ID: 1015739740

View in Genome Browser
Species Human (GRCh38)
Location 6:136441304-136441326
Sequence TTGCATATAAGTGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015739740_1015739742 -7 Left 1015739740 6:136441304-136441326 CCATTAAAACCACTTATATGCAA 0: 1
1: 1
2: 3
3: 29
4: 325
Right 1015739742 6:136441320-136441342 TATGCAACTCCATTTACCTATGG No data
1015739740_1015739745 27 Left 1015739740 6:136441304-136441326 CCATTAAAACCACTTATATGCAA 0: 1
1: 1
2: 3
3: 29
4: 325
Right 1015739745 6:136441354-136441376 CATTGCAAAAAAACAAATTCAGG 0: 1
1: 0
2: 3
3: 54
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015739740 Original CRISPR TTGCATATAAGTGGTTTTAA TGG (reversed) Intronic
901424993 1:9176839-9176861 TGGCTTATAAGTGGGTCTAAGGG + Intergenic
902068178 1:13706800-13706822 TTGCATGTATGTAGTTTTAAGGG + Intronic
902975940 1:20088640-20088662 TTGCATATAAAAGGTTTTCTTGG - Intronic
906051217 1:42874888-42874910 TTGCATAGAGGTGTTTGTAATGG + Intergenic
907103124 1:51855209-51855231 TTGCAGGTAAGGGTTTTTAAAGG - Intronic
907749419 1:57247772-57247794 ATCCATATAAGTGGTCTTTATGG - Intronic
909315082 1:74206091-74206113 TTTCACATAATTAGTTTTAAAGG + Exonic
909896421 1:81076178-81076200 TGGCATCTAAGTGGATTTAGTGG - Intergenic
910215426 1:84839046-84839068 ATGCATAAAAATGGTTTGAATGG - Intronic
911563830 1:99438912-99438934 TTGCAGATAAGTAGGTTTATGGG + Intergenic
911938647 1:104013300-104013322 TTGGATATAAGCCATTTTAACGG + Intergenic
912370566 1:109170946-109170968 CTGCATGTAAATGGTTTTTATGG - Intronic
919016314 1:192041971-192041993 TTGAAAATGAGTAGTTTTAAAGG - Intergenic
919312568 1:195929577-195929599 TTGTTTATAGGTGCTTTTAAAGG - Intergenic
920792950 1:209110071-209110093 TTATAAATAAGTGGTTTTACTGG + Intergenic
923256480 1:232225836-232225858 TTGCAGGTAAGGGTTTTTAAAGG - Intergenic
923437806 1:233984431-233984453 TTGCAAGTAAGAGTTTTTAACGG + Intronic
923883440 1:238129287-238129309 TTGCAAGTAAGGGTTTTTAAAGG + Intergenic
923959646 1:239063227-239063249 TTGCATATAAGTGGTTTTATCGG + Intergenic
924307696 1:242708353-242708375 TTGGATTTGAGTGGTTCTAATGG - Intergenic
1063747899 10:8906695-8906717 TAGAATATAAGTGTTTCTAAAGG + Intergenic
1063994502 10:11606537-11606559 TTGAATGTAAATGTTTTTAAAGG + Intronic
1065455092 10:25898934-25898956 TTACATGTAAGGGTTTTTAAAGG + Intergenic
1066028535 10:31391838-31391860 TTGTATATATGTGTTTTTACTGG + Intronic
1067345250 10:45433544-45433566 TTGCAGGTAAGGGTTTTTAAAGG + Intronic
1067981565 10:51092353-51092375 TTGAATAGAAATGATTTTAAAGG + Intronic
1068449624 10:57169166-57169188 TTGAATAGAAGTGGTTAGAATGG - Intergenic
1068590031 10:58843952-58843974 TTGCATCTAATTGGTTTCCAGGG - Intergenic
1068699815 10:60007969-60007991 TAGCAAATAAGTCATTTTAAAGG - Intergenic
1069394296 10:67971745-67971767 TTGAATATAAGTGGTTATGGTGG - Intronic
1071191483 10:83106811-83106833 TAGTATTTAAGTGATTTTAAAGG - Intergenic
1074536841 10:114334184-114334206 CTGCACAGAAGTGGTTTTAAAGG - Intronic
1074819981 10:117170758-117170780 TTGAATGCAAGTGGTTTTTATGG + Intergenic
1075306746 10:121374728-121374750 ATGCTTATAAGTGGGTTCAATGG + Intergenic
1075824907 10:125347297-125347319 TTGAATATCAGTGGTGTTAGTGG - Intergenic
1075947728 10:126452639-126452661 TTGATTAGAAGTGGATTTAAAGG - Intronic
1078787361 11:14507881-14507903 CTACACATAAGTGGTTTTTAAGG - Intronic
1079179816 11:18181383-18181405 TTGAATAGAAGTGGTGTAAATGG - Intronic
1080311269 11:30895657-30895679 TTGCATATAAATGCTTATTAGGG - Intronic
1080352671 11:31403363-31403385 TTATATATAAGGGTTTTTAAAGG + Intronic
1080795956 11:35564038-35564060 TTACTTATAAGTGGTTTTTAAGG - Intergenic
1081269596 11:41067075-41067097 GTACATGTAAATGGTTTTAACGG + Intronic
1083827527 11:65211861-65211883 TTTTATATTAGTGATTTTAAAGG + Exonic
1085075404 11:73586783-73586805 ATGCATAAGAGTGGTTTTTAAGG - Intronic
1085727376 11:78965870-78965892 TTGAATTTAAGTGGTTTCCAAGG + Intronic
1086207710 11:84279985-84280007 TTGAATATAAGTGGTGAGAAGGG - Intronic
1086819010 11:91411917-91411939 TTGCATTTATGTGGTTCTATTGG - Intergenic
1087131992 11:94676636-94676658 TTGCAAGTAAGGGCTTTTAAAGG + Intergenic
1087895864 11:103585484-103585506 ATACAGAAAAGTGGTTTTAAAGG + Intergenic
1087987489 11:104702243-104702265 TTGAATAGAAGTGGTGATAATGG + Intergenic
1088515529 11:110628931-110628953 TAGCATGTAAGTTGTTTTTATGG - Intronic
1088677421 11:112208463-112208485 TTGAATATAAGTGATGATAATGG + Intronic
1088982602 11:114876925-114876947 ATGTATGTAAGTGGTTTCAAGGG - Intergenic
1090619961 11:128551621-128551643 TTGCATAGAAGTTGTTTTAAAGG + Intronic
1091915026 12:4265666-4265688 TAGAATTTAAGTGGTTTTAATGG - Intergenic
1092037821 12:5354723-5354745 TTGAATGTAAGTGGTGATAATGG - Intergenic
1092656991 12:10696296-10696318 TGGGAGATAAGTTGTTTTAAGGG - Intergenic
1092685824 12:11044772-11044794 TTGGATATAAGCTGTTTTAACGG - Intronic
1093285966 12:17263650-17263672 TTTCATAGAAGTAGTTTTAATGG + Intergenic
1093725516 12:22503909-22503931 ATACATATAAGTGCTTTCAATGG - Intronic
1093998609 12:25670226-25670248 TAGCTTTTAAGTGATTTTAAGGG + Intergenic
1094211921 12:27901941-27901963 TGGCATATCAGTGGATTTAAGGG + Intergenic
1096901865 12:54891526-54891548 AGGCATATAAGGGGTTTTAGTGG - Intergenic
1097121727 12:56738080-56738102 ATGCATATAGGTGGGTTTTATGG - Intronic
1097566963 12:61282281-61282303 TTGCAAACAAGTGGTTTTGTGGG - Intergenic
1098105000 12:67060388-67060410 TTGCATATAACTGATTTTGGGGG + Intergenic
1098587856 12:72175925-72175947 TAGCATATCAGTTGTTTTATAGG + Intronic
1098634856 12:72770042-72770064 TTGCAGATGAGTTGTTTTATGGG + Intergenic
1098701995 12:73640188-73640210 TTGCATATAAGTGGAGTTCGTGG - Intergenic
1098776934 12:74632233-74632255 GTGCATACAAGTGTTTGTAATGG + Intergenic
1099668140 12:85657165-85657187 TTGCCTATCTGTGGTTTTGAAGG - Intergenic
1099685164 12:85876948-85876970 TTGCCTGTAAATGTTTTTAAAGG + Intronic
1099775834 12:87128342-87128364 CTGCATTTAAGTGTTTATAAAGG + Intergenic
1100363554 12:93899156-93899178 TTGCAGGTAAGAGTTTTTAAAGG - Intergenic
1101269245 12:103125756-103125778 TATCATGTATGTGGTTTTAATGG - Intergenic
1102784582 12:115594197-115594219 TTGGATACAAGTAGTTTTATTGG + Intergenic
1104300024 12:127556444-127556466 TTGCATAAAAGTAGTTTTCTAGG + Intergenic
1104356555 12:128091759-128091781 TGACATCAAAGTGGTTTTAAAGG - Intergenic
1105043533 12:132982258-132982280 TTTCATATTAGTGGATTGAAAGG - Intergenic
1106315990 13:28594054-28594076 ATTCATATAAGGGGTTATAAGGG + Intergenic
1106677796 13:31979455-31979477 TTGGATAACAGTGGATTTAAAGG - Intergenic
1107246508 13:38303002-38303024 TTACATATAAATTCTTTTAAAGG - Intergenic
1108740907 13:53337807-53337829 TTGCATATCAGTGACTTAAATGG + Intergenic
1109156834 13:58921822-58921844 TTGCACATAAGAAGTTTTTATGG - Intergenic
1109365080 13:61343890-61343912 TTTCATTTAAATGGTGTTAATGG - Intergenic
1109779135 13:67084501-67084523 TTGCAGGTAAGGGTTTTTAAAGG - Intronic
1110123770 13:71915537-71915559 TTGAATATAATTGATTCTAAAGG + Intergenic
1110762623 13:79246873-79246895 TTAAATATAAGTAGTATTAAGGG + Intergenic
1111497136 13:89066386-89066408 TTGCATAACAGTATTTTTAAAGG - Intergenic
1113715040 13:112498055-112498077 TTGCATATATGTGTGTTTACAGG - Intronic
1115349708 14:32380777-32380799 CTGACTACAAGTGGTTTTAATGG - Intronic
1116254490 14:42533684-42533706 TTGAATAGAAGTGGTAATAATGG - Intergenic
1116368940 14:44105177-44105199 TTGAATAGAAGTGGTGTTAGTGG - Intergenic
1116903164 14:50380748-50380770 TGGCATATAAGTGGTATTCTAGG + Intronic
1117786113 14:59287387-59287409 TTGCATAGAAGTGGTGAGAATGG - Intronic
1117828243 14:59725883-59725905 TTGGAGATAAGTGATTTCAAGGG - Intronic
1118468252 14:66051341-66051363 TGGCACATATGTGGTTTTCAAGG + Intergenic
1119050221 14:71359924-71359946 TTTAACATAAGTGGTTTAAAAGG + Intronic
1119115051 14:72012129-72012151 TTGGATATAAGTGATTTGATTGG + Intronic
1120471640 14:84933192-84933214 TTGCAGGTAAGGGTTTTTAAAGG - Intergenic
1120779974 14:88478713-88478735 TTGAATTTTAGTGGTTTTACTGG - Intronic
1202842059 14_GL000009v2_random:130906-130928 TTGCATAAAAGCCATTTTAATGG - Intergenic
1202911447 14_GL000194v1_random:121139-121161 TTGCATAAAAGCCATTTTAATGG - Intergenic
1202881166 14_KI270722v1_random:61494-61516 TTGCATAAAAGCCATTTTAATGG + Intergenic
1124074789 15:26434230-26434252 TTCCAGGTAAGGGGTTTTAATGG + Intergenic
1124860014 15:33430278-33430300 TTACAGATAAGGGTTTTTAAAGG + Intronic
1126270209 15:46807477-46807499 TTGCAAATAAGTCTTTATAAAGG + Intergenic
1126568702 15:50127195-50127217 TTCCATGTAAGAGTTTTTAAAGG - Intronic
1126771970 15:52067039-52067061 TTGCAAAAAATTGGTTATAATGG - Exonic
1127062844 15:55205030-55205052 TAACATTTAAGTGGCTTTAATGG + Exonic
1129911219 15:79228106-79228128 TTCCAAAGAAGAGGTTTTAAAGG - Intergenic
1130626167 15:85517684-85517706 TTGCAAATAAGTGATTTGATAGG + Intronic
1131881892 15:96870848-96870870 TGGCAATTAAGTGGTTTGAAGGG - Intergenic
1132949685 16:2554107-2554129 ATGCTTAAAAGTGCTTTTAAAGG + Intronic
1132964663 16:2646060-2646082 ATGCTTAAAAGTGCTTTTAAAGG - Intergenic
1133751354 16:8728452-8728474 TTTCAGACAAGTGGTTTTAAGGG + Intronic
1138746550 16:59369244-59369266 TTACTTATACGAGGTTTTAAAGG - Intergenic
1139263773 16:65621103-65621125 CTGCATGTATGTGATTTTAAAGG - Intergenic
1140539605 16:75744666-75744688 TTGCATAAAAGGGGTTTTAAGGG + Intronic
1144176082 17:12708889-12708911 AGCAATATAAGTGGTTTTAAAGG - Intronic
1150989539 17:70240212-70240234 GTTGATATAAGTGATTTTAAAGG + Intergenic
1153088090 18:1311654-1311676 GTGCATACAAGTGCTTTTACAGG + Intergenic
1153416579 18:4852434-4852456 TTGAAGTCAAGTGGTTTTAAAGG - Intergenic
1153749755 18:8216926-8216948 TTGCATATATGCTGGTTTAAAGG + Intronic
1154040651 18:10852410-10852432 CTGAATTTAAGTGGTCTTAAAGG + Intronic
1155342478 18:24826609-24826631 TTGCAAGTAAGGGTTTTTAAAGG - Intergenic
1155688990 18:28593259-28593281 TTGTTTATAAGTGGATTAAATGG - Intergenic
1156224465 18:35090346-35090368 TTGAATAGAAGTGGTTAAAATGG - Intronic
1156365383 18:36421490-36421512 TTGCATATGATTGGTTTTTATGG + Intronic
1156560639 18:38121706-38121728 TTGCATATAAGTAGATGTGAAGG + Intergenic
1156644909 18:39149030-39149052 TTGCTTAAAAAAGGTTTTAAGGG - Intergenic
1158338290 18:56436902-56436924 ATACAAATAAGTGGTTTAAAAGG + Intergenic
1159479850 18:68975548-68975570 TTGCATATTTGTTGTATTAACGG + Intronic
1160321197 18:77897418-77897440 TTACATTTATGTGTTTTTAATGG + Intergenic
1163085704 19:14978430-14978452 TTGCATACAAGAGGTTTTCGAGG - Intronic
1202656775 1_KI270708v1_random:30600-30622 TTGCATAAAAGCCATTTTAATGG + Intergenic
925457473 2:4028213-4028235 TTCCAAATAAATGGTTATAATGG - Intergenic
925531662 2:4869674-4869696 TGTCATATGAGTGTTTTTAAGGG + Intergenic
925667897 2:6281264-6281286 TTTTGTATAAGTGGTTTGAATGG - Intergenic
926070094 2:9880967-9880989 TTACATAAAAATGGTGTTAAAGG - Intronic
926161419 2:10492672-10492694 TACCATAAAAGTGCTTTTAATGG - Intergenic
926532182 2:14062341-14062363 TTGCATATAAGGGGATTTATTGG - Intergenic
927624002 2:24693400-24693422 CTGGATATAATTAGTTTTAAGGG - Intronic
929719327 2:44351337-44351359 TAGCATATAAATGGTATTTAAGG - Intronic
930168449 2:48227321-48227343 TTGAATATGACTGGTTTTCATGG + Intergenic
930796762 2:55401113-55401135 TAGAAAATTAGTGGTTTTAAGGG + Intronic
930960644 2:57256050-57256072 TTGAATATAATAGTTTTTAATGG + Intergenic
932208963 2:69911265-69911287 TTGCAAAACAGTGTTTTTAAAGG + Intronic
933393565 2:81703533-81703555 TTGTAAATAACTGTTTTTAAAGG + Intergenic
933451842 2:82463729-82463751 TTGCAAGTAAGGGTTTTTAAAGG - Intergenic
935129937 2:100254252-100254274 TTGTATTTAAGTTGTCTTAAGGG + Intergenic
935161985 2:100537333-100537355 TTGGATATCAGTGTTATTAAAGG - Intergenic
935378295 2:102422542-102422564 TTTCAAGTAAGTGGTTTGAAAGG + Intronic
935719509 2:105967633-105967655 TTGCAAACCACTGGTTTTAAGGG + Intergenic
936252957 2:110881939-110881961 TTGCATATAAGTCTTTTTTAGGG + Intronic
936510853 2:113144781-113144803 TTGGATAAAAGTCATTTTAACGG + Intergenic
936701965 2:115022117-115022139 TTGAATAGAAGTGGTTAAAATGG - Intronic
936891126 2:117371603-117371625 TTGCTTAAAAGGGGTTTTAAAGG + Intergenic
937898438 2:126996757-126996779 TTACATGTAAGGGTTTTTAAAGG - Intergenic
938893094 2:135724925-135724947 TTGAATGTAAGTGGTTTAAGAGG - Intronic
939141840 2:138363259-138363281 TTGCACTTCAGTGGTTTGAAAGG + Intergenic
940196613 2:151102114-151102136 GTGCATATTTATGGTTTTAAAGG + Intergenic
941595287 2:167468940-167468962 TTGGATATAAGTGGCTACAATGG - Intergenic
941904030 2:170704163-170704185 TTGCAGTTAAGGGTTTTTAAAGG - Intergenic
943484255 2:188459372-188459394 TTGGATATAAGCCATTTTAATGG + Intronic
944141579 2:196462589-196462611 TTGTAAATAAGTGGGCTTAAAGG - Intronic
944173194 2:196801341-196801363 TTCCCTATAAGTGGTTTAAGTGG - Intergenic
944317689 2:198300926-198300948 TTGCAAATAAGTGCATTAAAGGG + Intronic
944571667 2:201051320-201051342 TTGAATAGAAGTGGTGATAATGG - Intronic
945305919 2:208258632-208258654 TTGTATTTAAGTGATATTAATGG - Intronic
945584539 2:211642778-211642800 TTGGATATATGTGCTTTCAAGGG - Intronic
945778352 2:214135459-214135481 ATGCATCTAAGTGGTTTCATGGG + Intronic
946058797 2:216923802-216923824 TTTCATTTAACTTGTTTTAAAGG + Intergenic
946722625 2:222626616-222626638 TTACAAATAAATGATTTTAAGGG + Intronic
947039675 2:225902731-225902753 TTGGATATAAGCCATTTTAACGG - Intergenic
947268846 2:228310475-228310497 TTGAATGTATATGGTTTTAAAGG - Intergenic
947584878 2:231348896-231348918 TTGGAGATAAGCCGTTTTAACGG - Intronic
948155465 2:235777849-235777871 TTGGATATTAGTGGGTTTATGGG + Intronic
1170952382 20:20948774-20948796 TTACCTGTAAGTGGTTTTCAAGG + Intergenic
1171342847 20:24444248-24444270 TTGCAGTTAAGTGTTTTTAAAGG + Intergenic
1176630807 21:9135808-9135830 TTGCATAAAAGCCATTTTAATGG - Intergenic
1176642477 21:9319021-9319043 TTGCATAAAAGCCATTTTAATGG + Intergenic
1177416071 21:20794882-20794904 TTGCAGGCAAGTGTTTTTAAAGG - Intergenic
1180351491 22:11808374-11808396 TTGCATAAAAGCCATTTTAATGG + Intergenic
1180375782 22:12091816-12091838 TTGCATAAAAGCCATTTTAATGG + Intergenic
1180386713 22:12183703-12183725 TTGCATAAAAGCCATTTTAATGG - Intergenic
1182460066 22:30477254-30477276 TTGCAGGTAAGGGTTTTTAAAGG - Intergenic
949240113 3:1861013-1861035 TTGCATCAACGTGGTATTAATGG - Intergenic
950319323 3:12035535-12035557 TTACATGTAAGGGTTTTTAAAGG + Intronic
951069897 3:18315236-18315258 TTGGATAAAAGCTGTTTTAACGG + Intronic
952366024 3:32675660-32675682 TTGCAAGTAAGGGTTTTTAAAGG - Intergenic
953092790 3:39746412-39746434 TTACAGATAAGGGTTTTTAAAGG + Intergenic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
953660566 3:44888558-44888580 TTGCATCTGAGTGTTTTTCAGGG + Intronic
955553595 3:60111422-60111444 TTATATATCAGTGGTTTTAGAGG - Intronic
955590330 3:60527945-60527967 TGGCCTATGAGTGGTTTGAATGG - Intronic
956346946 3:68290223-68290245 TTCCATAAAAGTGTTCTTAAAGG + Intronic
956387207 3:68732712-68732734 TTGTATTAAAGTGGTTTTAAAGG - Exonic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957097629 3:75791630-75791652 TTGCATAAAAGCCATTTTAATGG - Intergenic
957129694 3:76207009-76207031 TTGCATATTAATGGTTCTAGTGG - Intronic
957352467 3:79043587-79043609 TTGCAAACGACTGGTTTTAAGGG + Intronic
957548061 3:81665616-81665638 TTACATATAAGTGGTCTTCTTGG + Intronic
958544038 3:95517664-95517686 TTACATATAAATATTTTTAAAGG + Intergenic
958851113 3:99326663-99326685 TTGCATGTAAGTGACTTTCAAGG - Intergenic
959358828 3:105366157-105366179 TGGCATAGACTTGGTTTTAAAGG - Intergenic
959805033 3:110540843-110540865 TTGAAGATAAGGGATTTTAAAGG + Intergenic
960066680 3:113381584-113381606 TTGCATGTAAGTGGTAATGAAGG - Intronic
960206920 3:114913260-114913282 TTGGATGTAAGTCATTTTAACGG + Intronic
961082821 3:124041139-124041161 TTGGATATAAGGGGTTAAAAGGG + Intergenic
963910588 3:150814184-150814206 TTGCTTAAAAGAGGTCTTAAGGG - Intergenic
964449021 3:156792102-156792124 TTGCATGTAGGGGTTTTTAAAGG - Intergenic
965316919 3:167203434-167203456 CTGCATATAATTGGTGTTATGGG - Intergenic
965373487 3:167893232-167893254 TAGCATATAGATGGTTTTTAAGG + Intergenic
966276667 3:178181179-178181201 TTGGAAAAAAGTGGTTTAAATGG - Intergenic
966994525 3:185266851-185266873 TTGCTTAAAAGGGGTTTTAAGGG + Intronic
1202744409 3_GL000221v1_random:85997-86019 TTGCATAAAAGCCATTTTAATGG - Intergenic
969388016 4:6869320-6869342 TTGAAGATAAGTGGATTTAGAGG - Intronic
971829830 4:31676685-31676707 TTGGATATAAGTGCTTACAATGG - Intergenic
972162713 4:36245109-36245131 TTGCAAATAACTGGATTTTACGG - Intergenic
972401765 4:38711206-38711228 TTGCATGCAGGTGGTTTAAAGGG - Intergenic
972950865 4:44320362-44320384 TTGCAACTAAGTTCTTTTAAGGG + Intronic
974165863 4:58201178-58201200 TTTAATATAAGTGTTTTTTAAGG - Intergenic
974457884 4:62151648-62151670 TTGCCTATAAGTGGCCTAAATGG + Intergenic
974486063 4:62507604-62507626 TTGCAAATGAGTGATTATAATGG + Intergenic
974587485 4:63897678-63897700 TTGAATGTAAGTAATTTTAACGG + Intergenic
975649249 4:76575962-76575984 TTGGATATAAGCCATTTTAACGG - Intronic
976428483 4:84934199-84934221 TTGCATAAAAGCCATTTTAATGG + Intronic
976850604 4:89541026-89541048 TTGCTTATAATTTGTTGTAAGGG - Intergenic
978475809 4:109128549-109128571 TTGCAGGTAAGAGTTTTTAAAGG - Intronic
978616695 4:110604150-110604172 TTGCATTTAAGTTGTTTTCTGGG + Intergenic
978758390 4:112328740-112328762 TTGCATATATGTGGATTTGTGGG + Intronic
978785673 4:112607043-112607065 TTATATATAAGTGTTATTAAAGG - Intronic
978861899 4:113460345-113460367 TTGTATGTAAGTGTTTTTAGAGG - Intronic
981755092 4:148134397-148134419 TTTCATACAAGTGGATTAAAAGG - Intronic
981816728 4:148839616-148839638 TTTCAGGTAAGGGGTTTTAAAGG + Intergenic
982079467 4:151774292-151774314 TTGCATATAAGAAATGTTAAAGG - Intergenic
982944868 4:161607952-161607974 TTGCATTTAAATTGTTATAAAGG - Intronic
983765281 4:171473184-171473206 TTGCCTAAAAGTGGATATAAAGG + Intergenic
984129184 4:175851864-175851886 TTGCATAAAACAGGTTTTACTGG - Intronic
984978357 4:185252020-185252042 TTGCTTTAAAGTGGTTTTCAGGG + Intronic
985047201 4:185952365-185952387 TTGCATTTCAGTGGGATTAAAGG + Intronic
1202757380 4_GL000008v2_random:77257-77279 TTGCATAAAAGCCATTTTAATGG + Intergenic
986701942 5:10418712-10418734 TTTTATTTAAGTGCTTTTAATGG + Intronic
987096019 5:14550917-14550939 TAGCATATAAGTGAGTTTGAAGG + Intergenic
988244895 5:28667146-28667168 TTGCTTAAAAGGGGTTTCAAGGG - Intergenic
989316052 5:40079979-40080001 TTTCATATTGGTTGTTTTAAAGG - Intergenic
989671221 5:43918685-43918707 TTGGATATAAGCTGTTTTACTGG + Intergenic
989770219 5:45135863-45135885 TTGCATATAAGGTTTTTTAAAGG + Intergenic
990059161 5:51625894-51625916 TTGCAAATAAATGAATTTAATGG + Intergenic
990905321 5:60796719-60796741 TTTCATTTAAATGGTTTTAAAGG + Intronic
992269089 5:75047632-75047654 TTGCAGAAAATTGTTTTTAAAGG - Intergenic
992321225 5:75614937-75614959 TTGCATAGAAGTGATTTCATAGG + Intronic
993608638 5:90027284-90027306 TTGCATAAAAGTGGTGAAAATGG - Intergenic
994188752 5:96844001-96844023 TTGCAAGTAAGGGTTTTTAAAGG - Intronic
994757372 5:103811288-103811310 TCCCATATAAGTTGTTTTGAAGG - Intergenic
995109368 5:108411846-108411868 TTGCAGGTAAGGGTTTTTAAAGG + Intergenic
995725521 5:115178018-115178040 TTGATTATAAGGAGTTTTAATGG + Intronic
996980485 5:129486688-129486710 TTGAATAGAAGTGGTTAGAATGG - Intronic
1000026296 5:157361967-157361989 TTGCAAACAAGGGTTTTTAAAGG + Intronic
1007868959 6:45010370-45010392 TTGCATATAAGTGCCATTAATGG + Intronic
1008867354 6:56228779-56228801 TTCCATACAAGGAGTTTTAATGG - Intronic
1009408201 6:63334076-63334098 TTGAATATAAGTGGTTAAAATGG - Intergenic
1010175898 6:73027617-73027639 ATGCAAATAAGTGCTATTAAGGG + Intronic
1010336676 6:74692665-74692687 TTGGATATAAGTCATTTTAACGG + Intergenic
1011389507 6:86836527-86836549 TTGCAGGTAAGGGTTTTTAAAGG - Intergenic
1011464423 6:87640777-87640799 TTGCATAAATAAGGTTTTAAGGG + Intronic
1011469861 6:87697475-87697497 TGGCAAATAAATGTTTTTAATGG - Intronic
1012442739 6:99276792-99276814 TTGCATATATGTGTTTTTCTGGG + Exonic
1013092758 6:106915189-106915211 TTGAATAGAAGTGGTTAGAACGG - Intergenic
1013190270 6:107797667-107797689 CTGCATATAAGTGGTGAGAAAGG + Intronic
1013573336 6:111452610-111452632 TAGCAGATAAGTGGTTGTGAGGG + Intronic
1014095794 6:117459412-117459434 GTGCTTTTAAGTGCTTTTAAAGG + Intronic
1014866503 6:126537881-126537903 TTCAATATAAGTGGTTTATATGG + Intergenic
1015739740 6:136441304-136441326 TTGCATATAAGTGGTTTTAATGG - Intronic
1017273550 6:152538437-152538459 TTTCATATAAGTGGTTTTATAGG - Intronic
1017306083 6:152920187-152920209 TTACATGTAAATGGTTTTAGTGG - Intergenic
1018444970 6:163848143-163848165 TTGAATATAAGTGGTGAAAATGG + Intergenic
1020849656 7:13335892-13335914 TTTCATAAAAGCTGTTTTAATGG - Intergenic
1021311921 7:19107143-19107165 TTGCATATAATAGGTGTTTATGG - Intronic
1021743651 7:23715233-23715255 TTGCTTATAAGTGGTTTATAAGG - Intronic
1022836289 7:34118560-34118582 TGGCATGTATGTGGTTTTCAAGG + Intronic
1023485455 7:40681603-40681625 TTGCAGGTAAGGGTTTTTAAAGG + Intronic
1026212916 7:68322847-68322869 TTGCAGATAAGGGATTTTAAAGG + Intergenic
1026346887 7:69482255-69482277 TTGCAGATAAGGGTTTTTAAAGG - Intergenic
1028715032 7:93956025-93956047 TTTGATATAAGTGGTCTTATGGG + Intergenic
1028858269 7:95616963-95616985 TTGAATATGAGTGGTTAGAAAGG - Intergenic
1030959253 7:115894310-115894332 TTGCATCTATGTTGTTGTAAAGG - Intergenic
1031287938 7:119895831-119895853 TTGTATATATTTGGTTTAAAAGG + Intergenic
1031524865 7:122812390-122812412 TTCCAAACAAGTGTTTTTAATGG - Intronic
1032271882 7:130416382-130416404 TTGCAGATAAGTTTTTTAAAAGG + Intronic
1032771488 7:135063142-135063164 TGGCATATAATTGTTTATAATGG + Intronic
1033382018 7:140830713-140830735 TTGCATTTCAGTGATTTTTATGG - Intronic
1033779579 7:144652565-144652587 TTGCATATAGTTGGTGTTCAGGG - Intronic
1035876878 8:3200255-3200277 TGGCCTATATGTGCTTTTAAAGG - Intronic
1037200320 8:16244573-16244595 GTGCAGATAAGAGGCTTTAAAGG - Intronic
1037299167 8:17433362-17433384 TTGCAAATATTTGGTTTGAATGG - Intergenic
1038704995 8:29885168-29885190 TTGCAGATAAGGGATTTTAAAGG - Intergenic
1039659202 8:39445142-39445164 TTGAATAAAAGTGTTTTTGATGG - Intergenic
1039994074 8:42516297-42516319 TTCCATAAAAGTACTTTTAAAGG + Intronic
1040537896 8:48325541-48325563 TTTCATTTAAGGGTTTTTAATGG + Intergenic
1042163188 8:65919233-65919255 TTGGATATAAGCCATTTTAACGG - Intergenic
1042589779 8:70386461-70386483 TTACTTATAAGTGGCTTTCAGGG + Intronic
1043972654 8:86549484-86549506 ATGCATATAAGTGAATTTAGGGG + Intronic
1044333110 8:90944551-90944573 TTGAATATAAGTGGTGTACACGG + Intronic
1045991314 8:108311911-108311933 TTGGATATAAGCCATTTTAATGG - Intronic
1047477439 8:125247357-125247379 TTTCCTATATGTGGTTTTAGTGG - Intronic
1047852481 8:128873115-128873137 TTCTATATAGGTGGTTTTAAAGG - Intergenic
1049327733 8:142032313-142032335 TGGCAGATAAGGGTTTTTAAAGG + Intergenic
1051052001 9:12945470-12945492 TTGAGTAGAAGTGATTTTAATGG - Intergenic
1051388767 9:16540661-16540683 TTCCATTTATGTGATTTTAAAGG + Intronic
1051648074 9:19290628-19290650 TTGCATATGATAGGTATTAATGG - Intronic
1051971977 9:22899479-22899501 GTGCATTGAAGTGGTTTAAAAGG - Intergenic
1056262890 9:84866380-84866402 TTGCATATAAGTCGATGTAGAGG + Intronic
1056661986 9:88550461-88550483 TTACATGTAAGGGTTTTTAAAGG + Intronic
1056772420 9:89488795-89488817 TTGGTTTTAAGTTGTTTTAATGG - Intronic
1058028503 9:100169264-100169286 TTGCATTTAAGTGATATCAATGG + Intronic
1058122101 9:101150057-101150079 TTTTATATATGTGCTTTTAATGG + Intronic
1061073437 9:128326230-128326252 TTCCACATAACTGGTATTAATGG + Intronic
1203688976 Un_GL000214v1:24298-24320 TTGCATAAAAGCCATTTTAATGG + Intergenic
1203753637 Un_GL000218v1:103510-103532 TTGCATAAAAGCCATTTTAATGG - Intergenic
1203491185 Un_GL000224v1:106838-106860 TTGCATATAATTTGGGTTAATGG - Intergenic
1203503809 Un_KI270741v1:48709-48731 TTGCATATAATTTGGGTTAATGG - Intergenic
1203713040 Un_KI270742v1:115946-115968 TTGCATAAAAGCCATTTTAATGG - Intergenic
1203538169 Un_KI270743v1:62118-62140 TTGCATAAAAGCCATTTTAATGG + Intergenic
1203647299 Un_KI270751v1:79755-79777 TTGCATAAAAGCCATTTTAATGG - Intergenic
1187024672 X:15422270-15422292 TTGAATAAAAGTGGTTAAAATGG - Intronic
1187481108 X:19656531-19656553 ATGCATATATGTGGACTTAAGGG - Intronic
1187680532 X:21762795-21762817 TTGCACATCAGTCTTTTTAAAGG - Intergenic
1187930390 X:24288383-24288405 TTGTATTTTAGTGGTTGTAATGG + Intergenic
1188263816 X:28045601-28045623 TTGGATATAAGCCATTTTAATGG + Intergenic
1188583022 X:31738388-31738410 TTGGATATAAGCCATTTTAACGG - Intronic
1189020047 X:37326179-37326201 TTGGATATAAGCCATTTTAACGG - Intergenic
1189539946 X:41976271-41976293 TAGAATATATGTGGCTTTAAAGG + Intergenic
1191169309 X:57424651-57424673 TTGCTTCTAAGTGTTTTTAGTGG - Intronic
1191213610 X:57913778-57913800 TTGCATAGAAGTGGTGATAGTGG + Intergenic
1191912586 X:66166495-66166517 TAACATCTAAGTGGTTATAAAGG + Intronic
1192023315 X:67420024-67420046 TTGTATAGAAGTGGTTGAAATGG + Intergenic
1192975768 X:76282877-76282899 TTGGATATAAGCCATTTTAACGG + Intergenic
1193161627 X:78235257-78235279 TTGTATATAAGTAATTTTAATGG + Intergenic
1194252614 X:91596158-91596180 TTGCATTTAATTTGTTTTAAAGG + Intergenic
1194684250 X:96892968-96892990 ATGCATATAAGTGTTTTAAGAGG - Intronic
1194787965 X:98110071-98110093 TTGCATATAAATGGAATAAAAGG + Intergenic
1195155366 X:102117402-102117424 TGCCTTATAAGAGGTTTTAAAGG + Intergenic
1196008032 X:110856171-110856193 TTGAATAGAAGTTGTTATAAGGG - Intergenic
1197070393 X:122289848-122289870 TGGGATAGAAGTGGTTTTATTGG - Intergenic
1197621048 X:128749417-128749439 TTGCATACAATTGGGTTTCAAGG - Intergenic
1198696781 X:139349199-139349221 TTGAATATAAGTCATTTTAATGG + Intergenic
1199134307 X:144232857-144232879 TTGCTTTTAAATGGTATTAATGG + Intergenic
1199254766 X:145706573-145706595 TTGCACACAAGTGTTTATAATGG + Intergenic
1199992962 X:152999618-152999640 TTGCAGGTAAGGGCTTTTAAAGG - Intergenic
1199995187 X:153019810-153019832 TTGCAGGTAAGGGCTTTTAAAGG - Intergenic
1200252459 X:154560866-154560888 TGGCCTAGAAGGGGTTTTAAAGG - Intronic
1200265308 X:154643550-154643572 TGGCCTAGAAGGGGTTTTAAAGG + Intergenic
1200571546 Y:4837415-4837437 TTGCATTTAATTTGTTTTAAAGG + Intergenic
1201167280 Y:11221069-11221091 TTGCATAAAAGCCATTTTAATGG - Intergenic
1201450693 Y:14110318-14110340 TTTCAGATAAGTGTTTTTGAAGG - Intergenic
1201723186 Y:17125568-17125590 TTGCATAAAAGTGTATTTATGGG + Intergenic
1201934414 Y:19392083-19392105 TTGAATATAAGTGGTGAGAAAGG + Intergenic