795-37317817 ACTGGGGCTCAGGTTGGGGCTGG - Intergenic
905415956 1:37804383-37804405 GATGGGGGACAAATTGGGGATGG - Exonic
905579967 1:39076838-39076860 ACTGGTGGTCAGATTTGGGAAGG + Intergenic
905920038 1:41713191-41713213 GCTGGGGCGCAGATCGGGGGTGG - Intronic
906159479 1:43637155-43637177 GATGGGGTGCAGAATGGGCAGGG + Intergenic
906803695 1:48759472-48759494 AATGGGGTTCCGAGTGGGGAAGG + Intronic
906984644 1:50670196-50670218 GCCGGGGGTGAGATAGGGGAGGG + Intronic
907308886 1:53528252-53528274 TGTTGGGTTCAGGTTGGGGATGG + Intronic
908095325 1:60731467-60731489 GCTGGGTTTCAGTTTGAGCATGG - Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
910859232 1:91727396-91727418 GCTGGGGTTCAGAGAGGTTAGGG + Intronic
910891826 1:92026851-92026873 GCTGGGCATCAGAGGGGGGACGG + Intergenic
912058149 1:105631548-105631570 GCTGGGGTTCCGGGTGGGTATGG - Intergenic
912753938 1:112308814-112308836 GCTGGGGTTCATAAGGGGAAGGG + Intergenic
915216695 1:154345182-154345204 GCTGGGCTTGAGGCTGGGGAGGG + Intronic
915357904 1:155267500-155267522 GCTGGGGTTGGGATTTAGGATGG - Intronic
915453157 1:156020797-156020819 GCTGGGGGTTAGCTAGGGGAGGG - Intronic
915475379 1:156149985-156150007 GATGGGGTTGAGAATGGGGGTGG + Intronic
916619426 1:166480068-166480090 GCTGGGGTTTAGATAGGTAAAGG + Intergenic
917194348 1:172449983-172450005 GCTGGAGTGGAGAATGGGGAAGG + Intronic
917581836 1:176386707-176386729 GCTGGGGTTGAGGTGGGGGTAGG + Intergenic
919810104 1:201403894-201403916 GAAGGGGTTGTGATTGGGGAGGG + Intronic
920749526 1:208660395-208660417 GCTGGGGTTCAGCATTGAGAAGG - Intergenic
921274523 1:213505702-213505724 GCTGGGGTTCAGACCTGGGCAGG + Intergenic
922675572 1:227547058-227547080 TCTGGGGTTCAGGCTGGGGGTGG + Intergenic
923766302 1:236895242-236895264 GCTGTGGTCCAGATGAGGGAGGG + Intronic
923826097 1:237502483-237502505 GCTGGGGTTGAAGGTGGGGATGG + Intronic
923826370 1:237504833-237504855 GCTGGGGTTGAAGGTGGGGATGG + Intronic
923863208 1:237913391-237913413 GCTGGGTTACACCTTGGGGAGGG + Intergenic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1064124821 10:12650678-12650700 GCTGCGCTGCAGATTGGGGCGGG - Intronic
1064731358 10:18334274-18334296 GCTGGGTGTCAGATTGCAGATGG - Intronic
1064873965 10:19971910-19971932 GCTGGGGATCTGATTGGGCAGGG + Intronic
1065231122 10:23599347-23599369 AATGTGGTTCAGATTGTGGATGG + Intergenic
1069862618 10:71481057-71481079 GGTGGGGTTGAGGTTGGGAAAGG + Intronic
1069889411 10:71643886-71643908 GCAGGGGTTGGGCTTGGGGAGGG + Intronic
1070122196 10:73588710-73588732 GCAGGGGATAAGATTGTGGAAGG - Intronic
1070602779 10:77877538-77877560 GCCGGGCTGCAGGTTGGGGATGG + Intronic
1070999427 10:80816114-80816136 GGTGGAATTCAGATTGGGGATGG - Intergenic
1071522324 10:86339092-86339114 GCTGGGGTTCAGGGTGGACATGG - Intronic
1071569298 10:86687695-86687717 GCTGGGTTTCTGGTTTGGGAAGG + Intronic
1072407543 10:95168964-95168986 TCAGGGGTTCAGGTGGGGGAGGG - Intergenic
1072454364 10:95562865-95562887 GATGAGGTGCAGATAGGGGAAGG - Intergenic
1072940554 10:99760014-99760036 GCTGGGGTTCAGATTTGCACGGG - Intergenic
1074079005 10:110152677-110152699 GATGGGGTTCTGAATGGGGAAGG + Intergenic
1074197635 10:111203281-111203303 GCAGGTGTTCAGAGTGGGGAGGG + Intergenic
1074272747 10:111971155-111971177 GGTGGGGTGCAGGTTGTGGAGGG - Intergenic
1074408401 10:113201337-113201359 CCTGGGGTTCAGGATGGGGTAGG - Intergenic
1075304089 10:121352208-121352230 GTGGGGGTACAGATTAGGGAGGG - Intergenic
1075563147 10:123482977-123482999 GATGGGGTCCAGGTTGGGGGTGG - Intergenic
1076131123 10:128014708-128014730 GCTGGGGTTGAGACGGGGGATGG - Intronic
1076227595 10:128792805-128792827 GGTGGGATTCAGGATGGGGAAGG + Intergenic
1076866841 10:133170838-133170860 GCTGGGGTTGGGCTTGGGGTTGG - Intronic
1076883859 10:133252442-133252464 GCTGGGGTGCAGGGTGGGGCGGG - Intergenic
1077048670 11:556983-557005 GCTGGTGTTCAGACAGGGCAGGG + Exonic
1077135892 11:998325-998347 GCGGGGGGTCAGAATGGGGGCGG - Intronic
1077603929 11:3594238-3594260 GCTGGTGTCCAGCTCGGGGACGG + Intergenic
1077826202 11:5810604-5810626 GCTGGTGTTAACATTGTGGAAGG + Intronic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1079104270 11:17560462-17560484 GCTCGTGTGCAGGTTGGGGATGG + Intronic
1080421898 11:32118034-32118056 GCTGGGGTTGAGTCTGGGGGTGG - Intergenic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081758326 11:45560203-45560225 GTTGGGCCTCAGGTTGGGGAGGG - Intergenic
1081981696 11:47270482-47270504 GCTCGGGTTCAGGTTCGGGGCGG + Intronic
1082784783 11:57311033-57311055 GATGGGGGTCAGATGGGGCATGG - Intronic
1083234199 11:61341533-61341555 GCTGGGGAAGAGAGTGGGGAAGG + Intronic
1083269874 11:61566628-61566650 GGAGGGGCTCAGAATGGGGAGGG + Intronic
1083945138 11:65919265-65919287 GCGGCGGTCCAGACTGGGGAGGG + Exonic
1084091160 11:66880161-66880183 CCTGGGTTTCAGATCTGGGAAGG - Intronic
1084273687 11:68041484-68041506 GCTGGGGTTCAAATGGGGCCAGG - Intronic
1086326492 11:85706670-85706692 GCTGGAGTTCAGGTTGTGAAGGG + Intronic
1087271262 11:96114422-96114444 ACTGAGGTTCTGAGTGGGGAGGG - Intronic
1087706972 11:101504362-101504384 GCTGGAGTTCAGACTGGCTAGGG + Exonic
1088011609 11:105008581-105008603 CCTTGGGTTCAGATTGTGCATGG - Intronic
1088412213 11:109546964-109546986 GTAGAGGTTCAGAATGGGGAAGG + Intergenic
1089291483 11:117440034-117440056 GGTGGAGGTCAGATCGGGGAGGG - Intronic
1089345524 11:117788989-117789011 GCTGGCGTTTAGTTGGGGGAGGG - Intronic
1090635365 11:128687566-128687588 GCGGGGCTTCAGGATGGGGAGGG - Intronic
1091638186 12:2214001-2214023 ACTGGCGCTCACATTGGGGAGGG + Intronic
1091791343 12:3273865-3273887 GCCGGGGCTGAGATCGGGGAGGG - Intronic
1091833164 12:3564717-3564739 CTTGGGGTCCAGATTGGGCATGG + Intronic
1093115636 12:15207389-15207411 GCTCAGGTACAGATTTGGGAAGG + Intronic
1094581660 12:31739195-31739217 GCTGGGGTGGAGATGGGGGTTGG + Intergenic
1094617138 12:32046144-32046166 CATGGGGTTCAGGTTGGGGGTGG + Intergenic
1094825170 12:34264182-34264204 GTTGGGGTGGAGTTTGGGGACGG - Intergenic
1096913628 12:55009336-55009358 GCTGGGGGCCAGAGTGGGGATGG + Intergenic
1097392090 12:59027247-59027269 ACTGAGGTTCAGAGTGGTGAAGG + Intergenic
1097902997 12:64891814-64891836 GTAGGGGCTCACATTGGGGAGGG - Intergenic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1098672849 12:73252833-73252855 GCTGGAGGTCTCATTGGGGAAGG - Intergenic
1098893202 12:76030733-76030755 GCTGGGGTTGTGATTGGGGCTGG + Exonic
1100930712 12:99606916-99606938 GCTGGGGTGAACAATGGGGAGGG - Intronic
1101113335 12:101507233-101507255 GCTGGGGTTCAGACTGGCATGGG + Intergenic
1101310352 12:103573206-103573228 GCTGGAGTTCAGATTTGGTTAGG + Intergenic
1101534878 12:105607513-105607535 GCTGGGGGTCTCGTTGGGGAAGG + Intergenic
1101777256 12:107806218-107806240 GCAGGGATTCAGATTGGGGGTGG - Intergenic
1102412871 12:112735526-112735548 GCTGGAGTTAAGATTTCGGAGGG + Intronic
1102547961 12:113670255-113670277 GGTGGGGCTCAGGCTGGGGAAGG + Intergenic
1102678106 12:114672171-114672193 CATGGTGTTCAGATTGAGGAAGG + Exonic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103403518 12:120659204-120659226 GATGGGGGTCAAATTGGAGAAGG + Intronic
1103775476 12:123364183-123364205 TGTGGGGTTCAGATTTAGGAAGG + Intronic
1104196152 12:126540303-126540325 GAAGGGGTTAAGATTGGGTAGGG + Intergenic
1104526796 12:129531695-129531717 GCTGAGGTTCAGATAGGGGAAGG + Intronic
1105838895 13:24236088-24236110 GCTGGGTTTCCAAATGGGGAAGG + Intronic
1106078325 13:26479712-26479734 GCTTGTGTTCAGAGTGGGGGAGG + Intergenic
1108431590 13:50359127-50359149 GCTGGGGTGCGGGTGGGGGATGG + Intronic
1108855829 13:54791536-54791558 GCTGGGTTTCAGATTTGTGTGGG - Intergenic
1112339131 13:98537984-98538006 GCTGGAGGTCAGAGTGGGCAGGG + Intronic
1113040803 13:106102048-106102070 GCAAGAGCTCAGATTGGGGATGG + Intergenic
1114633667 14:24175335-24175357 ACTGGGGTGCGGGTTGGGGAGGG + Intronic
1114918459 14:27296370-27296392 GCTGGGTTTCAGATTTGTGTGGG - Intergenic
1115488758 14:33938577-33938599 ACTGGGGTAGAGATGGGGGAGGG - Intronic
1117270453 14:54138169-54138191 GGTTAGGTTCAAATTGGGGATGG - Intergenic
1118059537 14:62120146-62120168 GCTGGTGTTCAAATTGATGAGGG - Intergenic
1118228496 14:63926202-63926224 GATGGGGGTGGGATTGGGGAGGG - Intronic
1118228507 14:63926226-63926248 GCTGGGGGTGAGATTGGAGGTGG - Intronic
1118388987 14:65280691-65280713 GCTCTGGTTCAGATGGCGGACGG + Intergenic
1119969423 14:78952852-78952874 GCTTGGGTGGAGGTTGGGGAGGG - Intronic
1121426546 14:93856351-93856373 GCAGGGGTACAGATTGGAGAGGG + Intergenic
1121979240 14:98439910-98439932 GCAGGAGTTGAGAGTGGGGAGGG + Intergenic
1122201860 14:100127664-100127686 GCAGGGGTTCAGTTAGGTGAAGG - Intronic
1122427959 14:101622698-101622720 GCTGGGGTCCAGAATGGGTAGGG - Intergenic
1122515019 14:102301531-102301553 GCTTGGGGTCAGAGTGGGGCTGG - Intronic
1122607692 14:102958455-102958477 GATGGGGTGCAGGGTGGGGAAGG - Intronic
1122649762 14:103220178-103220200 CCAGGGCTTCAGGTTGGGGAAGG - Intergenic
1122937559 14:104967075-104967097 GCTGGGGTCATGAGTGGGGAGGG + Intronic
1123699237 15:22902376-22902398 GCAGGGGTGCAGACTCGGGATGG + Intronic
1124366394 15:29074483-29074505 GCAGGGGCTCAGGTTGGGGTTGG + Intronic
1126105633 15:45145244-45145266 GGTGGGGTTCAGATGGGGGCAGG - Intronic
1126169057 15:45679331-45679353 TTTGGGGTGCAGATTGAGGATGG + Intronic
1127968062 15:63938673-63938695 TCTGGGGTACAGAATGGGCAGGG + Intronic
1127970003 15:63951188-63951210 GCTTGGGTGCAGATTGGGGGTGG + Intronic
1128470040 15:67944187-67944209 GCTGGGGTTCAGAGTGTCCAGGG - Intergenic
1128498615 15:68211863-68211885 GCTGGGGTTCAGAGTGGGGTTGG + Exonic
1128531116 15:68448691-68448713 GCTGAGGCTCAGATAGGGGAAGG - Intergenic
1130172126 15:81525743-81525765 GCTGGGTCTCAGATGGAGGAAGG + Intergenic
1130677749 15:85968545-85968567 GATGGGGTTCTGAGTGGGAAGGG - Intergenic
1131612161 15:93976587-93976609 GATGGTGCTCACATTGGGGAAGG + Intergenic
1132501360 16:286041-286063 GTTGGGGTTGAGGTTGGGGTTGG - Intronic
1132532820 16:461878-461900 GCTGGGGGACAGACTGGAGATGG - Intronic
1132724045 16:1331191-1331213 CCTGGGGCTCAGGGTGGGGAGGG + Intergenic
1132968533 16:2673373-2673395 GCTGGAGTTCAGCTTAGGGAAGG - Intergenic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1136459001 16:30398428-30398450 GCTGGGGATCAGAGCGGGTAGGG - Exonic
1137596446 16:49727319-49727341 GCCGGGCTCCAGGTTGGGGACGG + Intronic
1138230472 16:55332317-55332339 GCTGAAGATCAGATTGGAGAAGG + Intergenic
1139704564 16:68732334-68732356 CATAGGGTTCAGATTGGGGTGGG - Intergenic
1140283064 16:73573260-73573282 GGTGAGGTTCACACTGGGGAGGG - Intergenic
1140702800 16:77598061-77598083 GGTGGGGGTCAGGTTGGAGATGG - Intergenic
1141225568 16:82111576-82111598 ACTGGGGTTGGGAATGGGGAGGG + Intergenic
1143015032 17:3887176-3887198 ACTGGGGCTCAGAGTCGGGAAGG - Intronic
1143582520 17:7835221-7835243 GCTGGGGTAAATAGTGGGGAGGG + Intergenic
1143697397 17:8630590-8630612 GCTGGGGGACAGTTTGTGGAGGG - Intronic
1143787262 17:9265287-9265309 TCTGGGGCCCAGATTGGGGCAGG + Intronic
1144250945 17:13416162-13416184 GCTTGGGTTTGGATGGGGGAGGG - Intergenic
1144853056 17:18253776-18253798 GCTGGGGTTCACACTAGGGCTGG - Intronic
1145090081 17:19978640-19978662 CCTGGGGTTGGGGTTGGGGAGGG + Intergenic
1145828807 17:27898366-27898388 GCTTGGGTGCAGGTTGGAGAAGG - Intergenic
1146461994 17:33053604-33053626 GGTGGGGGTCAGATTGGAGGAGG - Intronic
1146570770 17:33950654-33950676 GCTGAAGTTCAGAGAGGGGAAGG + Intronic
1146589632 17:34117561-34117583 CCTGGGGTCCAGACTGGGAAGGG + Intronic
1147944877 17:44075241-44075263 GCTGGGGGTCGGGGTGGGGAGGG + Intronic
1148054633 17:44786833-44786855 GCAGGGGTTCAGGTGGCGGAGGG - Intergenic
1148427265 17:47610148-47610170 GGTGGGGCTGAGAGTGGGGAGGG - Intronic
1148800573 17:50222388-50222410 GCTGGAGTTGAGAGTGGGAAAGG - Intergenic
1148979977 17:51564461-51564483 GCTGAGTTCCAGATTGGTGAGGG + Intergenic
1149485819 17:57042031-57042053 GCTTGGGGTCAGGTGGGGGAGGG + Intergenic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1152134348 17:78495136-78495158 GCAGGGGTGTAGGTTGGGGAGGG - Intronic
1152209705 17:78996514-78996536 GCTGGGGTTCAGGGAGAGGAGGG + Intronic
1153328586 18:3848568-3848590 GCTGGGGTGGAGATGGGGGCGGG - Intronic
1153527835 18:6014650-6014672 GCTGGAGCTCAGAGTGGGGCAGG + Intronic
1154172880 18:12063636-12063658 GGTGGGATTCAGATTGGGGGTGG - Intergenic
1155199238 18:23503213-23503235 GCGGGGGTACAGGTTGGGGCAGG + Intergenic
1155271983 18:24149866-24149888 GCTGGAGTTCCGAGTGGGCATGG - Intronic
1155852257 18:30788492-30788514 GCTGGAGTTCCGGTTGGGCATGG + Intergenic
1157601347 18:48894904-48894926 GATTGGGGTCAGCTTGGGGAGGG - Intergenic
1157741254 18:50095497-50095519 GCTGGGGTTCAGAATGAGAGTGG + Intronic
1158335604 18:56412823-56412845 GCTACTGTTCAGATTGGGGCTGG - Intergenic
1160706043 19:530890-530912 GCTCGGGCTCAGCTTGGGGTGGG + Intergenic
1160971431 19:1769463-1769485 GATGGGGTTCAGAGTGGGGACGG - Intronic
1161149955 19:2702467-2702489 GCTGGGGTTGGAATTGGGGACGG - Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162321049 19:9970761-9970783 GCTGGGGTGAGGCTTGGGGAAGG - Intronic
1162968390 19:14166337-14166359 GATGGGGATCAGGTTGGGGGTGG + Intronic
1163102248 19:15105266-15105288 GCTGTGGTTCAGTTTGGACAGGG - Intergenic
1163103143 19:15109419-15109441 GCTGGTGCTCACCTTGGGGAAGG - Intronic
1163283572 19:16332140-16332162 AGTGGGGTTCAGAGAGGGGAAGG + Intergenic
1163606630 19:18279528-18279550 GCTGATGTCCAGGTTGGGGAGGG - Intergenic
1163653573 19:18532637-18532659 GCTGGGGCACAGAATGGGCAGGG - Intronic
1164684717 19:30159096-30159118 GCTGAGGTTCAGAGGAGGGAGGG - Intergenic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1166356368 19:42229881-42229903 ACTGGGGATCAGAGAGGGGAAGG - Intergenic
1166624226 19:44335202-44335224 GCTGGGTTTCAGATTGGCATGGG + Intronic
1167119990 19:47511121-47511143 GCTGGGGTTCCCAAAGGGGAAGG + Intronic
1167477518 19:49709475-49709497 GCTGGGGTTGGGGATGGGGATGG - Intronic
1167514575 19:49915673-49915695 GCTGGGGTTGAGAAAGGGGCTGG + Intronic
1167666657 19:50826370-50826392 GTTGGGGTTGAGAATGGGAATGG - Intronic
1167750243 19:51374985-51375007 GCTGGGGTTAATAATGGAGAGGG - Intergenic
1168241765 19:55092326-55092348 GCTGGGGGTCAGGTAGAGGAGGG + Exonic
1168327044 19:55543853-55543875 GCTGGGGGTGGGATTGAGGATGG - Intronic
925187092 2:1855515-1855537 GCTGGGGAGCAGAGTGGGGTTGG + Intronic
926095251 2:10077215-10077237 GCTGGGGTTGTGCTGGGGGAGGG - Intronic
926672797 2:15591562-15591584 GCTGGGGGACTGAGTGGGGAGGG + Intronic
926695957 2:15770381-15770403 GCTGGGGTCCAGAGGTGGGAGGG - Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927861295 2:26561817-26561839 GCTGCCGTTCATTTTGGGGATGG - Intergenic
927922013 2:26979937-26979959 GCTGAGGGTCAGGTTGTGGATGG + Intronic
928040869 2:27875769-27875791 GCTGGGGCTGAGATTGAGGGTGG + Intronic
930940991 2:57014032-57014054 GCTGGGTTTCAGATTTGTGGTGG + Intergenic
932499922 2:72174323-72174345 GGTGGGGTCCTGAGTGGGGACGG - Intergenic
933934110 2:87186734-87186756 GCTGGGGTTAAGGGTGGGCATGG - Intergenic
934557648 2:95295971-95295993 GCTGGACTTCACACTGGGGAAGG - Intergenic
934762568 2:96864647-96864669 GCTGGGGTTCAGGTCAGGGACGG - Intronic
935195735 2:100814632-100814654 TCTGGGCTTCAGGTTGGGAAAGG - Intergenic
935744574 2:106179243-106179265 GCGGGGGTTCAGGGTGGGGTGGG - Intronic
936072843 2:109382861-109382883 GCTGCAGGTCAGATTGGGGCAGG - Intronic
936359033 2:111779161-111779183 GCTGGGGTTAAGGGTGGGCATGG + Intronic
936702886 2:115035004-115035026 GCTTGTGTTTAGATTGGGAAAGG - Intronic
937270121 2:120644311-120644333 GGTGGGGTTAAGTTTAGGGAGGG - Intergenic
937381737 2:121383461-121383483 GCTGGGCCTCTGCTTGGGGAAGG + Intronic
937951883 2:127394532-127394554 CCTGTGGTCCAGATTAGGGAGGG - Intergenic
937990631 2:127660064-127660086 GCTGGGCTTCTGGTTGGGGTGGG + Intronic
939738808 2:145881221-145881243 GCTGGAGTTCAGGGTGGGCATGG - Intergenic
940871362 2:158863188-158863210 GAAGGGGTTCAGCATGGGGATGG - Intergenic
940980322 2:159994325-159994347 GCAGGGGTGGAAATTGGGGAGGG + Intronic
942646959 2:178122481-178122503 GATCGGGTTAAGACTGGGGATGG - Intronic
942803518 2:179903010-179903032 GCTGTGTTTCAGATTTGTGAGGG - Intergenic
944856772 2:203775599-203775621 GCTGGATTTCAGAGTGAGGAGGG + Intergenic
946024600 2:216664345-216664367 GCTGGGGTACAGGTTTGGGGAGG + Exonic
946297789 2:218799497-218799519 GGAGGGGTTTATATTGGGGAGGG - Intronic
946958923 2:224962112-224962134 GCTGGGGTTCATTTCAGGGAAGG - Intronic
948041123 2:234902436-234902458 GATGGGGGACAGATTGTGGACGG + Intergenic
948752302 2:240139732-240139754 GCTAGGGCTCAGAGTTGGGAGGG + Intronic
948768878 2:240237131-240237153 GGTGGGGTGGGGATTGGGGAAGG + Intergenic
948893487 2:240917916-240917938 GCAGGGGCACAGCTTGGGGAGGG - Intergenic
948939773 2:241190010-241190032 GATGGGGGTCAGAGAGGGGATGG - Intronic
948981164 2:241495634-241495656 ACTGCTGTTCAGATAGGGGACGG - Exonic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1169824565 20:9753059-9753081 GCTGGAGATCAGCTTGGGGTTGG - Intronic
1170696376 20:18662984-18663006 GCTGGGGTTGTGACTGGGGCAGG + Intronic
1171793438 20:29548478-29548500 GCTGAGGTCCAGTTTGGGGCGGG - Intergenic
1171855022 20:30335901-30335923 GCTGAGGTCCAGTTTGGGGCGGG + Intergenic
1171933097 20:31246334-31246356 GCTGGGTCTCAACTTGGGGAAGG - Intergenic
1172867923 20:38113875-38113897 GCTGAGGTCCAGCATGGGGAAGG + Intronic
1173852491 20:46227770-46227792 GTTGGGGCTCAGAGTGGGGATGG - Intronic
1174218168 20:48932980-48933002 GCTGGGTTTGAGGTTGGTGATGG + Intronic
1174278220 20:49419264-49419286 GCTGAGGTTCCGAGTGGGGAAGG + Intronic
1174447136 20:50597833-50597855 GCTGGGCTTCTGCTGGGGGACGG - Intronic
1175010925 20:55735174-55735196 GGTGGGGTTAACATTGGGAAGGG + Intergenic
1176267318 20:64216980-64217002 CCTGGGCTGCAGATTGGGGTTGG + Intronic
1177898278 21:26881435-26881457 GCTGGGGTTTATATTGAGGTTGG + Intergenic
1178123980 21:29497941-29497963 GCTGGGGTAAGGAGTGGGGATGG - Intronic
1179289435 21:40005910-40005932 GCTGGGATCCAGAGTGTGGATGG + Intergenic
1181572335 22:23774328-23774350 GCTGGGGGCCAGCTTGGGGTGGG + Intronic
1181625631 22:24120369-24120391 GCTGGCGTTTAGATTTGGGGAGG + Intronic
1181629817 22:24144828-24144850 GCTGGAGATAAGCTTGGGGAAGG - Intronic
1181775067 22:25153559-25153581 CCTGGGTTTGAGATTGGGGCTGG + Intronic
1181887200 22:26030690-26030712 GATGGGGTGCAGATAGGGGTAGG + Exonic
1182239466 22:28903575-28903597 GGAGGGGTTCAGGATGGGGAGGG - Intronic
1183200242 22:36380798-36380820 GTTGGGCTTCAGGTTGGGGTGGG + Intronic
1183429188 22:37755478-37755500 CCTGGGGTCCATAGTGGGGAGGG + Intronic
1183540370 22:38426417-38426439 GCAGGGGGTTAGTTTGGGGAGGG - Exonic
1184504828 22:44894394-44894416 ACTGAGGTTCGGAGTGGGGAAGG + Intronic
1184522747 22:45005246-45005268 GCTGTGATTCAGATAGTGGAGGG - Intronic
1184556515 22:45236139-45236161 GCTGAGCTTCAGCGTGGGGAGGG - Intronic
1184901287 22:47448126-47448148 GCAGAGGTGCAGTTTGGGGAAGG - Intergenic
1185314779 22:50174298-50174320 GCTGGAGATGAGCTTGGGGATGG + Intronic
1185333026 22:50260139-50260161 GCTGGGGGTCAGGGTGGGCATGG + Intronic
949569441 3:5278004-5278026 GCTGGGGTTCTGAAAGGGCAAGG + Intergenic
949760065 3:7460418-7460440 GCTGGGGCTCACATTGGGAGAGG + Intronic
950326470 3:12114989-12115011 ACTGGGGATAACATTGGGGATGG - Intronic
950449644 3:13058495-13058517 GCTGGGGTTCAGAGAGGTAAAGG + Intronic
952302579 3:32116596-32116618 GCTGGGGTGGGGATTGGGGTGGG + Intronic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
952883217 3:37998200-37998222 GCTGGGGTTGTGGATGGGGAAGG - Intronic
953286196 3:41612257-41612279 GAGGGAGTTCAGCTTGGGGAAGG - Intronic
953679787 3:45030582-45030604 GCTGGGGATCAGATGGGGCTGGG - Intronic
954296650 3:49678046-49678068 GCTGGGGTTAGGATGGTGGATGG - Intronic
954505760 3:51071084-51071106 TCTGTGGTTCAGATGGGGAAAGG + Intronic
954885230 3:53867576-53867598 GATGGGGGTGAGACTGGGGAAGG - Exonic
954942309 3:54385334-54385356 GCTGAGGCTCAGACAGGGGAAGG + Intronic
955345039 3:58154650-58154672 GCTTGGGTTCTGCTTGGGGTTGG + Intronic
957425061 3:80027078-80027100 TTTGAGGTTGAGATTGGGGAAGG - Intergenic
957714328 3:83905711-83905733 GCTGGACTTAATATTGGGGAGGG - Intergenic
958100072 3:88998249-88998271 CCTGGGGTCCAGATTATGGATGG - Intergenic
959040874 3:101422247-101422269 GATGGGGTTGAGAGTGGGGTGGG - Intronic
960067688 3:113392423-113392445 GGTGGGGTGCAAATTGGGGATGG + Intronic
960149832 3:114238602-114238624 GTTGGAGTTCAGAGTGGGCATGG - Intergenic
961553288 3:127680935-127680957 CCTGGGGTACAGCTTGGGAAGGG + Intergenic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961911160 3:130317952-130317974 TCTGAGGCTCAGAATGGGGATGG - Intergenic
962708172 3:138064539-138064561 CCTGGGGTGAAGGTTGGGGAGGG - Intronic
963801831 3:149683844-149683866 GCTGGGGTGGAGATTATGGATGG + Intronic
963835293 3:150052340-150052362 GAAGTGCTTCAGATTGGGGAGGG + Intergenic
964859848 3:161189511-161189533 GCAGTGTTTCAGAGTGGGGAGGG + Intronic
964977394 3:162637196-162637218 GCTGGAGGTCATCTTGGGGAAGG + Intergenic
966206894 3:177414196-177414218 GGCGGGGGTAAGATTGGGGATGG - Intergenic
966883455 3:184362183-184362205 GCGGGGGTGGAGGTTGGGGAGGG + Intronic
967934029 3:194712183-194712205 ACTGGGGCTCAGATGTGGGAAGG - Intergenic
968232912 3:197014997-197015019 GCTGAGATTCAGAAAGGGGAAGG + Intronic
968482027 4:837522-837544 TCTGGGGTTCAGTGTGGGCAGGG - Intergenic
969142898 4:5095174-5095196 GCTGGGGTTCAGGTTCAGGTGGG + Intronic
969392415 4:6900665-6900687 GCTGGGGTTCAGGGCAGGGAAGG - Intergenic
970657761 4:18250568-18250590 AATGGGATACAGATTGGGGAGGG - Intergenic
971459479 4:26878975-26878997 GTTGGGGGTCAGATTTGGGTGGG + Intronic
973822753 4:54677254-54677276 GGTGGGGATGAGAGTGGGGATGG - Intronic
975331462 4:73119385-73119407 ACTGGATTTCAGATTAGGGATGG - Intronic
976474500 4:85468310-85468332 ACTGGGGCTCAGGCTGGGGAGGG - Intergenic
978079830 4:104578659-104578681 GCTGTGGGTCTGATTGGGCATGG + Intergenic
979999361 4:127470510-127470532 GGTGGGGTTCAGTTTGGGACTGG - Intergenic
981185423 4:141796145-141796167 GCAGGTGTTGATATTGGGGAAGG - Intergenic
981641512 4:146949205-146949227 GGTGGGGTTGGGAGTGGGGATGG - Intergenic
982188994 4:152834531-152834553 GCTGGGTTTCAGATTTGTGTGGG - Intronic
982296061 4:153830752-153830774 GCTGGGTGTCAGAGTGGAGACGG + Intergenic
983492363 4:168402722-168402744 TCTAGGGTCCAGATTAGGGAAGG + Intronic
985231651 4:187824655-187824677 GCTGGGATTCAGATTTCTGAGGG + Intergenic
986205819 5:5623998-5624020 GCTGGGTTTCAGATTTGTGTTGG + Intergenic
986482230 5:8201279-8201301 GCAGGGGGTGGGATTGGGGATGG + Intergenic
986753446 5:10811551-10811573 AATGGGGATCAGAGTGGGGAGGG + Intergenic
986832133 5:11591891-11591913 GCTTGGTAACAGATTGGGGAGGG + Intronic
987327779 5:16828140-16828162 GCTGAGGCTTAGATTGGTGAGGG + Intronic
987393754 5:17401577-17401599 GCAGGGGTGCAGGGTGGGGAGGG - Intergenic
987731214 5:21775081-21775103 GCTGTGATTCACATTGAGGAAGG + Intronic
989100967 5:37822465-37822487 GGTGGGGCTCAGTTTTGGGATGG + Intronic
989113500 5:37929678-37929700 GCTGGGGGTCTGATTCGAGACGG + Intergenic
989240807 5:39201594-39201616 GCTGGGGTTTTGTTGGGGGAAGG - Intronic
992620307 5:78585843-78585865 GTTGGGGTTGGGGTTGGGGATGG + Intronic
996024086 5:118624291-118624313 GTTGGGGTTCGGAATGGGGAGGG + Intergenic
997987142 5:138510974-138510996 CCTGGGGTGGAGATTTGGGAGGG - Intronic
998361233 5:141589651-141589673 GGTGGGGTCGTGATTGGGGAAGG + Intronic
998768979 5:145520434-145520456 GCTGTGGTTCAGCGTGGGAAGGG - Intronic
1000176782 5:158763863-158763885 GCTGAGGCTCAGATAAGGGAAGG - Intronic
1000866365 5:166519402-166519424 GCTGTGGTACAGGTTGGGGAGGG + Intergenic
1001149484 5:169214768-169214790 GATGGGGACCAGGTTGGGGATGG - Intronic
1001544879 5:172564871-172564893 ACTGGGGCTGAGTTTGGGGAAGG + Intergenic
1001754422 5:174157373-174157395 GCTGGGAGCCAGATTGTGGAGGG - Intronic
1002418122 5:179131512-179131534 TGTGGGGCTCAGATTGGGGAAGG + Intronic
1002440980 5:179264341-179264363 GCTGGGGTGAAGTTTGGGCAAGG - Intronic
1002932684 6:1645269-1645291 GCTTGCATTCAGTTTGGGGAAGG - Intronic
1003661397 6:8065329-8065351 TCTGGGGAGCAGATTGGGGCTGG + Intronic
1004260758 6:14105596-14105618 GGCTGGGTTCAGATTGGGGATGG + Intergenic
1004858958 6:19781646-19781668 GCTGGGGTGGGGATTGGGGGTGG - Intergenic
1004910040 6:20274133-20274155 GCTGGGTAACAGATTGGGAAGGG - Intergenic
1007510067 6:42367867-42367889 GATGGAGATCAGATCGGGGATGG - Intronic
1007697400 6:43742622-43742644 GTTGCGGGTGAGATTGGGGATGG - Intergenic
1009411551 6:63370683-63370705 GCAGGGGCACAGATTGGGGCAGG + Intergenic
1010372334 6:75125203-75125225 GCTGGGATTGAGATTGTGTAAGG + Exonic
1010451919 6:76013248-76013270 GGTGGGGTGCAGATTCTGGAGGG - Intronic
1014631462 6:123795379-123795401 GCTGGAGTTCTCACTGGGGAAGG - Intergenic
1015712678 6:136159381-136159403 GCTGGGGTTCAGATTGGGGATGG - Intronic
1017168953 6:151437798-151437820 GCTGTGGAACAGATTGAGGAAGG - Intronic
1017180183 6:151544785-151544807 GCTGTGGTTGAGTTTGGGGGTGG + Intronic
1018563965 6:165132033-165132055 AGTGGGATTCAGATTGGTGAGGG + Intergenic
1019348593 7:542717-542739 GCAGGGGGTCTGCTTGGGGACGG - Intergenic
1019517965 7:1447951-1447973 GCTGGGGCTCTGAGTGGGGAGGG - Intronic
1019778070 7:2924191-2924213 GCCGGGGTTGAGGGTGGGGATGG - Intronic
1019948886 7:4354768-4354790 GCTGTGGTTCAGACTAGAGATGG + Intergenic
1021030158 7:15723175-15723197 GCTGGATTTCAGGTTGGAGATGG - Intergenic
1021800935 7:24305657-24305679 GCTGGGGAGAAGATTGAGGAAGG + Intergenic
1022074710 7:26956017-26956039 TTTGGGGTTCATAATGGGGAGGG - Intronic
1022090097 7:27102315-27102337 GCCGGGGTTCAGGCTGGGAATGG + Exonic
1023050731 7:36248798-36248820 GCTGGTGAGCAGATTGGGGGTGG + Intronic
1023266523 7:38411714-38411736 ACTGGGCTTCATATTGGGGTGGG + Intronic
1024734905 7:52294868-52294890 GCTGGGCTTCTGAGTGGGGTGGG + Intergenic
1024970176 7:55061956-55061978 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1026949349 7:74337229-74337251 GCTGGGCTGCAGCTTGGGGAGGG + Intronic
1027861870 7:83594352-83594374 GCAGGTGATCAGATTAGGGATGG + Intronic
1030139458 7:106290207-106290229 ACTGGGGTCTGGATTGGGGAGGG + Intergenic
1030691384 7:112538326-112538348 GTTGGGGTAAAGTTTGGGGAGGG + Intergenic
1032581202 7:133105151-133105173 GCTGGGGATCAGGCTGGGGCGGG - Intergenic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033768750 7:144524417-144524439 GATGGAATTCAGACTGGGGATGG - Intronic
1035415025 7:158675945-158675967 GCAGGTGTTCAGATTAGGCATGG + Intronic
1037260410 8:17001704-17001726 GCTGGGGCGCAGATGGGGGTGGG + Intronic
1037787884 8:21913120-21913142 GCTGGTGTTCAGCTTGGGCTGGG - Intronic
1038002807 8:23405037-23405059 GCTGGAGGTGAGATTTGGGAGGG - Intronic
1038049122 8:23792546-23792568 GCTGGGTTTAAGATGGAGGAAGG - Intergenic
1038248411 8:25880963-25880985 GATGGGGTGAAGGTTGGGGAGGG - Intronic
1039443707 8:37613466-37613488 GGTGGATTTCAGAGTGGGGAGGG + Intergenic
1039504785 8:38044030-38044052 GCTGGAGTTCAGATTGTCCAGGG + Intronic
1039640127 8:39210280-39210302 GCATTGCTTCAGATTGGGGACGG + Intronic
1041927304 8:63250145-63250167 GTTGGGGTTCAGTGTGGGCAGGG - Intergenic
1043626135 8:82260866-82260888 GCTGGGGTTCACATTTGGGCAGG + Intergenic
1046761400 8:118025123-118025145 ACTGGGGGTCAGAGTGGGAAGGG + Intronic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1049307116 8:141909999-141910021 GGTGGGGTTCAGGGTGGGCAGGG + Intergenic
1049557746 8:143291467-143291489 GCTGGGGTGTCGATTCGGGAGGG + Exonic
1049575060 8:143386082-143386104 GCTGGGAGTGAGGTTGGGGATGG + Intergenic
1049974344 9:847157-847179 GCTGGGGTTCACATGGAGGCTGG + Intronic
1050482046 9:6097483-6097505 TCTGAGGCTCAGAATGGGGAAGG - Intergenic
1050991327 9:12156356-12156378 AATGGGGTGCAGATTGGGGGTGG - Intergenic
1052040778 9:23736466-23736488 GCAGGGGGTGAGAGTGGGGAGGG + Intronic
1053294840 9:36905396-36905418 ACTGAGGTTCAGAGAGGGGAAGG + Intronic
1053792850 9:41699190-41699212 GCTGAGGTCCAGTTTGGGGCGGG + Intergenic
1054152324 9:61615635-61615657 GCTGAGGTCCAGTTTGGGGCGGG - Intergenic
1054181263 9:61911211-61911233 GCTGAGGTCCAGTTTGGGGCGGG + Intergenic
1054472099 9:65546778-65546800 GCTGAGGTCCAGTTTGGGGCGGG - Intergenic
1054656330 9:67669931-67669953 GCTGAGGTCCAGTTTGGGGCGGG - Intergenic
1056038074 9:82630398-82630420 GCTGGGGCACAGAGTGGGTAGGG + Intergenic
1056884255 9:90425270-90425292 GCTGGGGCCCAGATTGGTTAAGG - Intergenic
1056989204 9:91394135-91394157 TGGGGGGATCAGATTGGGGAAGG + Intergenic
1058465394 9:105221946-105221968 GCTGGGGTTCAGAGAAAGGAGGG + Intergenic
1059311780 9:113393386-113393408 GTTGGGGTTGGGGTTGGGGAGGG - Intronic
1059753338 9:117269639-117269661 GCTGAGGTTCAGCGTGGGCAAGG + Intronic
1059758028 9:117311974-117311996 GCTGGGGTTCACATTGGTGGTGG - Intronic
1060242765 9:121918530-121918552 CAAGGAGTTCAGATTGGGGAGGG + Intronic
1060798842 9:126531182-126531204 ACTGGGGTTCAGAGAGGAGATGG - Intergenic
1060812803 9:126619428-126619450 GTTGGGGTACACACTGGGGAAGG - Intronic
1060979242 9:127783240-127783262 GCTGGGGTTCAGACGAGGGATGG + Intergenic
1061055101 9:128218356-128218378 GCTGGCCCTCAGCTTGGGGACGG - Intronic
1061871731 9:133524518-133524540 ACTGAGGTCCAGATAGGGGAAGG + Intronic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062237978 9:135521766-135521788 GCAGGGGTGCAGAGTGGGCAGGG + Intronic
1185641773 X:1592428-1592450 GCTGGAGGCCAGAGTGGGGAGGG + Intronic
1188050251 X:25475856-25475878 GCTGGAGAACAGAATGGGGAAGG - Intergenic
1189001303 X:36950020-36950042 CCAGGGGTTGGGATTGGGGAGGG - Intergenic
1189278218 X:39802806-39802828 GCTGGCCTTCACATTCGGGAAGG - Intergenic
1189902015 X:45716314-45716336 GCTGGGGCACAGATTAAGGAAGG - Intergenic
1191755524 X:64588363-64588385 TCTGGGGTTGAGGTAGGGGAGGG + Intergenic
1193770323 X:85580499-85580521 GCTGGGGTTCAGACTTGTGTGGG - Intergenic
1195094615 X:101492166-101492188 GCTGGGGGTCAGACTAGTGAGGG + Exonic
1195111771 X:101657254-101657276 GCTGAGGCTCAGAGTGGGGCAGG - Exonic
1196212525 X:113011469-113011491 GCTGGGGTTAGGATTGGGGCTGG - Intergenic
1198473064 X:136967335-136967357 CCAGGGTTTCAGGTTGGGGAAGG - Intergenic
1198716514 X:139563566-139563588 GCTGGGGGTGAGGTTGGGGCAGG - Intergenic
1199307166 X:146279968-146279990 GCTGGAGATCAGAGTTGGGATGG + Intergenic
1199383323 X:147194856-147194878 GCTGGGTTTCAGATTTGCGCAGG + Intergenic
1200749350 Y:6930531-6930553 GCTGGGCTTCTGAGTGGGGTGGG + Intronic
1202377938 Y:24255339-24255361 GCTGGGGCTCAGGGTGGGGTGGG - Intergenic
1202492844 Y:25414782-25414804 GCTGGGGCTCAGGGTGGGGTGGG + Intergenic