ID: 1015731876

View in Genome Browser
Species Human (GRCh38)
Location 6:136357365-136357387
Sequence AACCCTGTCCTGTATTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015731876_1015731880 22 Left 1015731876 6:136357365-136357387 CCTCTAAAATACAGGACAGGGTT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1015731880 6:136357410-136357432 CAGAGTTTCAGATATATCTGTGG No data
1015731876_1015731877 -2 Left 1015731876 6:136357365-136357387 CCTCTAAAATACAGGACAGGGTT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1015731877 6:136357386-136357408 TTACTTATAAACCTTTATATAGG 0: 1
1: 0
2: 1
3: 23
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015731876 Original CRISPR AACCCTGTCCTGTATTTTAG AGG (reversed) Intronic
900925329 1:5702485-5702507 AATCATGTTCTGTATTTTTGGGG + Intergenic
901873506 1:12152516-12152538 AACCCTCTCCTGTACCCTAGGGG + Intergenic
906993416 1:50763505-50763527 CACTCTCTCCTCTATTTTAGGGG + Intronic
911170522 1:94766679-94766701 AACCCATTCCTGTGTTTGAGTGG - Intergenic
911579357 1:99617432-99617454 ACACCTTTCCTGTAATTTAGGGG + Intergenic
912924093 1:113897941-113897963 TACCCTGGCCTGTATTGTAGTGG - Exonic
914372140 1:147035780-147035802 AACTCTTTCCAGAATTTTAGTGG - Intergenic
915903899 1:159864329-159864351 AAGCCTGCACTGTAGTTTAGTGG - Intronic
917316816 1:173734425-173734447 AAACCTGGCTTTTATTTTAGAGG + Intronic
917917016 1:179712215-179712237 AAACCTGTGCTGGATTTTAAAGG + Intergenic
919261220 1:195196656-195196678 AACCCTGTTTTGAATTTTTGAGG + Intergenic
923002044 1:230014706-230014728 AACCCTGCACTGAATTTTTGTGG - Intergenic
1064440500 10:15349201-15349223 AGCCCTGTTCTGTATTTTCTAGG - Intronic
1068881529 10:62054495-62054517 AACTCTGTCCTGAATCTCAGTGG - Intronic
1071440592 10:85688939-85688961 TCCCCTGTCCTGTACTTAAGTGG + Intronic
1072559832 10:96561682-96561704 AACCCAGTCATGTATTTTTATGG - Intronic
1074335733 10:112572883-112572905 AACCATGAACTGTATTTTAATGG + Intronic
1074485624 10:113875332-113875354 TTCCCTGTACTGTAGTTTAGGGG + Intronic
1076057310 10:127386297-127386319 CACCCAGTCCTGTAGTTTAGGGG + Intronic
1076976785 11:178432-178454 AACCCTGTCCTTTATTACACAGG + Intronic
1079535873 11:21514834-21514856 AGTCCTGTCCTGTATTATTGAGG + Intronic
1085688331 11:78645903-78645925 CACCCTGTCCTGGAATTTACTGG - Intergenic
1088236405 11:107728813-107728835 AACCATGTCCTGTGTTTAAAAGG - Intergenic
1088613495 11:111601742-111601764 AAAACTGGCCTGTGTTTTAGGGG + Intergenic
1088711734 11:112514443-112514465 AACCCTGCCCTGTACTTAAAAGG + Intergenic
1090343417 11:126046291-126046313 AAACTTATCCTCTATTTTAGGGG + Intronic
1093505948 12:19865874-19865896 AACACTGTCCTGAATTTGATTGG + Intergenic
1094362671 12:29646987-29647009 GAAGCTGTTCTGTATTTTAGAGG - Intronic
1095604399 12:44049796-44049818 AACCCAGCCCTTTATTTTATGGG - Intronic
1098581162 12:72100816-72100838 AACCCTGTCATATATGTGAGGGG - Intronic
1101953392 12:109193628-109193650 AACCCTGTCTTTTCTTTCAGGGG + Exonic
1105408971 13:20154140-20154162 AACCCTATCTTGGATTTTTGTGG - Intronic
1106673397 13:31931480-31931502 CTCCCTGTCCTGCATTTTCGTGG - Intergenic
1106833673 13:33611785-33611807 ATCAGTGTCCTGCATTTTAGGGG + Intergenic
1109251912 13:60030279-60030301 AATCCTGTGCTATATTTTAGTGG + Intronic
1112056719 13:95695534-95695556 ATGCCTGTTCTGAATTTTAGTGG + Intronic
1112542827 13:100334017-100334039 TATCCTGTCCTGTAGTATAGTGG - Intronic
1113391372 13:109900547-109900569 AATCCTGTCCTGTAGATGAGCGG + Intergenic
1119007368 14:70943967-70943989 AACCCTTGCCTGGATTTCAGAGG + Intronic
1119621388 14:76134463-76134485 AACCCTGACCCGTGTATTAGGGG + Intergenic
1119923723 14:78471844-78471866 AATCCTGTTCAGTATTTGAGGGG - Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1133612314 16:7444846-7444868 AATCCTGGCCTGTATTTAAAGGG + Intronic
1137523212 16:49211265-49211287 AGCCCAGTCCTCTATTTCAGTGG + Intergenic
1137954620 16:52816194-52816216 AAACTTGTCCAGTGTTTTAGTGG - Intergenic
1138727792 16:59159712-59159734 AACCCTGACCTTTATTTTTCTGG - Intergenic
1140753010 16:78043229-78043251 AACCCTGTGCTAGATTTTGGAGG + Intronic
1142443632 16:90119742-90119764 AACCCTGTCCTTTATTACACAGG - Intergenic
1142463798 17:115473-115495 AACCCTGTCCTTTATTACACAGG + Intergenic
1143979210 17:10853723-10853745 AACCATGCACTGAATTTTAGTGG - Intergenic
1146066294 17:29638310-29638332 AAACCTGTCAGGTATTTTAGTGG + Intronic
1146182558 17:30707448-30707470 AACCCTGATCTGAGTTTTAGAGG - Intergenic
1146727467 17:35168041-35168063 ACCCTTGTCCTTTGTTTTAGGGG + Exonic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1148958582 17:51374196-51374218 ACCTTTGTCCTGTATTTTACTGG - Intergenic
1150969986 17:70016624-70016646 AACCCAGTCCACCATTTTAGAGG - Intergenic
1153295891 18:3546129-3546151 AAGCCTGGCCTGTTTTTCAGTGG - Intronic
1153906805 18:9669044-9669066 AGACCTGTGCTGTATTTCAGGGG + Intergenic
1157168573 18:45381468-45381490 AACCCAGTCCTGTGTCTTTGTGG - Intronic
1160062545 18:75546176-75546198 ATCCCTGTCCTCCATTTTTGTGG + Intergenic
1162976264 19:14208357-14208379 AACCCTGATCTGAGTTTTAGAGG + Intergenic
1166218076 19:41349369-41349391 AACCCATTCCAGTATTATAGTGG + Intronic
929134734 2:38612917-38612939 AACTCTGTCCAGTCTTGTAGTGG + Intergenic
929393050 2:41494054-41494076 AACCCTTTCCTGTCATTTTGAGG + Intergenic
934731632 2:96662111-96662133 AACCCTCCCCTATAATTTAGAGG - Intergenic
940677470 2:156742595-156742617 AGCCCTAACCTGTATTTTATTGG - Intergenic
940915471 2:159250489-159250511 AACACTGTGCTGCATTTTAGAGG - Intronic
942123114 2:172798145-172798167 AAGCCAGTGCTGTACTTTAGAGG - Intronic
942444235 2:176067608-176067630 AACCCTGTCCTGGGCGTTAGTGG - Intergenic
943291958 2:186084790-186084812 AACTCTGCCCTTTCTTTTAGAGG + Intergenic
946882560 2:224191200-224191222 CACCTTGGCCTTTATTTTAGAGG - Intergenic
948073221 2:235144321-235144343 AAACCTTTGCTGTATTTTAGTGG + Intergenic
948659011 2:239495329-239495351 AGCCCAGCCCTGGATTTTAGTGG - Intergenic
1169856401 20:10108340-10108362 AAACCAGTCCTGTATTTGAATGG + Intergenic
1177120289 21:17129484-17129506 AACCATGTGTTATATTTTAGAGG - Intergenic
1178012133 21:28300889-28300911 TCCCATGTCCTGTATTTTAGTGG - Intergenic
1179079681 21:38159254-38159276 AACCCTGTCATGGATTTTGAAGG + Intronic
1182136891 22:27913850-27913872 AAGCCTGTTCTGTCTTGTAGTGG - Intronic
1182171993 22:28240235-28240257 AACCATATTCTGTATATTAGAGG + Intronic
1183032021 22:35113609-35113631 ATCCCAGTTGTGTATTTTAGAGG + Intergenic
1183032221 22:35114830-35114852 ATCCCAGTTGTGTATTTTAGAGG - Intergenic
1184118995 22:42438314-42438336 AAACCTGTCCCATATTTGAGAGG - Intergenic
1184793643 22:46718106-46718128 AACCCTGTTATCTGTTTTAGTGG - Intronic
953216282 3:40921979-40922001 AACCCTGTAATATATTTTAGAGG - Intergenic
953216297 3:40922124-40922146 AACCCTGTAATATACTTTAGAGG - Intergenic
953456543 3:43046951-43046973 AACCTTCACCTGTATTTCAGAGG + Intronic
953730173 3:45440640-45440662 AAAGCTGTCATGTATTTTGGTGG - Intronic
953794650 3:45975220-45975242 AGCCCTGTCCTGTATTTACCTGG + Exonic
955102283 3:55861913-55861935 AGCCCTGTACTGTGTTTTATAGG + Intronic
956624969 3:71258149-71258171 AAGTCTGCTCTGTATTTTAGTGG - Intronic
957309727 3:78504534-78504556 CACACTGTCCTCTCTTTTAGTGG - Intergenic
963583557 3:147156074-147156096 AATACAGTACTGTATTTTAGAGG + Intergenic
964111983 3:153097207-153097229 AACCCAGTCCTGAATTTTCAGGG + Intergenic
965750701 3:171971969-171971991 AACCCAGTCCAGTATTGTTGGGG - Intergenic
967650042 3:191974459-191974481 AACTTTCTCCTGTACTTTAGGGG - Intergenic
968363923 3:198170791-198170813 AACCCTGTCCTTTATTACACAGG - Intergenic
974843396 4:67323418-67323440 AACCTTCACCTATATTTTAGAGG + Intergenic
976658736 4:87517017-87517039 CACCCTGTCCTGTGTTATAGTGG + Intronic
979462837 4:121002993-121003015 AACTCTGGCCTATATTTTATTGG - Intergenic
985813599 5:2110347-2110369 AAGCCTTTCCTGTATTACAGTGG - Intergenic
988661016 5:33268591-33268613 AAGCCTGTCCTGTGTTGGAGTGG - Intergenic
988738393 5:34045262-34045284 AATCCTGTCATCTATTCTAGTGG + Intronic
992678208 5:79126925-79126947 CACCCTATCCTATATTTTATAGG + Intronic
993871359 5:93258024-93258046 AAACCTCTCCTGTATCTCAGTGG - Intergenic
998804236 5:145903106-145903128 TACCCTGTACTGTCTTTTAGGGG - Intergenic
999670651 5:153956556-153956578 AACACTGTCCTTTATTCTAAAGG - Intergenic
1004926729 6:20423290-20423312 AAACCTGTACTGTATGTTACTGG + Intronic
1006712971 6:36091619-36091641 AAGACTGGCCTGTATTTCAGTGG + Intronic
1007934913 6:45724415-45724437 AACACTTTCCTGAATTTTATGGG - Intergenic
1009525004 6:64732680-64732702 GAGCCTGTCCTGTTATTTAGAGG - Intronic
1010690856 6:78909950-78909972 ACCCTTTTCCTGTATTTTTGTGG - Intronic
1012488600 6:99751644-99751666 AACTCTGTGGTGTATTTGAGAGG - Intergenic
1012614931 6:101265490-101265512 AATCTTGTCATGTATTTTACAGG - Intergenic
1013247125 6:108297484-108297506 ATCCCTTTCCTGTTTTTTTGGGG + Intronic
1015373143 6:132479065-132479087 AACACTGCCCTGTATTTTCATGG - Intronic
1015731876 6:136357365-136357387 AACCCTGTCCTGTATTTTAGAGG - Intronic
1018987773 6:168650605-168650627 AACATTTCCCTGTATTTTAGAGG + Intronic
1019251890 7:18873-18895 AACCCTGTCCTTTATTACACAGG + Intergenic
1020376885 7:7497480-7497502 AACCCAGTCCTATATTTTATTGG - Intronic
1021878626 7:25071969-25071991 AATTCTGTCCTGTATAGTAGAGG + Intergenic
1024740468 7:52348535-52348557 ACTCCTGTTCTTTATTTTAGGGG - Intergenic
1024929498 7:54655255-54655277 AAACTTGTCAGGTATTTTAGTGG + Intergenic
1025639278 7:63352080-63352102 ACCCATGACTTGTATTTTAGGGG + Intergenic
1025643421 7:63396012-63396034 ACCCATGACTTGTATTTTAGGGG - Intergenic
1027634495 7:80654001-80654023 AACCCCGTCCATTTTTTTAGAGG - Intronic
1027774709 7:82449450-82449472 ATCCCTGTCCTTAATTTTAAAGG - Intergenic
1027879560 7:83817136-83817158 GACCCTCTCCTGTATGGTAGAGG + Intergenic
1031388150 7:121178431-121178453 AACTCTGTGCTGTAATGTAGAGG + Intronic
1039915670 8:41858677-41858699 AAACTTGTCCTGGATTTTACAGG - Intronic
1041219366 8:55633622-55633644 AACCATGTCCTTTATTTTCTGGG + Intergenic
1042418246 8:68552638-68552660 ATCCTTGTACTGTAATTTAGGGG + Intronic
1043023761 8:75040817-75040839 AACTCTTTCCTGTATTTTTCTGG + Intergenic
1046514545 8:115241436-115241458 AAACCAGTCCTGTAGTTTAGAGG - Intergenic
1047514358 8:125540890-125540912 AAGCCTATTCTGTATTCTAGGGG + Intergenic
1048303491 8:133267690-133267712 TGCCCTGGCCTGTCTTTTAGAGG - Intronic
1052181044 9:25528443-25528465 AAACCTGTTTTGTATTTTAAAGG + Intergenic
1052864964 9:33459270-33459292 AACTCTGCCCTGTTTTTTAGAGG - Intergenic
1055869742 9:80860884-80860906 AACCATGTGCTGTCTGTTAGAGG - Intergenic
1062748622 9:138234736-138234758 AACCCTGTCCTTTATTACACAGG - Intergenic
1188020522 X:25151903-25151925 AACCCAGGCCTGGATTTGAGTGG + Intergenic
1189715622 X:43862270-43862292 TACCCTGTATTGTATTTTTGTGG + Intronic
1191755285 X:64586131-64586153 AACCCAGCCCTGGATCTTAGAGG + Intergenic
1192080131 X:68039816-68039838 AAGCCTATCCTGTATTATTGGGG + Intergenic
1193213671 X:78837843-78837865 AACTCTGTTCTGAATTTTACAGG - Intergenic
1194368972 X:93047209-93047231 AACCTTGACCTAGATTTTAGGGG + Intergenic
1195465097 X:105171539-105171561 CCCCCTGCCCTGTATTTTGGAGG + Intronic
1195594143 X:106668688-106668710 AACCTTGTCTTGTATATTTGAGG + Intronic
1197378105 X:125707105-125707127 CACCCTGTCATGCATTTAAGTGG + Intergenic
1200677177 Y:6163542-6163564 AACCTTGACCTAGATTTTAGGGG + Intergenic
1201947861 Y:19531292-19531314 AGCCCCCACCTGTATTTTAGAGG + Intergenic