ID: 1015724815

View in Genome Browser
Species Human (GRCh38)
Location 6:136289420-136289442
Sequence GAAGATATGCGCACGCGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 21}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015724815 Original CRISPR GAAGATATGCGCACGCGCAC GGG Intronic