ID: 1015729637

View in Genome Browser
Species Human (GRCh38)
Location 6:136334877-136334899
Sequence CTCTGTCCTTGCCATAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015729633_1015729637 -6 Left 1015729633 6:136334860-136334882 CCAGGATACAGAAAGCCCTCTGT 0: 158
1: 206
2: 114
3: 62
4: 202
Right 1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG No data
1015729627_1015729637 24 Left 1015729627 6:136334830-136334852 CCGATTCCTCTGGTACACCAAGG No data
Right 1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG No data
1015729631_1015729637 7 Left 1015729631 6:136334847-136334869 CCAAGGCAAGAACCCAGGATACA 0: 45
1: 77
2: 72
3: 65
4: 200
Right 1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG No data
1015729632_1015729637 -5 Left 1015729632 6:136334859-136334881 CCCAGGATACAGAAAGCCCTCTG 0: 99
1: 258
2: 242
3: 135
4: 323
Right 1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG No data
1015729629_1015729637 18 Left 1015729629 6:136334836-136334858 CCTCTGGTACACCAAGGCAAGAA No data
Right 1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015729637 Original CRISPR CTCTGTCCTTGCCATAAGGC AGG Intergenic
No off target data available for this crispr