ID: 1015735922

View in Genome Browser
Species Human (GRCh38)
Location 6:136400080-136400102
Sequence ACTTTTTTGTAGGAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 360}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015735922_1015735935 24 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735935 6:136400127-136400149 GGAAAATAGGCTGGGTGTGGTGG No data
1015735922_1015735930 3 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735930 6:136400106-136400128 TTTTTCTTTTTTAAAAAAAGGGG No data
1015735922_1015735932 15 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735932 6:136400118-136400140 AAAAAAAGGGGAAAATAGGCTGG 0: 1
1: 1
2: 16
3: 248
4: 2140
1015735922_1015735929 2 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735929 6:136400105-136400127 TTTTTTCTTTTTTAAAAAAAGGG No data
1015735922_1015735931 11 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735931 6:136400114-136400136 TTTTAAAAAAAGGGGAAAATAGG 0: 1
1: 1
2: 15
3: 269
4: 1952
1015735922_1015735928 1 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735928 6:136400104-136400126 TTTTTTTCTTTTTTAAAAAAAGG 0: 3
1: 92
2: 919
3: 8106
4: 49114
1015735922_1015735934 21 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735934 6:136400124-136400146 AGGGGAAAATAGGCTGGGTGTGG No data
1015735922_1015735933 16 Left 1015735922 6:136400080-136400102 CCCTGCCCCTCCTACAAAAAAGT 0: 1
1: 0
2: 2
3: 37
4: 360
Right 1015735933 6:136400119-136400141 AAAAAAGGGGAAAATAGGCTGGG 0: 1
1: 0
2: 24
3: 269
4: 1981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015735922 Original CRISPR ACTTTTTTGTAGGAGGGGCA GGG (reversed) Intronic
900529923 1:3148137-3148159 ACGGTTTTGTGGGAGGGGCTGGG + Intronic
900635140 1:3659850-3659872 ACTTTTTTTTAGTAGAGACAGGG + Intronic
901674642 1:10875778-10875800 AATTTTTTGCAGGCTGGGCACGG + Intergenic
902519758 1:17009564-17009586 ATTTTTTTTTAGTAGGGACAGGG + Intronic
903764525 1:25725619-25725641 ACTTTATTCTAGGAGGAGCTAGG - Intronic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
905719489 1:40185061-40185083 ACTTTTTTTTTGTAGGGACAGGG - Intronic
908695067 1:66830602-66830624 AATTTTTTTTAGTAGGGACAGGG - Intronic
909161920 1:72162277-72162299 ATTTTTTTTTAGTAGAGGCAGGG - Intronic
909450266 1:75790634-75790656 ACTTTTTTGTGGCAGGGTCTTGG + Intronic
910566724 1:88651978-88652000 TATTTTTTGTATGAGGGGTACGG - Intergenic
910780647 1:90928493-90928515 ATTTTTTTTTAGTAGAGGCAGGG + Intronic
910800541 1:91141032-91141054 TATTTTTTGTAGGCCGGGCACGG - Intergenic
912565797 1:110586355-110586377 ACTTTTATGCAGGGTGGGCAGGG - Intergenic
913282017 1:117194973-117194995 ATTGTTTTGTAGGCCGGGCACGG + Intronic
914023041 1:143885994-143886016 ACATTTTCCTAGGAGGGCCAAGG + Intergenic
916785633 1:168085216-168085238 GCTTTTTGGGAGGTGGGGCATGG - Exonic
917103990 1:171473915-171473937 ACTTTATTGGAGGAGGGCCATGG + Intergenic
917321433 1:173786520-173786542 ACATTTTTGTAGTTGGGGAAAGG - Exonic
918096291 1:181337331-181337353 ATTTTTTTTTAGTAGAGGCAGGG + Intergenic
918905470 1:190486933-190486955 ACTTTTTTCTAGGAAGTGCTTGG - Intergenic
918975707 1:191483270-191483292 TTTTTTTTGTAGGGGGGACAAGG + Intergenic
919352594 1:196477584-196477606 ACTTTTTTTTTGGAGGGGGAGGG - Intronic
919404333 1:197158980-197159002 ACTTGTTTGTAAGAAGGGCTAGG + Exonic
919524791 1:198633985-198634007 TCTTTTATGTAGGATGGTCAGGG + Intergenic
920115940 1:203621770-203621792 ACTCATTTGTAGGAAAGGCAGGG + Intergenic
920160153 1:203991329-203991351 AATTTTTTGTAAGCCGGGCACGG + Intergenic
921727175 1:218536174-218536196 ACTTTTTTTTGGGAGGGGGCGGG - Intergenic
921823811 1:219648625-219648647 ACTTTTTTGGAGGAGGAGAAGGG + Intergenic
921990109 1:221356671-221356693 ACCTTTTTGTAGGCCGGGCATGG - Intergenic
923722230 1:236476813-236476835 AACTTTTTGTAGGCTGGGCAAGG - Intronic
1062837413 10:644779-644801 ACTTTTGAGAAGTAGGGGCAGGG - Intronic
1063585251 10:7346677-7346699 AATTTTTTGTAGGCTGGGCAAGG + Intronic
1063725989 10:8638184-8638206 ACTTGTCTTTGGGAGGGGCAGGG - Intergenic
1064383105 10:14863928-14863950 ACATTTTGGTGGGAGGGGGAGGG - Intronic
1066517714 10:36182446-36182468 ACTATTTTGTCAGAGGGTCAAGG - Intergenic
1067772961 10:49140351-49140373 ACTTTATTCCAGGAGGGCCAGGG - Intergenic
1069732775 10:70629855-70629877 ACTTTTTTTTGGGGGGGGGAGGG + Intergenic
1070712220 10:78691080-78691102 TCTTTTTTGTATGAGAGGAAGGG + Intergenic
1070773235 10:79094940-79094962 TTTTTTTTCCAGGAGGGGCAGGG - Intronic
1071745974 10:88419830-88419852 ACTTTTTTTTAGTAGAGACAGGG - Intronic
1072139853 10:92579853-92579875 ACTTTTTATTGGGAGGGGCACGG + Intergenic
1073391816 10:103184234-103184256 ACTTGTTTATAGGCTGGGCACGG - Intronic
1074066425 10:110018770-110018792 ACTTATTTGTAGCAGTGCCAAGG + Intronic
1075208004 10:120463314-120463336 ACTTGTTTCTAGGCCGGGCACGG - Intronic
1075596682 10:123736061-123736083 ACTTTATTGTTGGCCGGGCATGG - Intronic
1076231327 10:128822236-128822258 CTCTTTTTGTAGGAGGAGCAGGG - Intergenic
1078992385 11:16662979-16663001 ACTTTTTTTTAGGATGGGTATGG - Intronic
1079090180 11:17475390-17475412 AATTTTTTGTAGAAAGGGCGGGG + Intronic
1079248292 11:18769327-18769349 GCTCATTTGTGGGAGGGGCAAGG + Intronic
1080419329 11:32095999-32096021 ACTTTTTTTTAGGTGGGGGAGGG - Intronic
1080484413 11:32690490-32690512 ACGTTGTTGGAGGAGGGGCCTGG + Intronic
1080568626 11:33535663-33535685 TCTTTTTTGGAGGGGGGACAGGG - Intergenic
1081844725 11:46231795-46231817 ATTTTTTTTTGGGAGGGGGATGG - Intergenic
1083765837 11:64841160-64841182 AGTTTATTGTAGGCTGGGCACGG + Intronic
1084034955 11:66504020-66504042 CCTTATTTGTAGGAGAGGAATGG + Intronic
1084958000 11:72701780-72701802 ACCTCTTTGTAGGCGGGGAAAGG + Exonic
1086232450 11:84586856-84586878 ACTTTTTTGGAGGATGGGGATGG - Intronic
1086647468 11:89242382-89242404 ATTTTTTTTTAGTAGAGGCAGGG + Intronic
1087529295 11:99358391-99358413 AATTTTTTGTAGTAGAGACAGGG - Intronic
1087853996 11:103068923-103068945 ACTGTTTTGAAGGAGTGACAGGG + Intronic
1088752705 11:112858247-112858269 AGCTTTTTGGTGGAGGGGCAGGG - Intergenic
1090232966 11:125122882-125122904 AGTTTTTTTTAGGCCGGGCATGG + Intergenic
1090338629 11:125994698-125994720 ACATATTTTGAGGAGGGGCAGGG - Intronic
1091504900 12:1057563-1057585 ACTGTTTTGAAGGATGCGCATGG + Intronic
1091636057 12:2197662-2197684 ATGTTTTTGGAGGAGGGGAAAGG - Intronic
1091916845 12:4275875-4275897 TTTTTTTTGTGGGAGGGGGAGGG - Intronic
1092133239 12:6127113-6127135 ACTTTTTTCAAGGCAGGGCACGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092649944 12:10623898-10623920 GTTTTTTTCAAGGAGGGGCAAGG - Intronic
1094599719 12:31898057-31898079 TCTTCTTTGTAGTAGGGGCAGGG - Intergenic
1094626476 12:32129232-32129254 AATTTTTTGTAGGCCGGGCATGG + Intronic
1095552617 12:43460822-43460844 TCTTTTTTGAAGGAGTGGAATGG - Intronic
1096150694 12:49309905-49309927 ATTTTTCTTTTGGAGGGGCAGGG - Intergenic
1096293647 12:50364378-50364400 ATTTTTTTTTAGGAGAGACAGGG - Intronic
1097533381 12:60834812-60834834 GGTTTTTTGTAGGAAAGGCAAGG + Intergenic
1097557930 12:61163597-61163619 TGTTTTTTGTGGGAGGTGCATGG - Intergenic
1097753290 12:63381652-63381674 ACTTTTTTGTATAAGGTGTAAGG - Intergenic
1098470804 12:70841185-70841207 ATTTTTTTGTTGGGGGGGTAAGG - Intronic
1099110789 12:78558123-78558145 ACATTTTTTAAGGAGGGGCAAGG - Intergenic
1100595865 12:96071578-96071600 ACTTTTTTTTAGGCCAGGCACGG + Intergenic
1100936659 12:99677421-99677443 ACTTTTTTGGAGGAGAGGAAAGG + Intronic
1101373833 12:104153852-104153874 ACTATTAGGTAGGTGGGGCATGG + Intergenic
1101553204 12:105782772-105782794 TATTTTTTTTGGGAGGGGCAGGG + Intergenic
1101956999 12:109220843-109220865 ACATTTTTCTAGGCAGGGCATGG - Intronic
1102375045 12:112415420-112415442 ACTTTTTTTTGGGCCGGGCATGG + Intronic
1102536883 12:113588353-113588375 ACCTTTCTGCAGGCGGGGCATGG + Intergenic
1103272128 12:119682030-119682052 ACCTTTTTGGAGGAGGGACACGG - Intergenic
1103517649 12:121517894-121517916 ACTTTTTTTGAGGGGGGGGATGG + Intronic
1103517692 12:121518181-121518203 ACTGTTTTATAGGCTGGGCATGG - Intronic
1103695685 12:122813653-122813675 ACTTTTTTCTTGGAGGGGGCGGG + Intronic
1103787600 12:123445048-123445070 AATTTTTTGTAGGCCGGGCACGG + Intergenic
1104021026 12:124992486-124992508 ACTTTTTTGTAGGTCGGGTGCGG - Intergenic
1104127040 12:125857764-125857786 CCTGTTTTGAAGGTGGGGCACGG + Intergenic
1106251466 13:27985165-27985187 ACTCTCTTGAAGGTGGGGCAAGG + Intronic
1106448607 13:29859529-29859551 ATTTTTTTGTTGGCTGGGCATGG - Intergenic
1106872205 13:34033898-34033920 ACTTTTTTCTTGGCTGGGCACGG - Intergenic
1108615305 13:52127055-52127077 ATTTTTTTTTAGCAGGGACAGGG + Intronic
1108679204 13:52764925-52764947 TTTTTTTTGTAGGCCGGGCATGG + Intergenic
1110044201 13:70808868-70808890 ACATTTTTGTGGGAGGGACCTGG + Intergenic
1110828772 13:80005699-80005721 ACTTTTTTGAAGGATTGCCATGG + Intergenic
1111432292 13:88160016-88160038 TCTTGGTTGTAGGAGGGGCCAGG + Intergenic
1113366307 13:109679991-109680013 ACTTTATTGTAGGGATGGCAAGG - Intergenic
1114992427 14:28302864-28302886 ACTTTTTTGTATGTGGTGAAAGG - Intergenic
1115660057 14:35485230-35485252 ACTTTGTAGTAGGCAGGGCATGG - Intergenic
1115966174 14:38890946-38890968 AATTTTTTTTAGGCCGGGCATGG + Intergenic
1116327738 14:43553425-43553447 ATTTTTTTTTGGGAGGGGAAAGG - Intergenic
1116466261 14:45236153-45236175 AATATTTTGTAGGAGGGACATGG - Intronic
1118455705 14:65944223-65944245 ACTATTATGTAGCAGGGGCGTGG + Intergenic
1118948147 14:70408109-70408131 TTTTTTTTGGAGGAGGGGGAAGG + Intronic
1119523838 14:75306658-75306680 ACTTTTTTTCAGGCTGGGCATGG + Intergenic
1119747507 14:77054658-77054680 ACATTTGTGTGGGGGGGGCAGGG + Intergenic
1122580154 14:102766567-102766589 TCTTTTTTGGGGTAGGGGCAGGG + Intergenic
1202839515 14_GL000009v2_random:108635-108657 AATTTTTTATAGGCTGGGCATGG - Intergenic
1202908887 14_GL000194v1_random:98790-98812 AATTTTTTATAGGCTGGGCATGG - Intergenic
1124397091 15:29311683-29311705 ACTTTTTTTTGGGGGGGGGATGG - Intronic
1125597172 15:40894511-40894533 ATTTTTTTGTAGCGGGGGCGGGG + Exonic
1125695699 15:41635516-41635538 AATTTTTTATAGGAGGGGGGGGG - Intronic
1125704624 15:41722517-41722539 CCTTTTTTATAGGAAGGGGAGGG + Intronic
1126138062 15:45411605-45411627 AATTTTTTGTAGGCCAGGCATGG - Intronic
1126597469 15:50396770-50396792 TATTTTTTGTAGGCGGGGCGCGG + Intergenic
1126789769 15:52210384-52210406 ACTTCTCTTTTGGAGGGGCATGG + Intronic
1127947172 15:63766966-63766988 ACTTTAGTGTAGGCTGGGCATGG - Intronic
1128507922 15:68290467-68290489 ACCTTTTTGTCTGAGGTGCAGGG - Exonic
1128963490 15:72033212-72033234 ACTTTTTTGTAGGGGGGCTCTGG - Intronic
1128965471 15:72053107-72053129 ACTTTTTTTTAGGCTGGGCCTGG + Intronic
1130360825 15:83184009-83184031 ATTTTTTGGTGGGAGAGGCAAGG - Intronic
1130827100 15:87560466-87560488 ACTTTTATGTATTAAGGGCACGG + Intergenic
1130986942 15:88850765-88850787 ACTTTTTTTTAGTAGAGACAGGG - Intronic
1131814381 15:96207153-96207175 ACTTTTTTTTAGTAGAGACAGGG - Intergenic
1132780131 16:1619667-1619689 AAATATTTGTAGGAGGGGAAAGG + Intronic
1133443659 16:5841462-5841484 AATTTTTTGTGGGAGGGACAAGG - Intergenic
1135657906 16:24267576-24267598 ATTTTTTTCTAGGTGGGGCACGG - Intronic
1137749626 16:50849972-50849994 AATTTTTTTTGGGAGGGGGACGG + Intergenic
1139236709 16:65347213-65347235 ACTATTTTGTGGGAGTGGAATGG + Intergenic
1139276878 16:65736005-65736027 ACTGTCTCCTAGGAGGGGCATGG - Intergenic
1139833825 16:69822272-69822294 CCTTGCTTGTAGCAGGGGCAGGG + Intronic
1140688114 16:77453145-77453167 ACTTTATTTTAGGCTGGGCACGG - Intergenic
1141978077 16:87531481-87531503 ACCTTGTTGGAGGAGAGGCATGG + Intergenic
1143324076 17:6087121-6087143 AGTGTTTTGAAGGAGCGGCATGG - Intronic
1144514891 17:15910587-15910609 ACATATTTGTAGGCCGGGCACGG - Intergenic
1145212754 17:21027082-21027104 AATTTTTTGTAGGCTGGGCGTGG - Intronic
1145855848 17:28156558-28156580 CTTTTTTTGTGGGAGGGGGAGGG + Intronic
1145950862 17:28815788-28815810 ACTTTTTTTTAGTAGAGACAGGG - Intronic
1146396938 17:32475764-32475786 AATTTTTTGTAGTAGAGACAGGG + Intronic
1146677695 17:34784896-34784918 ACTTTTTTCTGGGAGAGCCAAGG + Intergenic
1147212816 17:38881959-38881981 ACTTGTTTGGGGGAGAGGCAGGG + Intronic
1147449946 17:40497968-40497990 AGTTTCTTGTAGGTGGGGCTTGG + Intronic
1147684486 17:42278688-42278710 AATTATTTGTAGGCCGGGCACGG + Intergenic
1148000984 17:44386968-44386990 ATTTTTTTATAGGCTGGGCATGG + Intronic
1148663174 17:49353187-49353209 TCTTTTTTTCTGGAGGGGCAGGG + Intronic
1148667571 17:49386328-49386350 CCTTCTTTGTAGGCCGGGCATGG + Intronic
1149820786 17:59775232-59775254 AATTTTTTGTAGGCCGGGCGTGG - Intronic
1150961553 17:69918483-69918505 CTTTTTTTTTTGGAGGGGCAGGG + Intergenic
1152250290 17:79208991-79209013 ACTTTTTTTTAGTAGAGACAGGG + Intronic
1152676347 17:81643286-81643308 TATTTTTTGTAGGCCGGGCACGG - Intronic
1152679784 17:81661095-81661117 ATTGTTTTGTAGGCTGGGCATGG + Intronic
1154242365 18:12664251-12664273 AACTTTTTGTAGGCCGGGCATGG + Intronic
1154379069 18:13833402-13833424 ACGTGTGTGTTGGAGGGGCAGGG + Intergenic
1160206432 18:76837184-76837206 ACTTTTGTGAAGGCTGGGCATGG - Intronic
1161302698 19:3550675-3550697 AAGTTTTTGTAGGCTGGGCATGG - Intronic
1161725709 19:5927367-5927389 ATTTTTTTTTAAGTGGGGCAGGG - Intronic
1162848595 19:13413394-13413416 AACTTTTTGTAGGCCGGGCACGG - Intronic
1163322037 19:16580543-16580565 ATTTTTTTTTAGTAGGGACAGGG + Intronic
1163624518 19:18381436-18381458 AATTTTTTTTAGGCTGGGCACGG - Intronic
1163895674 19:20056894-20056916 ATTTTTTTTTTGGAGGGGGATGG + Intergenic
1163960869 19:20690705-20690727 ACTTTTTTTTTGGAGGGGCAGGG + Intronic
1164774695 19:30843901-30843923 ACATTTTTTTAGGCCGGGCAAGG + Intergenic
1165421465 19:35724057-35724079 TCTTTTGTGTAGGAGGGACAAGG + Intronic
1202659787 1_KI270708v1_random:57578-57600 AATTTTTTATAGGCTGGGCATGG + Intergenic
925655241 2:6140176-6140198 ATTTTTTTGGAGGGGGGGAATGG + Intergenic
925771452 2:7286379-7286401 ACTTTTTGATAGGAGGGACCTGG + Intergenic
926193904 2:10749320-10749342 ACTTTTTTTTGGTAGGGCCAGGG - Intronic
926433946 2:12819018-12819040 ACTTTTTGGTAATAGGGGCTTGG + Intergenic
927050658 2:19324969-19324991 ACCTTTGTGTAGGAGGGGATGGG - Intergenic
927944742 2:27128856-27128878 ACTTGTTTGTGGGTGGGGCAGGG + Intronic
928656007 2:33452638-33452660 ACTTTGTTCTAGGATGGGCCTGG + Intronic
928771505 2:34707393-34707415 ACTATTTTGTTGGTGGGGAAAGG + Intergenic
929202609 2:39253135-39253157 ACCTTTTTTTTGGAGGGGGACGG + Intronic
930685539 2:54303354-54303376 ACTTTTTTTTTGGAGGGGGGAGG - Intronic
932332979 2:70909372-70909394 AATTTTTTTTAGTAGGGACAGGG + Intronic
933722264 2:85405675-85405697 ACTATTTTGTAGGTTGGGAAAGG - Intronic
933935771 2:87202717-87202739 TCTTTGTTGTGGGAGGGGGAAGG + Intergenic
935150617 2:100431787-100431809 ACTTTTTGGCAGGCTGGGCATGG + Intergenic
935321295 2:101891841-101891863 ACTTTTTTGTGGGTGGGGCTTGG + Intronic
935700732 2:105809631-105809653 ATTTTTTTGGAGGTAGGGCAAGG + Intronic
936357377 2:111763113-111763135 TCTTTGTTGTGGGAGGGGGAAGG - Intergenic
938379213 2:130827227-130827249 ACTGATCAGTAGGAGGGGCAGGG + Intergenic
938422980 2:131158599-131158621 ACTTTTTTGGAGCAGGGGGAAGG - Intronic
939740009 2:145894411-145894433 ACTTTTTTTTTGGAGGGGGGTGG - Intergenic
939826761 2:147024585-147024607 ATTTTTTTGAAAGAGGGACAAGG + Intergenic
940097990 2:149999912-149999934 ACTTTTTTCAAAGGGGGGCATGG - Intergenic
940901303 2:159128774-159128796 ACTCTTTTGTTGGGGGGGCAGGG + Intronic
941683181 2:168420905-168420927 AGTTTTTTGTAAAAGGGGCAGGG - Intergenic
942101223 2:172585989-172586011 AATTTTTTTTAGTAGAGGCAGGG - Intronic
942647921 2:178134817-178134839 ATTTTTTTGTAGTAGAGACAGGG - Intronic
943378635 2:187115212-187115234 AGTTTCTTATAGGAGGGCCATGG + Intergenic
943844623 2:192629535-192629557 ACATTTTTGTAGGCCAGGCACGG + Intergenic
944415709 2:199477731-199477753 GCTGTTTTGTAGGATGGGGAGGG - Intergenic
945163649 2:206919646-206919668 CATTTTTTGTAGCAGGGTCATGG + Intergenic
945459562 2:210089689-210089711 TCTTTTTGGGGGGAGGGGCATGG + Intronic
1169455478 20:5749108-5749130 ACCATTTTGTAGGCCGGGCACGG + Intergenic
1172242850 20:33424801-33424823 AATTTTTTGTAGGCCAGGCACGG - Intronic
1172243444 20:33429053-33429075 AATTTTTTGTAGGCCAGGCACGG + Intronic
1174248316 20:49198967-49198989 ATTTTTTTGGCGGGGGGGCAGGG - Intergenic
1174614575 20:51825885-51825907 ATTTTTTTGTAGGCTGGGCACGG - Intergenic
1174639627 20:52032472-52032494 ACTTTGTTGTAGGCCAGGCATGG + Intergenic
1175368906 20:58473610-58473632 ACTTTTTTGGAGGAAGAGAAGGG - Intronic
1176427161 21:6555339-6555361 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1176628247 21:9113496-9113518 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1177548649 21:22592862-22592884 AATTTTTTGTAGTAGAGACAGGG + Intergenic
1178320299 21:31600187-31600209 ACTATTGTATAGGTGGGGCACGG + Intergenic
1179205462 21:39272782-39272804 ATTTTTTTTTAGTAGAGGCAGGG + Intronic
1179702652 21:43163657-43163679 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1180149003 21:45938144-45938166 CCCTGTTTGCAGGAGGGGCAGGG + Intronic
1180718120 22:17886102-17886124 ACTTCTGTGAGGGAGGGGCATGG - Intronic
1181145814 22:20846083-20846105 ATTTTTTTTTAGTAGAGGCAGGG - Intronic
1182959241 22:34456465-34456487 ATTTTTTTTTAGTAGAGGCAGGG - Intergenic
1183814596 22:40289103-40289125 AATTTTTTGTAGGCTGGGCGCGG - Intronic
1184590687 22:45480805-45480827 ACTGTGTTGGAGGAGGGGCTTGG + Intergenic
949466662 3:4351621-4351643 ACTTTTTTTTAGGGGCGGCGTGG - Intronic
950860931 3:16146676-16146698 ATTTTTTTTTTGGAGGGACAGGG + Intergenic
951224209 3:20102024-20102046 AATTTTTTTTAGGCTGGGCATGG + Intronic
951888594 3:27548888-27548910 ACCAAATTGTAGGAGGGGCAGGG + Intergenic
952499133 3:33943158-33943180 ACTTTATTGCAGGATGGGCAAGG + Intergenic
952509589 3:34039659-34039681 GCTTTTTTGTAGGAGGACCTTGG + Intergenic
954159748 3:48712534-48712556 ATTTTATTGTAGGCCGGGCATGG - Intronic
954168329 3:48779115-48779137 ACATTTTTTTAGGCCGGGCACGG - Intronic
954316344 3:49803695-49803717 ACTTCTTTGGGGGCGGGGCATGG + Intronic
954441105 3:50522393-50522415 ACTTCTTGGTGGGTGGGGCAGGG + Intergenic
954867634 3:53743472-53743494 CCTTTTATATAGGAGGGGCTGGG + Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
955727661 3:61950073-61950095 ATTTTTCTGGAGGAGGGGCCTGG - Intronic
955942658 3:64161080-64161102 ACTTTTAAGTAGGAGCGTCAGGG - Intronic
957063448 3:75500950-75500972 ACTTATTAGTAGGATGGGGAGGG + Intergenic
957094458 3:75765700-75765722 AATTTTTTATAGGCTGGGCATGG - Intronic
957365717 3:79220877-79220899 AATTCTTTGTAGTAGGGGCATGG + Intronic
957785810 3:84881203-84881225 AATTTTTTGTAGGTGGGTAATGG - Intergenic
957853218 3:85838561-85838583 ACTTTTTTGGAGGAGAGGGGAGG + Intronic
958706724 3:97665293-97665315 ACTTTTTTGTATAAGGTGCAAGG - Intronic
961289947 3:125838626-125838648 ACTTATTAGTAGGACGGGGAGGG - Intergenic
961584796 3:127913525-127913547 CCTTTTTTGGGGGAGGGGGATGG - Intergenic
961814385 3:129541688-129541710 CCTTTTTTTTGGGGGGGGCAGGG + Intergenic
962736695 3:138331805-138331827 ACTTTTTTTTAGTAGAGACAGGG - Intergenic
962762408 3:138527404-138527426 AATTATTTGTAGGCCGGGCACGG + Intronic
963058366 3:141205772-141205794 GCTTTTCTGGGGGAGGGGCAAGG + Intergenic
963541725 3:146599553-146599575 ACTTTTGGGTAAGAGGGGCTAGG + Intronic
965398942 3:168194983-168195005 TTTTTTTTGTAGTGGGGGCAGGG - Intergenic
965743177 3:171898065-171898087 GCTTATTTGTGGGAAGGGCAAGG + Intronic
966845245 3:184123726-184123748 AAGTTTTCATAGGAGGGGCATGG - Intergenic
967837791 3:193979221-193979243 GCTTATGTGGAGGAGGGGCAGGG - Intergenic
968846090 4:3042254-3042276 CCTTCTTTGTACGAGGGGAAGGG + Intergenic
969007333 4:4030952-4030974 ACTTATTAGTAGGATGGGGAGGG + Intergenic
970029411 4:11658390-11658412 GCTTTTCTGGGGGAGGGGCAGGG - Intergenic
972687638 4:41366512-41366534 TCTTTTTTGGAGGAAGGGTAGGG + Intronic
973598058 4:52512875-52512897 CTTTTTTTGTAGGCTGGGCATGG + Intergenic
974016999 4:56656569-56656591 ACTTTTTTGGAGGAAGGGTGGGG - Intronic
974362772 4:60903553-60903575 ATTTTTTTGTTGGGGGGACAGGG + Intergenic
974507536 4:62795963-62795985 AATTTTTTTTAGGAGAGGCAGGG + Intergenic
974963223 4:68729968-68729990 ACATTTTTGTGGGAGGGACGTGG - Intergenic
975053574 4:69898171-69898193 ACTTTACTGTAGTAGTGGCAAGG + Intergenic
978364861 4:107970694-107970716 ACTTTTTTTTAGATGGGGCGGGG + Intergenic
978737801 4:112103831-112103853 AATGTTTTGTAGGCCGGGCACGG - Intergenic
981055513 4:140357144-140357166 ACTTTTTTTTAGTAGAGACAGGG + Intronic
982548786 4:156770241-156770263 ATTTTTTTGTAGCAGTAGCAAGG + Intronic
984321951 4:178207996-178208018 GCTTTTCTGGGGGAGGGGCAAGG + Intergenic
984431314 4:179653110-179653132 ACTTTTTTGTAGGGGGTGGGGGG + Intergenic
984936617 4:184895374-184895396 TCTTTTTTGTAGGATGGGGAGGG + Intergenic
987350525 5:17017876-17017898 TCTTTTTTTTTGGAGGGGGATGG + Intergenic
987709684 5:21491855-21491877 TTTTTTTTGTAGGCCGGGCATGG + Intergenic
988749929 5:34182307-34182329 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
989002643 5:36776949-36776971 ATTTTTTTGTTGGGGGGGGACGG - Intergenic
989196178 5:38718785-38718807 ACTTTCTCCCAGGAGGGGCAGGG - Intergenic
989217183 5:38917464-38917486 ACCTTTTTCTAGGACGGTCAAGG - Intronic
990727385 5:58771642-58771664 ACTTTTTTGTAACAGTTGCAAGG + Intronic
990763895 5:59161099-59161121 ACTTTTTTGTTGGCGGGGGTGGG - Intronic
990846671 5:60148171-60148193 ACTTTTTTGGGGGTGGGGCAGGG + Intronic
991023971 5:62009821-62009843 ACTTTTATGTTGGTGGGGAAGGG - Intergenic
991240287 5:64451251-64451273 ACATTTTTGAAGGGTGGGCATGG - Intergenic
991262619 5:64683523-64683545 AATGTTGTGTAGGAGGGGCGAGG + Intergenic
991738188 5:69645513-69645535 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991760006 5:69910913-69910935 TTTTTTTTGTAGGCCGGGCATGG + Intergenic
991787326 5:70207189-70207211 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991789764 5:70225239-70225261 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991814513 5:70500348-70500370 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991817648 5:70521640-70521662 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991839236 5:70785964-70785986 TTTTTTTTGTAGGCCGGGCATGG + Intergenic
991879772 5:71207578-71207600 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
991882212 5:71225606-71225628 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
992113362 5:73516665-73516687 CTTTTTTTGGAGGAGGGGGACGG + Intergenic
994421809 5:99533178-99533200 ATTTTTTTGTAGGCCGGGCATGG + Intergenic
994461034 5:100067403-100067425 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
994485182 5:100380831-100380853 TTTTTTTTGTAGGCTGGGCATGG - Intergenic
996201073 5:120674252-120674274 CCTTTTTTGGAGGGCGGGCAGGG - Intronic
996540498 5:124626337-124626359 AATTTTCTGTAGGAGGTTCAGGG - Intergenic
998522070 5:142810161-142810183 AGTTTTGTCTGGGAGGGGCAGGG + Intronic
998743280 5:145229098-145229120 ACTTTTTTGTGGGCGATGCAGGG - Intergenic
999184998 5:149700652-149700674 ATATTTTTCAAGGAGGGGCATGG + Intergenic
1000081605 5:157853484-157853506 ACTGCTTTGTAGGCCGGGCACGG + Intronic
1000778214 5:165445220-165445242 ACTTTTTTTTTGGTGGGGGACGG - Intergenic
1001669857 5:173464498-173464520 TCTTTTTTGAAGGTGGGACAAGG - Intergenic
1002355237 5:178622879-178622901 ACTTGTATGTAGGAGGGAGATGG - Intronic
1005547993 6:26888648-26888670 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
1005569120 6:27127458-27127480 ACTTTTTTTTTGGAGGGGAAAGG + Intronic
1006308334 6:33238967-33238989 AAATTTTTGTAGGCCGGGCATGG + Intergenic
1007651755 6:43427013-43427035 ACTTTTTTTTGGGGGGGGGACGG - Intergenic
1008211961 6:48736507-48736529 ATATTTTTGTAGGTGGGGAAGGG + Intergenic
1009018754 6:57929728-57929750 TTTTTTTTGTAGGCCGGGCATGG - Intergenic
1010517785 6:76794254-76794276 ACTTTTTTGTAGGAGGCAGGTGG - Intergenic
1011511692 6:88108511-88108533 ACTTTTTTTTAGTAGAGACAGGG + Intergenic
1012418732 6:99038256-99038278 TATTTTTTGGAGGAGGGGCTGGG - Intergenic
1012650785 6:101749985-101750007 ACTTTTTTTTGGTAGGGACAGGG + Intronic
1013510408 6:110839684-110839706 CCTTTTTTTTAGTGGGGGCATGG + Intronic
1013554136 6:111239247-111239269 CCTTTTTTTTGGGAGGGGGATGG + Intergenic
1015069717 6:129076827-129076849 AATTTTCTGTAGGAAGGTCATGG + Intronic
1015434462 6:133169647-133169669 ACAATTTGGTAGGAGAGGCATGG - Intergenic
1015541327 6:134317208-134317230 AATTTGTTGGAGGAGGGGCAGGG - Intronic
1015735922 6:136400080-136400102 ACTTTTTTGTAGGAGGGGCAGGG - Intronic
1016001038 6:139041531-139041553 ATTTTTTTTTAGGAGAGACATGG + Intronic
1016577242 6:145583607-145583629 ACTTTGTAGGAGGAGTGGCATGG + Intronic
1016916018 6:149245145-149245167 ACATTTTTGGAAGAGGGTCAGGG + Intronic
1017250428 6:152274512-152274534 ACTTTTTTGGGGGTGGGGAAGGG + Intronic
1018770154 6:166963362-166963384 AATTTTTTGTAGGCTGGGCGAGG + Intergenic
1019833672 7:3359145-3359167 GCTTTTCTGTAGGAGTAGCAGGG + Intronic
1020234013 7:6341508-6341530 ATTTTTTTTTAGTAGAGGCAGGG - Intronic
1020264219 7:6549608-6549630 ATTTTTTTGGAGGTGGGGAATGG + Intronic
1020449913 7:8309171-8309193 ATTTTTTTTTAGTAGAGGCAGGG + Intergenic
1020738137 7:11977780-11977802 ACTTTTTTGTAGGACAGGTCTGG - Intergenic
1020936906 7:14477038-14477060 TCTTTTTAGTAGGCCGGGCACGG - Intronic
1021133077 7:16934644-16934666 AATGTTTTCTAGAAGGGGCATGG - Intergenic
1021421405 7:20449225-20449247 AATTTTTTTTTGGAGGGGGAGGG - Intergenic
1023123806 7:36935395-36935417 ATTTTTTTTTAGAAGGGACAAGG - Intronic
1023254437 7:38299224-38299246 CCTTTTTTCTGGGAGGGGTAGGG - Intergenic
1023402597 7:39801246-39801268 AATTTTTTATTGGCGGGGCATGG + Intergenic
1023474764 7:40564721-40564743 ACTGTCTTCTAGGAGGGGCTTGG + Intronic
1024647021 7:51379417-51379439 AATTTTTTATTGGTGGGGCATGG - Intergenic
1026335781 7:69393362-69393384 AATTTTTTTTTGGAGGGACAGGG - Intergenic
1026578864 7:71597327-71597349 ACTTTTTTGTAGGCCGGGCACGG - Intronic
1027557768 7:79687173-79687195 ACTTTTTGTTTGGAGGGGGAGGG + Intergenic
1027587285 7:80074521-80074543 CCATTGTTGGAGGAGGGGCATGG - Intergenic
1029622925 7:101701229-101701251 AATTATTTGTAGGAAGGACAAGG + Intergenic
1029660457 7:101957428-101957450 ACTTTTTTTTAGGCAGGGAACGG + Intronic
1029751338 7:102544258-102544280 ATTTTTTTTTTGGGGGGGCAGGG + Intronic
1029769290 7:102643352-102643374 ATTTTTTTTTGGGGGGGGCAGGG + Intronic
1030036874 7:105415496-105415518 ACTTTTTTGGGGGAGGGGGCTGG + Intergenic
1032141994 7:129340094-129340116 ATTTTTTTTTAGTAGAGGCAGGG + Intronic
1033678388 7:143567832-143567854 ACTTTAATGTAGGCCGGGCATGG - Intergenic
1033693453 7:143761617-143761639 ACTTTAATGTAGGCCGGGCATGG + Intergenic
1034427929 7:151024240-151024262 AGCTTCTTGTATGAGGGGCAGGG + Exonic
1034653979 7:152714086-152714108 ACTTTTTTTTAGTAGAGACAGGG - Intergenic
1034678463 7:152909958-152909980 ACAGCTTTGTAGGAGGAGCAGGG + Intergenic
1036281025 8:7401651-7401673 CCTTTTGTGTAGGAAGGGGAAGG - Intergenic
1036340440 8:7909921-7909943 CCTTTTGTGTAGGAAGGGGAAGG + Intergenic
1037262994 8:17027923-17027945 CTTTTTTTGTAAGAGGGGGAGGG - Intronic
1037857181 8:22380264-22380286 ACTGTCCTGTAGGATGGGCAGGG + Intronic
1038134476 8:24770464-24770486 ATTTTTTTGGAAAAGGGGCAGGG - Intergenic
1040437684 8:47408704-47408726 ACTTTTTTTTGGCAGGGGCAGGG - Intronic
1040459442 8:47633392-47633414 TCTTCTTTATAGGAGGGGGATGG + Intronic
1041558243 8:59184085-59184107 ACTTTTTTAAAGGAGGGGGTGGG - Intergenic
1043118527 8:76290810-76290832 AATTTTCTGGAAGAGGGGCAGGG - Intergenic
1044318390 8:90775330-90775352 TCTTAGTTGTAGGAGGGACAAGG + Intronic
1044984458 8:97745496-97745518 AAATTTTTGTAGGCCGGGCATGG + Intergenic
1045095420 8:98792522-98792544 ATTTTTTTTTAGTAGGGGCGGGG - Intronic
1046958378 8:120084577-120084599 TCTTTTTTGGAGGGGGGACAGGG - Intronic
1046983627 8:120363413-120363435 ACCTGTTGGGAGGAGGGGCAAGG + Intronic
1047901313 8:129425067-129425089 AATTTTTTGTAGGACAGGTATGG - Intergenic
1048569829 8:135642965-135642987 ACTTTTTTTTAGTAGAGACAGGG + Intronic
1048829923 8:138465946-138465968 ACTTTTTTTTAGTAGAGACAGGG + Intronic
1050073978 9:1844857-1844879 ACTTTTTTCTTGGAAAGGCAGGG - Intergenic
1050143526 9:2541414-2541436 ATTTTTTTTTAGTAGAGGCAGGG + Intergenic
1053302855 9:36964104-36964126 TCTATTTTTTAGTAGGGGCAGGG - Intronic
1053351851 9:37418443-37418465 ACTTGTGTGTAGGAGGAGCTGGG - Intergenic
1055501054 9:76902695-76902717 ACTTGGTTGGAGGTGGGGCACGG - Intronic
1056083830 9:83125118-83125140 GCTTTTTTGATGGAGGGGCAGGG + Intergenic
1057393088 9:94655329-94655351 ACTTTTTTGTTGTAGTGCCAAGG + Intergenic
1057482944 9:95460094-95460116 ACATATTTATAGGAGGGGAAGGG + Intronic
1058210898 9:102168565-102168587 ACATATTTGTAGGCCGGGCATGG - Intergenic
1058552771 9:106133315-106133337 ACTCTTTTTTTGGAGGGGCGGGG + Intergenic
1058857389 9:109076593-109076615 ACTTTTTTTTTGGCGGGGAAGGG - Intronic
1060850633 9:126872239-126872261 AGTTTTTTGTAGGCCGGGCGCGG - Intronic
1203751093 Un_GL000218v1:81176-81198 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1203482892 Un_GL000224v1:23182-23204 AATTTTTTATAGGCTGGGCATGG + Intergenic
1185892348 X:3832851-3832873 AATGTTTTGTAGGCGGGGCTCGG - Intronic
1185897456 X:3871270-3871292 AATGTTTTGTAGGCGGGGCTCGG - Intergenic
1185902575 X:3909702-3909724 AATGTTTTGTAGGCGGGGCTCGG - Intergenic
1186366939 X:8905418-8905440 ACTTCTCTGTAGGAGAGGCTTGG - Intergenic
1187642772 X:21313018-21313040 TCTTTGTTGTAGGAGGTGCTAGG - Intergenic
1187716113 X:22104274-22104296 ACTCTTTGGTAGGTGGTGCATGG + Intronic
1187971415 X:24662706-24662728 ACTTTGTACTGGGAGGGGCAGGG - Intronic
1188227929 X:27624828-27624850 AGTTTTTTGTATGTGGTGCAAGG - Intronic
1188745490 X:33836817-33836839 CCTTTTTTTTAGGAGGGGGGTGG - Intergenic
1190310582 X:49114427-49114449 AATTTTTTGTAGGCTGGGCGCGG - Intronic
1193187331 X:78528863-78528885 TTTTGTTTGTAGGAGGGGCCAGG - Intergenic
1195496791 X:105545489-105545511 GATTTTTTGTGGGAGAGGCAGGG + Intronic
1195690555 X:107620940-107620962 ACTTTATGGTAGGCTGGGCATGG + Intergenic
1198487298 X:137100485-137100507 ACTTTTTTGGGGGAGAGGCAGGG + Intergenic
1199146147 X:144369682-144369704 TCTTTTTTGGATTAGGGGCATGG - Intergenic
1201164749 Y:11198780-11198802 AATTTTTTATAGGCTGGGCATGG - Intergenic
1201223728 Y:11795852-11795874 AATTTTTTATATGAGAGGCAGGG + Intergenic
1201423909 Y:13828717-13828739 ACTTTTTTGGGGGAGGGGGGAGG + Intergenic