ID: 1015752300

View in Genome Browser
Species Human (GRCh38)
Location 6:136572545-136572567
Sequence TTTCAGTTTAGGGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 1, 1: 0, 2: 13, 3: 80, 4: 709}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015752300_1015752309 19 Left 1015752300 6:136572545-136572567 CCATGCCCAGCCCTAAACTGAAA 0: 1
1: 0
2: 13
3: 80
4: 709
Right 1015752309 6:136572587-136572609 TATAATCTCACTTTTAGGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 224
1015752300_1015752307 14 Left 1015752300 6:136572545-136572567 CCATGCCCAGCCCTAAACTGAAA 0: 1
1: 0
2: 13
3: 80
4: 709
Right 1015752307 6:136572582-136572604 TTGACTATAATCTCACTTTTAGG 0: 1
1: 1
2: 0
3: 20
4: 240
1015752300_1015752308 15 Left 1015752300 6:136572545-136572567 CCATGCCCAGCCCTAAACTGAAA 0: 1
1: 0
2: 13
3: 80
4: 709
Right 1015752308 6:136572583-136572605 TGACTATAATCTCACTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015752300 Original CRISPR TTTCAGTTTAGGGCTGGGCA TGG (reversed) Intronic
900230761 1:1556003-1556025 ATTCACTTTGAGGCTGGGCATGG + Intronic
900233065 1:1572083-1572105 ATTCTATTTAGGGCTGGGCGCGG - Intronic
901408706 1:9067682-9067704 TCTCAGTTGAGGGCTGGGAGTGG + Intronic
901583451 1:10265524-10265546 AATCAGTTAAAGGCTGGGCATGG - Intronic
901661054 1:10798080-10798102 TTCCAGTTTAAGGCAGGACATGG - Intergenic
901830352 1:11888354-11888376 TTCCAGTTCTAGGCTGGGCACGG - Intergenic
901940322 1:12656848-12656870 ACTCAGTGTAAGGCTGGGCATGG + Intronic
901960517 1:12822994-12823016 TTCATGTTTAGGGCTTGGCATGG - Intergenic
901967110 1:12877604-12877626 TTCATGTTTAGGGCTTGGCATGG - Intronic
901974908 1:12936744-12936766 TTCATGTTTAGGGCTTGGCATGG - Intronic
901982511 1:13047862-13047884 TTCATGTTTAGGGCTTGGCATGG - Intronic
901986509 1:13079472-13079494 TTCATGTTTAGGGCTTGGCATGG + Intergenic
901995303 1:13147295-13147317 TTCATGTTTAGGGCTTGGCATGG - Intergenic
901999576 1:13181057-13181079 TTCATGTTTAGGGCTTGGCATGG + Intergenic
902010266 1:13265020-13265042 TTCATGTTTAGGGCTTGGCATGG + Intergenic
902018054 1:13324182-13324204 TTCATGTTTAGGGCTTGGCATGG + Intergenic
902527937 1:17071389-17071411 TTCCAGGTGAGGGCAGGGCAGGG - Exonic
903045581 1:20562096-20562118 TTGCACTTTTTGGCTGGGCACGG + Intergenic
903461762 1:23525341-23525363 CTCCTGGTTAGGGCTGGGCAGGG + Intronic
903863934 1:26383963-26383985 AACCATTTTAGGGCTGGGCAAGG - Intergenic
904251696 1:29229492-29229514 ATTCAGGCTAGAGCTGGGCACGG - Intronic
905130339 1:35750681-35750703 TTTCCTTTTTGGGCCGGGCAGGG - Intronic
905595213 1:39200782-39200804 TTCCACTTGAGGGGTGGGCATGG + Intronic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
905986446 1:42287668-42287690 ATTCCATTTAGGGCCGGGCATGG + Intronic
906537911 1:46562103-46562125 AGTCAGTTCAGGGCTGGGCGCGG + Intronic
907923177 1:58931786-58931808 TTCCAGTCGAGGGGTGGGCAGGG - Intergenic
908463590 1:64369814-64369836 TGTCTGTTTTTGGCTGGGCATGG + Intergenic
909766180 1:79358975-79358997 CTTCAGAGTAGGGCAGGGCATGG - Intergenic
910158187 1:84244306-84244328 TTCCAGTTTGGGGCTGCACACGG - Intergenic
910326295 1:86012107-86012129 TTTATTTTTAAGGCTGGGCATGG - Intronic
910985870 1:93004034-93004056 TTTAAATTTAGGGCTGGGCATGG - Intergenic
911172244 1:94782276-94782298 CTACAGTGTAGGGCTTGGCAGGG - Intergenic
911381640 1:97121962-97121984 TTTCAGTCTAGAGCAGGGCATGG + Intronic
911658780 1:100476160-100476182 TATCAGCTCTGGGCTGGGCACGG + Intronic
911993641 1:104735583-104735605 TTTTGGTTTTGGGCTGGGTAGGG + Intergenic
912434015 1:109645656-109645678 TATCAGTACTGGGCTGGGCATGG + Intergenic
912821065 1:112868107-112868129 TTTTATTTCAGGGCCGGGCAGGG - Intergenic
912893967 1:113565138-113565160 TTTCATTTCAGGGTTGGGCTCGG - Intronic
913012800 1:114701256-114701278 ATTTAGTTTGAGGCTGGGCATGG - Intergenic
913275285 1:117131635-117131657 TTAAAAATTAGGGCTGGGCATGG - Intergenic
913293655 1:117298264-117298286 TTTCAGGCCTGGGCTGGGCATGG - Intergenic
913319553 1:117578757-117578779 TTTCATTTTAGCACTGGGGATGG - Intergenic
914838838 1:151230930-151230952 GTTAATTTTAGGGCTGGGCATGG + Intronic
914923028 1:151860273-151860295 TTGCAGTACAGGGCTGGCCAGGG - Intergenic
915456825 1:156046195-156046217 TGTCAGTTTTAGGCCGGGCACGG + Intronic
915944206 1:160137810-160137832 TCTTAGTTTGGGGCTGGGGAGGG + Intronic
916056874 1:161074086-161074108 TTTCAGACTAGAGGTGGGCAGGG - Intronic
916559124 1:165917826-165917848 TATCATGTCAGGGCTGGGCAAGG + Intergenic
916796471 1:168171998-168172020 TTTCAGGGCAGGGCTGGGCAGGG + Intergenic
916952112 1:169790911-169790933 TTTCCATGAAGGGCTGGGCAGGG + Intronic
917294178 1:173501981-173502003 TTGCTGTTTATGGCTGGGCGCGG + Intronic
917324572 1:173818942-173818964 TTCCAAATTAGGGCCGGGCATGG + Intronic
917464615 1:175264864-175264886 TAACAGTTTAGAGATGGGCAGGG + Intergenic
917528351 1:175810064-175810086 TTTCAATTGAGGGATGGGTAAGG - Intergenic
917536038 1:175875412-175875434 TTTCAGTTTTGGGAAGGGCTAGG - Intergenic
917550366 1:176020395-176020417 TTACACTGTAAGGCTGGGCATGG + Intronic
917863951 1:179175404-179175426 TTTCTGTTCTGGGCAGGGCAGGG - Intronic
917977205 1:180247830-180247852 TTTCAGTCCAGGCCTGGGCAGGG + Intronic
917986926 1:180330119-180330141 CTTCATTTGAAGGCTGGGCATGG + Intronic
918398429 1:184139589-184139611 TTTCACTCCAGAGCTGGGCATGG + Intergenic
918506999 1:185266352-185266374 TTTAATTCTAAGGCTGGGCACGG - Intronic
918623945 1:186636777-186636799 TTTCTGTTCAGGACTGGGGACGG - Intergenic
919239629 1:194895914-194895936 TCTCAATTTTAGGCTGGGCATGG - Intergenic
919372494 1:196746153-196746175 TTTCTCTTTAGGGCTGGGTGCGG + Intronic
919378941 1:196830835-196830857 TTTCTCTTTAGGGCTGGGTGTGG + Intronic
919547764 1:198944934-198944956 TTTGAGCTCAGGGCCGGGCACGG - Intergenic
919824976 1:201497058-201497080 TTTAAATGCAGGGCTGGGCATGG + Intronic
919874887 1:201857503-201857525 TTTCAGTTTATGGCTGGGCGTGG + Intronic
919912456 1:202120040-202120062 TTTCAGCTTTGGGCTGGGTGAGG + Intergenic
920305554 1:205016083-205016105 TTGCAGGTCAGGGCAGGGCAGGG - Intronic
920629929 1:207642302-207642324 TTTGATGTTAGGGCTGGGCGCGG - Intergenic
920841445 1:209558695-209558717 TAGCAGTTTGAGGCTGGGCATGG + Intergenic
920884014 1:209908859-209908881 AGATAGTTTAGGGCTGGGCATGG + Intergenic
921284187 1:213594153-213594175 TTCCATTTTTAGGCTGGGCATGG - Intergenic
921350127 1:214226181-214226203 TTATAGTTTAGGGCCAGGCATGG + Intergenic
921961767 1:221042790-221042812 TTAAAATTTAAGGCTGGGCATGG - Intergenic
922034058 1:221831200-221831222 ATTGATTTTAGGGCTGGGCACGG - Intergenic
922280654 1:224120570-224120592 TGTCATTGTAGGGCTGGGCGTGG + Intronic
922766643 1:228159529-228159551 TCTCAGTTTGGGGCTGGGAAGGG - Exonic
922774554 1:228208717-228208739 TGTCAGTGTAGGGGTGGGGAGGG + Intronic
922872056 1:228910883-228910905 ATACAGTTCAAGGCTGGGCACGG - Intergenic
923147143 1:231206135-231206157 TTTAATTTTTTGGCTGGGCATGG + Intronic
923672837 1:236055329-236055351 ATTCAGTTTGGGGATGGGGAGGG + Intronic
924465880 1:244298915-244298937 TTGCAGTTTTAGGCTGGGCGTGG + Intergenic
924567409 1:245210218-245210240 TTTCATTCCAGGGATGGGCAGGG + Intronic
924940665 1:248810908-248810930 TTTCAGTTTGGGGAAGAGCAAGG + Exonic
1063579977 10:7297461-7297483 TCTCAGCACAGGGCTGGGCAGGG + Intronic
1064020873 10:11807570-11807592 ATTCAGGTTACGGCTGGGCATGG - Intergenic
1064246928 10:13675689-13675711 ATACGTTTTAGGGCTGGGCACGG - Intronic
1064353834 10:14600573-14600595 TTACAGTTAAGAGCTGGGAAGGG - Intronic
1064383802 10:14872400-14872422 GATCTCTTTAGGGCTGGGCACGG + Intergenic
1064604507 10:17024794-17024816 AATGAGTTTGGGGCTGGGCATGG - Intronic
1064712886 10:18144368-18144390 TATCCATTTTGGGCTGGGCATGG - Intronic
1064925224 10:20562297-20562319 TGTCTGTTTCTGGCTGGGCATGG + Intergenic
1064954997 10:20898456-20898478 TTTCAGTTTAGGTAAGGCCAAGG - Intronic
1064982932 10:21182179-21182201 ATTCATTTTAGGGTTGGGCACGG + Intergenic
1065200846 10:23311419-23311441 TTCCAGCTTGGGGCCGGGCACGG + Intronic
1065377669 10:25059663-25059685 TTACATTTTAGGGCCAGGCATGG + Intronic
1065574388 10:27103321-27103343 CTGAAATTTAGGGCTGGGCATGG + Intergenic
1065998870 10:31085710-31085732 TTTTAGTCTAGGGCTGAGAATGG - Intergenic
1066301807 10:34103933-34103955 TTTTAATTTAAAGCTGGGCACGG - Intergenic
1067136595 10:43613921-43613943 AGACATTTTAGGGCTGGGCATGG + Intronic
1068097442 10:52509918-52509940 TTTAAGTTACAGGCTGGGCATGG + Intergenic
1068689439 10:59900766-59900788 TTTCAGCTTTTGGCTGGGCATGG + Intronic
1069050598 10:63788566-63788588 TTTCAGTGTTTGGCTGGGCTCGG + Intergenic
1069113546 10:64475973-64475995 TTACAGATTTGAGCTGGGCATGG + Intergenic
1069211775 10:65770591-65770613 TTACAATTTATGGCTGGGCACGG + Intergenic
1069459243 10:68578832-68578854 TTAAATTTTGGGGCTGGGCATGG - Intronic
1070057345 10:72948164-72948186 TTTCACTCTCTGGCTGGGCAAGG - Intronic
1070246790 10:74739693-74739715 TTTAAAGTTGGGGCTGGGCACGG + Intergenic
1070250555 10:74769434-74769456 TTTCCCTTTTGGGCTGGGCACGG + Intergenic
1070517608 10:77222937-77222959 TTTTAATTTGGGGCTGGGCGTGG + Intronic
1070604696 10:77890524-77890546 TTACACTTTACGGCCGGGCACGG + Intronic
1070831968 10:79423258-79423280 TTTTATTTTCTGGCTGGGCATGG + Intronic
1071194570 10:83142864-83142886 TGTAAGTTCAAGGCTGGGCAAGG - Intergenic
1072088621 10:92105054-92105076 TTGTGGTTTGGGGCTGGGCACGG - Intronic
1072125433 10:92441524-92441546 TTTCAGTTGGAGGCTGGGCGTGG + Intergenic
1072231766 10:93419839-93419861 TTTAATTTTAAGGCTGGGCATGG + Intronic
1072597713 10:96890374-96890396 AATCAGTTTTAGGCTGGGCAGGG - Intronic
1073032519 10:100538538-100538560 TTTCCTATTAAGGCTGGGCATGG + Intronic
1073084437 10:100879279-100879301 TACCAGATTAGGGCTTGGCATGG - Intergenic
1073145394 10:101277601-101277623 ATTCACTTAAGGGCTGGGTATGG - Intergenic
1074234866 10:111574819-111574841 GTTAATTTTTGGGCTGGGCACGG - Intergenic
1074572844 10:114640234-114640256 AAACAGTTGAGGGCTGGGCACGG + Intronic
1074745447 10:116527957-116527979 TTCCAGGTTAGGGCTGGGTTAGG + Intergenic
1075117122 10:119636311-119636333 TGTCAATCTTGGGCTGGGCACGG + Intergenic
1075326302 10:121534683-121534705 TGCCATTTTGGGGCTGGGCATGG - Intronic
1075499694 10:122961726-122961748 TTTAAGATTCAGGCTGGGCATGG + Intronic
1075760806 10:124854935-124854957 GTGCAGTTGAGGGCTGGGCAAGG - Intergenic
1075772638 10:124952898-124952920 TATTTGTTTAGGGCTGGGCGTGG - Intronic
1076523373 10:131094879-131094901 TCTCAGTTAGGGGCTGGACAGGG + Intronic
1077645452 11:3919493-3919515 ACTCAGTTTCAGGCTGGGCATGG - Intronic
1077726150 11:4676855-4676877 TTTAAGCTTGGGGCTGGGCACGG + Intergenic
1078625134 11:12948443-12948465 TTTCAGTTGAGGCCTTGACATGG + Intergenic
1081203420 11:40246262-40246284 TAGGACTTTAGGGCTGGGCATGG - Intronic
1081821486 11:46000627-46000649 TATAAATTTATGGCTGGGCATGG + Intronic
1082052714 11:47785419-47785441 TTTCCTTGTAAGGCTGGGCATGG - Intronic
1082747543 11:56981446-56981468 TCTCAGCACAGGGCTGGGCATGG - Intergenic
1082750522 11:57010186-57010208 TCTCAGCACAGGGCTGGGCATGG - Intergenic
1083182642 11:60997083-60997105 TTTAAATTTTTGGCTGGGCATGG + Intronic
1083995200 11:66268324-66268346 GCTCAATTTAGGGCTGGGCTTGG - Intergenic
1084181171 11:67447049-67447071 TTATGGTTTAGGGCCGGGCATGG + Intergenic
1085367522 11:75964610-75964632 TATCAGTTTAGGGCTGGGCGTGG + Intronic
1085575553 11:77599572-77599594 ACACAGTTTGGGGCTGGGCATGG - Intronic
1086926535 11:92646674-92646696 TTTGAGTTTTGGGCTGAGCCTGG + Intronic
1086951286 11:92892699-92892721 GCACAGTTTTGGGCTGGGCACGG - Exonic
1088255859 11:107903055-107903077 TTTCCGTTTGAGGCTGGGCGCGG - Intronic
1088660035 11:112036079-112036101 TATATGTTTAAGGCTGGGCACGG - Intronic
1089155100 11:116395771-116395793 ATTCAGCTGAGGGCTGGGCGTGG + Intergenic
1089488299 11:118864268-118864290 GTTCAGTTTTGGGCTGGGCATGG - Intergenic
1089913325 11:122126025-122126047 TAATAATTTAGGGCTGGGCATGG - Intergenic
1089924582 11:122244104-122244126 ATTCATTTTTGGGCTGGGCCTGG + Intergenic
1090204914 11:124878749-124878771 TGTCAGTTGGGGGCTGGGGAGGG - Exonic
1090415205 11:126535692-126535714 TTTTGGTTGAGGGCTGGGCCCGG + Intronic
1091478764 12:804661-804683 TTTCGGTTTGGGGCCAGGCACGG - Intronic
1092001480 12:5036071-5036093 TTTCAGCATTGGGCTGGGGAGGG + Intergenic
1092140048 12:6177676-6177698 GTGCAGGTCAGGGCTGGGCACGG - Intergenic
1092349243 12:7742220-7742242 TATGACTTTACGGCTGGGCATGG + Intronic
1092363605 12:7858787-7858809 TTAAAATTTGGGGCTGGGCAGGG - Intronic
1092801675 12:12174399-12174421 CTTCAGTTTGAGGCTGGGCACGG - Intronic
1093174239 12:15894167-15894189 TTACAATTTAAGGCCGGGCATGG + Intronic
1094097286 12:26721017-26721039 ATTCAGTGGAGGGCTGGGGATGG + Intronic
1094144709 12:27216051-27216073 TTACATTTGTGGGCTGGGCATGG + Intergenic
1094578771 12:31713548-31713570 TTTCTGATTAAGGCTGAGCATGG + Intronic
1094587024 12:31786954-31786976 ATTCTGTTTAAGGCCGGGCATGG - Intergenic
1094663530 12:32495404-32495426 TTGCTTTTCAGGGCTGGGCACGG + Intronic
1095201675 12:39392026-39392048 TTGCAGTTTAAGGCTGGGTGCGG - Intronic
1095538361 12:43278825-43278847 ATTAATTTGAGGGCTGGGCACGG + Intergenic
1095658277 12:44697246-44697268 TTTCAGTTCAGGGTTGGTGATGG + Intronic
1096310389 12:50515516-50515538 CCACAGTGTAGGGCTGGGCATGG - Intronic
1096318420 12:50589467-50589489 TTTAAATTAATGGCTGGGCATGG - Intronic
1096340952 12:50798597-50798619 TCTCAGGTTCAGGCTGGGCATGG - Intronic
1096985271 12:55752005-55752027 TTTCAGTAGAGGAATGGGCAGGG + Exonic
1096989798 12:55791163-55791185 TGGCTGCTTAGGGCTGGGCAGGG + Intronic
1097111162 12:56659337-56659359 TTTAGGATTGGGGCTGGGCAGGG + Intergenic
1097215967 12:57413301-57413323 ATTCAGGTTAAGGCTAGGCATGG + Intronic
1097690205 12:62727949-62727971 TTGCATTTTAAGGCTGGGCGTGG - Intronic
1097914217 12:65003147-65003169 CTTCAATCTCGGGCTGGGCATGG + Intergenic
1098141845 12:67457820-67457842 TTTTTCCTTAGGGCTGGGCAGGG - Intergenic
1098160940 12:67648347-67648369 TTTATGTTTAGGGGTGCGCATGG + Intronic
1098430461 12:70413941-70413963 TTTAAGTTTTGGGCTGGGTGCGG + Intronic
1098903666 12:76139404-76139426 TTTTATTTATGGGCTGGGCATGG - Intergenic
1099275669 12:80573197-80573219 TTTTACTTTAGGGCCGGGCGCGG + Intronic
1099785380 12:87256170-87256192 ACACATTTTAGGGCTGGGCACGG + Intergenic
1100102662 12:91127766-91127788 GTTGAGTTTGGGGCGGGGCAGGG - Intergenic
1100562464 12:95761621-95761643 TATCTCTTTTGGGCTGGGCACGG - Intronic
1100680053 12:96908884-96908906 TTTCAGATAGTGGCTGGGCACGG + Intronic
1100854798 12:98749395-98749417 TCTAAGTTTTGGGCCGGGCACGG - Intronic
1101380909 12:104213277-104213299 ATTTACTTTAGGGCCGGGCACGG + Intergenic
1102501112 12:113353218-113353240 TTTAAGATTCAGGCTGGGCATGG + Intronic
1102746816 12:115256217-115256239 ATGGACTTTAGGGCTGGGCATGG + Intergenic
1103660559 12:122512094-122512116 ATTCATTTTTGGGCTGGGCATGG - Intronic
1103865781 12:124050937-124050959 ATTTATTTTTGGGCTGGGCATGG + Intronic
1105463040 13:20609464-20609486 AGTCAGTTTAGGGCTGGGTGCGG + Intronic
1105962315 13:25353463-25353485 TTACAGCTAAAGGCTGGGCACGG - Intergenic
1106327799 13:28710520-28710542 TTTCTTCTTAGGGCGGGGCACGG + Intronic
1106972230 13:35155331-35155353 AGTCTCTTTAGGGCTGGGCATGG + Intronic
1106994578 13:35466757-35466779 TTTTTTTTTAGGGCTGGGCATGG - Intronic
1107471422 13:40694999-40695021 GTTCAGCTTCAGGCTGGGCATGG - Intergenic
1107850569 13:44568625-44568647 TTGCAGTGTGGGGCTGGCCATGG - Intronic
1108593401 13:51930093-51930115 TTTCCTTTTGGGGCTGGGGAGGG + Intergenic
1108845000 13:54667255-54667277 ATTCATTTTATAGCTGGGCACGG - Intergenic
1109485922 13:63019294-63019316 TTTCTGTTAAGGGCTGGCTAGGG - Intergenic
1109964476 13:69673695-69673717 ATTCAATTTACGGCTGGGCGCGG + Intergenic
1110199089 13:72827537-72827559 TCTCTTTTTGGGGCTGGGCATGG - Intronic
1110227611 13:73136151-73136173 TTTAATATTTGGGCTGGGCATGG + Intergenic
1111466828 13:88624183-88624205 TTGCAGTTATGGGCTGGGCGTGG + Intergenic
1111560998 13:89946289-89946311 TTAAATTTTAGGGCTGGGCGCGG - Intergenic
1112446679 13:99470800-99470822 TTAAATTTTAGGGCTGGGCATGG + Intergenic
1112500124 13:99936499-99936521 AGACAGTTTGGGGCTGGGCATGG + Intergenic
1113212612 13:108001220-108001242 TTGAGGTTTGGGGCTGGGCATGG + Intergenic
1114446608 14:22793519-22793541 TTATGGTTTAGGGCTGGGCACGG + Intronic
1114505868 14:23212794-23212816 TTTAAATTTCTGGCTGGGCATGG - Intronic
1114642380 14:24232273-24232295 TTCCAGTTTGGGGCTGCACACGG + Exonic
1114725510 14:24932116-24932138 ATTTAGATTTGGGCTGGGCACGG + Intronic
1115561257 14:34585140-34585162 CTTGGGTTGAGGGCTGGGCATGG - Intronic
1115655308 14:35438217-35438239 TTTGTTTTTTGGGCTGGGCACGG + Intergenic
1116507621 14:45704156-45704178 TTACATTTTAGGGCCGGGCGCGG - Intergenic
1116836313 14:49771706-49771728 ATTCAGATAAGGGCTGGGCACGG + Intronic
1117059882 14:51951327-51951349 TGTCAGGTTAGGTCTGGGGAGGG - Intronic
1117779459 14:59217544-59217566 TTAAAGTTAAGGGCTAGGCATGG + Intronic
1117798293 14:59417123-59417145 TTTCAGTCTAGTGCTCGGGATGG + Intergenic
1117817015 14:59608992-59609014 ATTCATTTCTGGGCTGGGCATGG + Intronic
1118053242 14:62051746-62051768 ATGCAGTTTTTGGCTGGGCATGG + Intronic
1118191246 14:63582614-63582636 TTTTAATTGTGGGCTGGGCACGG - Intergenic
1118978534 14:70698096-70698118 TTTGAGGTGAGGGCTAGGCAGGG + Intergenic
1119009025 14:70964355-70964377 TATCAATCTAAGGCTGGGCATGG - Intronic
1119136798 14:72228753-72228775 TTCTAGTTCGGGGCTGGGCACGG + Intronic
1119228618 14:72962811-72962833 TTTCAGTTTATTGGTGGCCAAGG + Intergenic
1119313065 14:73667169-73667191 TTTAATTTTATGGCTGGGGACGG + Intronic
1120819467 14:88898858-88898880 TGTCTATTTTGGGCTGGGCATGG + Intergenic
1121502353 14:94448373-94448395 TTCGAGTTTGGGGCTGGGCAGGG + Exonic
1122336694 14:100994392-100994414 ATTCAGTTATCGGCTGGGCACGG + Intergenic
1122590383 14:102845490-102845512 TTTTATTTTTAGGCTGGGCACGG - Intronic
1122665371 14:103326224-103326246 TTTTAGTTTTTGGCTGGGCACGG - Intergenic
1122728869 14:103780193-103780215 TTGCATTTTAGGGCCAGGCATGG + Intronic
1122752883 14:103952056-103952078 TTTCCTTTTATGGCTGGGCATGG - Intronic
1122841244 14:104464682-104464704 TTGAAAGTTAGGGCTGGGCATGG - Intergenic
1122927542 14:104913170-104913192 AATCAATTTAGTGCTGGGCATGG - Intergenic
1122996989 14:105270463-105270485 TTTGAAATTTGGGCTGGGCATGG - Intronic
1123703993 15:22937892-22937914 TTTTAGTTTGTGACTGGGCACGG - Intronic
1123810243 15:23917732-23917754 GTTAAGTTGGGGGCTGGGCATGG - Intergenic
1125026370 15:35033912-35033934 ATACAGTTTTGGGCTGGGCGCGG + Intergenic
1125302431 15:38270195-38270217 TTCCAGATTTGGGCTGGGCATGG - Intronic
1125434186 15:39627895-39627917 TTCCAAGTCAGGGCTGGGCAGGG + Intronic
1125585697 15:40817900-40817922 AGTGTGTTTAGGGCTGGGCATGG - Intronic
1126025931 15:44446212-44446234 TGTAAGTTTATGGCAGGGCATGG - Intronic
1126083173 15:44985507-44985529 ATTCTGTTTTTGGCTGGGCACGG - Intergenic
1126482465 15:49141209-49141231 TTACAGTTTTTGGCTGGGCTTGG + Intronic
1126597909 15:50400066-50400088 TGTCAGTATTTGGCTGGGCATGG - Intergenic
1126759188 15:51953805-51953827 TGTCAATTTGTGGCTGGGCACGG + Intronic
1127249129 15:57211661-57211683 ATACAATTTAAGGCTGGGCATGG + Intronic
1127276021 15:57444830-57444852 TTTCCATTTCGGGCTGGGAAGGG + Intronic
1127696297 15:61451222-61451244 ATTCAATTCAGGGCTGGGCGTGG - Intergenic
1127904794 15:63368638-63368660 ATTCAGGTGAGGGCAGGGCATGG - Intronic
1127923667 15:63516758-63516780 TTTCAAAATATGGCTGGGCATGG + Intronic
1128175076 15:65548217-65548239 TTTAAAATTATGGCTGGGCATGG + Intronic
1128178651 15:65580499-65580521 CTTCAGTTTAGGGAGGGGCCTGG + Intronic
1128811069 15:70573139-70573161 TTTCAGTGTGGAGGTGGGCAGGG + Intergenic
1129252884 15:74318493-74318515 TTCCAGCTCAGGGCTGGGCTTGG + Intronic
1129305029 15:74653960-74653982 CTGCAGTGTAGGGCTGGGCGCGG + Intronic
1129718923 15:77867090-77867112 TTTCAGCTTAGGGCAGGCCCAGG - Intergenic
1129835155 15:78699640-78699662 GATCAATTCAGGGCTGGGCACGG - Intronic
1130201584 15:81833859-81833881 TTTTTGTTTAGGACTGGACAAGG + Intergenic
1130288874 15:82579111-82579133 TGTAATTTTAAGGCTGGGCATGG - Intronic
1130937985 15:88486270-88486292 CTTTAATTTAAGGCTGGGCATGG - Intergenic
1130976627 15:88781495-88781517 TTAGTGTTCAGGGCTGGGCATGG + Intergenic
1131148577 15:90032485-90032507 TGTGTGTTTGGGGCTGGGCACGG + Intronic
1131174167 15:90199849-90199871 TTGGAGTTAAGGGCTGAGCAGGG + Intronic
1132712031 16:1273138-1273160 TTTTAGTGGAGGGCTGGGCTGGG + Intergenic
1133533509 16:6676964-6676986 GTTGAGTTAACGGCTGGGCATGG - Intronic
1133719135 16:8478156-8478178 ATCTAGTTGAGGGCTGGGCATGG - Intergenic
1134110404 16:11511996-11512018 CTTAAGTTGAAGGCTGGGCACGG + Intronic
1134139670 16:11707134-11707156 TGTCAGTTTAGGGCTGGATGCGG + Intronic
1135085550 16:19472049-19472071 GTCAAGTTTATGGCTGGGCATGG - Intronic
1135393712 16:22115095-22115117 TTTCTGTAGAGGGCCGGGCATGG - Intronic
1136176329 16:28519513-28519535 TTTCAGTTCTGGGCTGGGTGCGG - Intergenic
1136289611 16:29263594-29263616 TTTTATTTTTGGGCTGGGCACGG + Intergenic
1136471126 16:30481009-30481031 GTAGAGTTTGGGGCTGGGCACGG + Intronic
1136509289 16:30725913-30725935 GTACAGTTTAGGGCCAGGCATGG - Intronic
1137295355 16:47087312-47087334 TGTAATTATAGGGCTGGGCACGG - Intronic
1137369083 16:47887851-47887873 TTTCAGTTTACCCCTGGGAAAGG + Intergenic
1137648757 16:50099732-50099754 TTTCAGTTTAAGGCTGGGCGCGG - Intronic
1137727984 16:50669936-50669958 TTTCAATTGTGGGCTTGGCAGGG + Intronic
1138171894 16:54859345-54859367 CTTTAATTTTGGGCTGGGCACGG + Intergenic
1138757725 16:59509075-59509097 ATTCACATAAGGGCTGGGCATGG + Intergenic
1139202787 16:64996197-64996219 TTACAATTCAAGGCTGGGCACGG + Intronic
1139454739 16:67064493-67064515 CATAATTTTAGGGCTGGGCACGG - Intronic
1139498780 16:67343269-67343291 AATCAAATTAGGGCTGGGCACGG + Intronic
1139543412 16:67635914-67635936 AATCAATTTAAGGCTGGGCACGG - Intronic
1139661967 16:68427290-68427312 CCTTAGTTTAAGGCTGGGCATGG - Intronic
1139807426 16:69580235-69580257 TAAAAGTTTAGGGCTGGGCATGG + Intronic
1140296727 16:73716175-73716197 TTGCAGTTTAGGGGAGGGAATGG + Intergenic
1140398330 16:74648443-74648465 TTTGGGTTTTTGGCTGGGCACGG - Intronic
1140458478 16:75118488-75118510 TTTCTGATTGGCGCTGGGCACGG - Intergenic
1140487178 16:75302903-75302925 TTTTTTTTTAGGGCTGGGCGTGG + Intronic
1140793041 16:78410517-78410539 TGTCAGCTGGGGGCTGGGCATGG + Intronic
1140906644 16:79415053-79415075 TTTGAGGTTAAGCCTGGGCATGG - Intergenic
1141001484 16:80312498-80312520 TTTTATTTTGGGGCTGGGCATGG - Intergenic
1141105983 16:81234191-81234213 TATCAGGTTTTGGCTGGGCATGG - Intergenic
1141134072 16:81454462-81454484 TTTCAGTTTAGTGTTTGCCAAGG + Intronic
1141470253 16:84233410-84233432 TTGAAAGTTAGGGCTGGGCACGG + Intronic
1141495300 16:84405627-84405649 TTTCAATTTCAGGCTGGGCGTGG + Intronic
1141952759 16:87349424-87349446 TTTCAGCTGCAGGCTGGGCATGG + Intronic
1142095345 16:88236574-88236596 TTTTATTTTTGGGCTGGGCGCGG + Intergenic
1142394602 16:89824875-89824897 TTAAAAGTTAGGGCTGGGCACGG - Intronic
1142621008 17:1165821-1165843 TTTCGTTTTGGGGCTGGACATGG - Intronic
1142695584 17:1631075-1631097 TTCCAGTTCCTGGCTGGGCACGG + Intergenic
1143687648 17:8531679-8531701 ATAGAGTTTATGGCTGGGCACGG - Intronic
1144008067 17:11119177-11119199 ATTCACTATAGGGCTGGGCGCGG + Intergenic
1144323707 17:14156516-14156538 TTTCAGATTTAGGCCGGGCACGG - Intronic
1144561475 17:16323905-16323927 TATCAGCTTTGGGCAGGGCACGG - Intronic
1144696966 17:17311044-17311066 TTTTAGTTTTGGGCCGGGCGCGG + Intronic
1144702746 17:17349469-17349491 GTTGAGTCTAGGGCAGGGCAGGG + Intergenic
1145053188 17:19680185-19680207 TATCATTTTAAGGCTGGGCATGG + Intronic
1145228121 17:21148203-21148225 TTATTTTTTAGGGCTGGGCATGG - Intronic
1145244746 17:21261194-21261216 GTACTGTTTATGGCTGGGCATGG + Intergenic
1145878906 17:28340015-28340037 TTTCTGTGTTGGGCTGGGCCTGG + Intronic
1145939046 17:28732161-28732183 TTGCATTCTGGGGCTGGGCATGG + Intronic
1145983703 17:29030105-29030127 TTTCTGTTTTTGGCCGGGCACGG - Intronic
1146080600 17:29776919-29776941 TTTAAATTCATGGCTGGGCATGG + Intronic
1146224224 17:31051887-31051909 TTTGAGTGTATGGCTAGGCAGGG - Intergenic
1146234914 17:31150172-31150194 TTTCAGATTAGGGATGATCACGG - Intronic
1146507939 17:33421664-33421686 TTTCAGTTTATGGTAGGGCCAGG + Intronic
1146707803 17:35014383-35014405 TTTCAGTTCTGGTCTGGGTAGGG - Intronic
1146822113 17:35991951-35991973 TGTCAGTCCAGGGCCGGGCACGG - Intronic
1147205405 17:38833929-38833951 TTTCAGTTTATTGGTGGCCAAGG - Intergenic
1147464707 17:40602232-40602254 TTTCAGGAGAGGGCTGGGCATGG + Intergenic
1147934517 17:44004285-44004307 TTTGAGCACAGGGCTGGGCAGGG - Intronic
1147969532 17:44212149-44212171 TCTCAGGCTAGGGCAGGGCAGGG - Intronic
1148277107 17:46314611-46314633 TTTCATTTATTGGCTGGGCATGG - Intronic
1148299223 17:46532187-46532209 TTTCATTTATTGGCTGGGCATGG - Intronic
1148492077 17:48029676-48029698 TTTTTTTTTAAGGCTGGGCACGG + Intronic
1149751310 17:59148128-59148150 TTTCTTTTTTTGGCTGGGCATGG - Intronic
1150065190 17:62103050-62103072 TTGAATCTTAGGGCTGGGCACGG + Intergenic
1150337093 17:64338368-64338390 TCTGCTTTTAGGGCTGGGCATGG - Intronic
1150762097 17:67971513-67971535 TTACACTTTAGGGCCGGGCACGG + Intronic
1152003374 17:77661583-77661605 TTTAATTCTTGGGCTGGGCATGG + Intergenic
1152173852 17:78773121-78773143 GTTCAGTTTCAGGCTGGGCATGG - Intronic
1152185216 17:78851875-78851897 TTTTATTTTTTGGCTGGGCACGG + Intergenic
1153026154 18:674808-674830 TATTAATTCAGGGCTGGGCATGG - Intronic
1153264568 18:3257292-3257314 TCAGAGTTTTGGGCTGGGCATGG - Intergenic
1153356975 18:4148020-4148042 TTTCTGTTTCTGGTTGGGCACGG + Intronic
1153567832 18:6437328-6437350 TATCACTTAAGGGCTGGGCGCGG - Intergenic
1153616887 18:6943556-6943578 ATTCAGATGATGGCTGGGCATGG + Intronic
1154265612 18:12876168-12876190 TTCTGGTTAAGGGCTGGGCATGG + Intronic
1154476633 18:14766187-14766209 TGTCAGGTCAGGGCTGGGCATGG + Intronic
1155143262 18:23062556-23062578 ATACTGTATAGGGCTGGGCACGG + Intergenic
1155211855 18:23608839-23608861 TTACAATTTAGGGCCGGGCGCGG + Intronic
1156047517 18:32893778-32893800 TAACAGTTTACAGCTGGGCATGG - Intergenic
1156787498 18:40932859-40932881 TTTAAGTTTTGGGCCGGGCGCGG - Intergenic
1157240896 18:46008595-46008617 ATACAGCTTAAGGCTGGGCAAGG - Intronic
1157248706 18:46075107-46075129 TCTCTGTGAAGGGCTGGGCAGGG + Intergenic
1157642597 18:49232897-49232919 ATTCCGTTTCAGGCTGGGCATGG - Intronic
1157846007 18:51004682-51004704 TATCACTGTGGGGCTGGGCATGG + Intronic
1158395899 18:57078177-57078199 TGTGAGTTGTGGGCTGGGCAGGG + Intergenic
1158596184 18:58817855-58817877 TTTCTTTTTAGGGCTGAGCATGG + Intergenic
1158617635 18:59002659-59002681 TATTACTTTTGGGCTGGGCATGG - Intergenic
1159897030 18:74007066-74007088 TAAAAATTTAGGGCTGGGCATGG - Intergenic
1160746927 19:716119-716141 ACTTAGATTAGGGCTGGGCATGG + Intronic
1161135118 19:2615059-2615081 CTTCAGTGCTGGGCTGGGCAAGG + Intronic
1161335475 19:3710571-3710593 TTCCTCTTTAGGGCTGGCCAGGG + Intronic
1161833014 19:6623574-6623596 CTTCAGTCCATGGCTGGGCATGG + Intergenic
1161947006 19:7443653-7443675 TTGCAGTCTAGGTCTGGTCAGGG + Intronic
1162083836 19:8236399-8236421 TTTCTGCTTATGGCTGGGCGTGG + Intronic
1162693980 19:12457451-12457473 TTAAAGTTTTTGGCTGGGCATGG + Exonic
1163083162 19:14958118-14958140 TTGAAGTTTATGGCTGGGCATGG + Intronic
1163336758 19:16677846-16677868 TTTTATTTCCGGGCTGGGCACGG - Intronic
1163543442 19:17925903-17925925 GTCCACTTTATGGCTGGGCATGG - Intergenic
1164134136 19:22396828-22396850 TTACAGATTTAGGCTGGGCATGG + Intronic
1164135116 19:22407421-22407443 TTTCATTTCTCGGCTGGGCACGG + Intronic
1164164676 19:22659954-22659976 TTACAGATTTAGGCTGGGCATGG - Intronic
1164166562 19:22682313-22682335 TTACAGATTTAGGCTGGGCACGG - Intergenic
1164240301 19:23381748-23381770 GTTCAGTTTATGGCTGGGCGCGG - Intronic
1164682861 19:30147267-30147289 CTTCAGTTTGTGGATGGGCAAGG - Intergenic
1165119518 19:33550025-33550047 TCTCAATCCAGGGCTGGGCATGG - Intergenic
1165243451 19:34484213-34484235 ATCCAGTTCAGGGCCGGGCACGG - Intronic
1166017723 19:39995649-39995671 TGTCAATATAAGGCTGGGCACGG - Intronic
1166265574 19:41682227-41682249 ATACGGTTTAGGGCTGGGCGCGG - Intronic
1166314797 19:41983366-41983388 TTCCATATTAGGGCCGGGCAGGG - Intronic
1166357893 19:42238033-42238055 TTTTATTTTAAGGCTGGGTATGG - Intronic
1166785866 19:45366430-45366452 TATTAGTTTTGGGCTGGGCACGG - Intronic
1167001719 19:46749204-46749226 TGTCAGGTTAGGGCTGGGGAAGG + Intronic
1167274866 19:48531202-48531224 ATTGAGTTTAGGACTGGGCCTGG + Intergenic
1168157823 19:54486466-54486488 ATGAAGTTTGGGGCTGGGCATGG - Intergenic
1168433003 19:56296024-56296046 ATGCTTTTTAGGGCTGGGCAGGG + Intronic
1168442799 19:56385393-56385415 TGTTAGTGTGGGGCTGGGCATGG + Intronic
926057143 2:9780509-9780531 TTTCTGCTGAGGGCTGGGTAGGG + Intergenic
926169440 2:10542712-10542734 TTACATTTTTTGGCTGGGCATGG - Intergenic
926241901 2:11094856-11094878 TTACAGTTAGGGCCTGGGCATGG - Intergenic
926603692 2:14875327-14875349 ATACATTTCAGGGCTGGGCATGG + Intergenic
927270425 2:21203500-21203522 TATCAGTTCTAGGCTGGGCATGG + Intergenic
927335059 2:21912070-21912092 TTTCAGATTAGGCTTGGCCATGG - Intergenic
927930960 2:27043837-27043859 TGTCTGTATAGGGCCGGGCACGG - Intronic
928014856 2:27646330-27646352 TTTCAAGCTGGGGCTGGGCATGG - Intronic
928276551 2:29906007-29906029 TTGCAGTTTAGCGGTAGGCATGG - Intronic
928524095 2:32121832-32121854 AATCAGAATAGGGCTGGGCACGG - Intronic
928535996 2:32242161-32242183 TTTGATTTCTGGGCTGGGCATGG - Intronic
928565218 2:32538638-32538660 GTACAGTGTATGGCTGGGCATGG + Intronic
928891861 2:36213469-36213491 TTTAAGTTTACAGCAGGGCAAGG - Intergenic
929441606 2:41969605-41969627 TTTTATTTTGAGGCTGGGCATGG - Intergenic
929755431 2:44760347-44760369 TTTGAGGTTAGGGTTGGGGAAGG + Intronic
929893079 2:45935494-45935516 TTGCAGCTTAGGGTTGGGCACGG + Intronic
930123466 2:47778724-47778746 AGACAGTTTAGGGCCGGGCACGG + Intronic
930459369 2:51652289-51652311 TTTCTGTATAGGGTTGGGAAGGG - Intergenic
930848217 2:55928412-55928434 TTAAAGATTTGGGCTGGGCACGG + Intergenic
931446168 2:62328943-62328965 AATCAGCTTAGGGCTAGGCACGG - Intergenic
931702269 2:64918743-64918765 TTTCAGTTTAGGGTAGTGAAGGG - Intergenic
931715881 2:65028285-65028307 TTTCAGGTATGGCCTGGGCATGG - Intergenic
932059767 2:68484396-68484418 ATGCAGTTTAGGGCTGGGCACGG + Intronic
932154186 2:69400792-69400814 TATCTTTTTAAGGCTGGGCATGG + Intronic
932262660 2:70340153-70340175 TTGAAACTTAGGGCTGGGCATGG - Intergenic
932357804 2:71080966-71080988 AATCACTTTTGGGCTGGGCATGG - Intergenic
932597067 2:73100714-73100736 TTTCAGTCTGGGGCCGGGCATGG - Intronic
933700346 2:85250724-85250746 TCTCATTTTTCGGCTGGGCATGG - Intronic
933718599 2:85381825-85381847 TTTAAGATTTGGGCTGGGCGCGG + Intronic
934094690 2:88589945-88589967 TTTCAGAATTGGGCTGGGCGTGG + Intronic
935233169 2:101116929-101116951 TTTCACTTCTCGGCTGGGCATGG - Intronic
936146902 2:109986478-109986500 CTCCAGTGTCGGGCTGGGCAAGG - Intergenic
936197790 2:110385005-110385027 CTCCAGTGTCGGGCTGGGCAAGG + Intergenic
936546797 2:113397602-113397624 TTTCTGCTTCAGGCTGGGCATGG + Intergenic
936644416 2:114352022-114352044 TTCTATTTTTGGGCTGGGCATGG - Intergenic
936815505 2:116456055-116456077 TTGCAGTTCTGGGCTCGGCAGGG - Intergenic
937161872 2:119771209-119771231 ATTCAGTTGATGGCTGGGCTGGG - Intronic
938003499 2:127767421-127767443 TTTCAGTTTAAGGCCGGGCACGG + Intronic
938716370 2:134025794-134025816 TTTCAACTGAGGGCCGGGCATGG - Intergenic
938746024 2:134279043-134279065 TTTCAGTTCAGTGCTGAGCTTGG + Intronic
939114935 2:138049762-138049784 TTTACATTTTGGGCTGGGCATGG + Intergenic
939686673 2:145208804-145208826 TTTGAGTTGTAGGCTGGGCATGG + Intergenic
939858172 2:147386036-147386058 TTACAGTTTCAGGTTGGGCATGG + Intergenic
939923663 2:148147528-148147550 GTTCAGTTTGGGGCTGGGCATGG - Intronic
940350180 2:152675920-152675942 AAGCAGTTTATGGCTGGGCATGG - Intronic
940500264 2:154485276-154485298 TGACAGTTGAGGGCTGGGCGTGG + Intergenic
941268309 2:163392027-163392049 TGTCAGCTTAGGCCTGTGCAAGG + Intergenic
941586104 2:167361781-167361803 TCAGAGTTTTGGGCTGGGCACGG + Intergenic
942266715 2:174234752-174234774 GTACAGTTGAGGGCTGGGCATGG - Intronic
944799826 2:203228499-203228521 TTTAAAATTAAGGCTGGGCATGG + Intergenic
945008121 2:205431365-205431387 ATCAAGTTTCGGGCTGGGCATGG - Intronic
945087971 2:206152992-206153014 TTTCAGTTTAAAGTTGGGTATGG - Intronic
945363902 2:208927428-208927450 TATTATTTTGGGGCTGGGCATGG - Intergenic
945449649 2:209978956-209978978 TTTCTGCTTCTGGCTGGGCACGG + Intronic
945605428 2:211924010-211924032 ATTTAGGTTATGGCTGGGCATGG - Intronic
945620155 2:212126171-212126193 TTTAATTTTGTGGCTGGGCATGG + Intronic
945702663 2:213190944-213190966 TTGAAATTTAAGGCTGGGCACGG + Intergenic
945963760 2:216163590-216163612 TCTCATTTTTGGGCCGGGCACGG - Intronic
946060739 2:216939301-216939323 TTTCCTTTTAAGACTGGGCAGGG + Intergenic
946263030 2:218512214-218512236 TTTAAAATTAAGGCTGGGCACGG + Intronic
946917168 2:224535458-224535480 TTGAAGTTGAAGGCTGGGCACGG - Intronic
947511314 2:230756979-230757001 ATACAGTTAAAGGCTGGGCATGG - Intronic
947821291 2:233072926-233072948 CTTCAGTTCAGGGGTGGGAATGG - Intronic
948916358 2:241036617-241036639 TTTCACTTTAGGTCGGAGCAGGG - Intronic
1169377954 20:5082163-5082185 TTTCAGTGAATGGCTGGGCGTGG - Intronic
1169879120 20:10327896-10327918 TCTGGTTTTAGGGCTGGGCATGG - Intergenic
1170521387 20:17189491-17189513 ACTAATTTTAGGGCTGGGCACGG + Intergenic
1171216346 20:23355226-23355248 TTTGAGGATACGGCTGGGCATGG + Intergenic
1171750078 20:29040037-29040059 TTAGACTTTAGGACTGGGCATGG - Intergenic
1172281969 20:33714241-33714263 TTGGACTTTAGGGCCGGGCACGG + Intronic
1172484477 20:35290182-35290204 GCTCAGTTGAGGGCTGGGCTGGG + Intronic
1172567627 20:35943111-35943133 GCTTAGTTTAGGGCTGGGTACGG - Intronic
1172746144 20:37210896-37210918 ATTCAGTTAAGGGCCAGGCATGG + Intronic
1173866955 20:46318320-46318342 TTGCAGTATGGGGCCGGGCATGG + Intergenic
1174229130 20:49029881-49029903 ATTCACTTTTAGGCTGGGCACGG - Intronic
1174903272 20:54523274-54523296 TTTATTTTTTGGGCTGGGCATGG + Intronic
1175939049 20:62529474-62529496 TGTGTGTTTAGGGCTGGCCATGG + Intergenic
1176204468 20:63880598-63880620 TTGTATTTTTGGGCTGGGCACGG + Intronic
1176315141 21:5235875-5235897 TTAGACTTTAGGACTGGGCATGG + Intergenic
1177489351 21:21802620-21802642 TTATAGTTTAGGGCTGGGCATGG + Intergenic
1177569912 21:22874106-22874128 TATTAGTTCATGGCTGGGCATGG - Intergenic
1178448860 21:32672628-32672650 TTAAGGTTTTGGGCTGGGCACGG - Intronic
1178456116 21:32753166-32753188 TATCATTATACGGCTGGGCACGG + Intronic
1178577771 21:33810080-33810102 ATTTATTTTTGGGCTGGGCACGG - Intronic
1179156912 21:38858946-38858968 TTACATTTTAGTGATGGGCAAGG + Intergenic
1180665775 22:17510893-17510915 TTTCTGTTTCGGGCTGGGTGGGG - Intronic
1180963301 22:19772604-19772626 TTTGAGAAGAGGGCTGGGCACGG - Intronic
1182116567 22:27759925-27759947 TTTCACATTTGAGCTGGGCAAGG + Intronic
1182557096 22:31135134-31135156 TTTAGGTTTAGGGCTGGGCCAGG + Exonic
1183127950 22:35803383-35803405 TTTAAAATTAAGGCTGGGCATGG + Intronic
1183198005 22:36366716-36366738 CTTCAGTGTGGGGCTGGGCCTGG - Intronic
1183450136 22:37889339-37889361 ATTCAATTTAGGGCTGGGCACGG - Exonic
1183518415 22:38281719-38281741 TTTGCATTAAGGGCTGGGCACGG - Intergenic
1183675239 22:39295425-39295447 TTACAGTTCAGGGCCAGGCATGG + Intergenic
1183683213 22:39346855-39346877 TTTCTGTTCAGGGTTGGGCTCGG + Intergenic
1183725309 22:39585680-39585702 TTTAAGTTTACAGCTGGGCATGG - Intronic
1184021982 22:41827059-41827081 AAACAGGTTAGGGCTGGGCAGGG - Intergenic
1184051839 22:42012700-42012722 TTTGTTTTTAGGGCTGGGCACGG + Intronic
1184199103 22:42952954-42952976 TATCCTTTAAGGGCTGGGCATGG - Intronic
1184601704 22:45547688-45547710 TTTCAGTTGGGGGCCAGGCACGG - Intronic
1185239028 22:49731567-49731589 TTTTAATTTGGGGCCGGGCACGG + Intergenic
949729346 3:7090131-7090153 TATTAATTTAAGGCTGGGCACGG - Intronic
949971745 3:9413016-9413038 TTTCTATTATGGGCTGGGCATGG - Intronic
949996432 3:9620867-9620889 TTTTTGTTTGTGGCTGGGCACGG + Intergenic
950018233 3:9769007-9769029 TTTGAGTTCAGGGCTGTGGAGGG - Intronic
950245337 3:11411333-11411355 TTTCTTATCAGGGCTGGGCACGG + Intronic
950873664 3:16250900-16250922 TTTAAATTCAGGGCTGAGCACGG + Intergenic
950950419 3:16992708-16992730 TTCCAGCCAAGGGCTGGGCAAGG + Intronic
950950673 3:16995109-16995131 TTCCAGCCAAGGGCTGGGCAAGG + Intronic
950974573 3:17226994-17227016 TTTCTGTTTAGCACTGGGGAGGG + Intronic
951223861 3:20097937-20097959 TTTCAGTCTTAGTCTGGGCACGG + Intronic
953443951 3:42946481-42946503 AGTCAGTTTATGGCTGGGCATGG + Intronic
953554393 3:43931955-43931977 TTGCATTATGGGGCTGGGCACGG + Intergenic
953564885 3:44022802-44022824 TTTCAGTTTAGGGATGATTATGG + Intergenic
953920996 3:46951488-46951510 AATCATTTTAGGGCTGGGCACGG + Intronic
954217994 3:49135017-49135039 TTTAAGGTTAGGGCTGGGTCAGG - Intergenic
954276877 3:49547987-49548009 ATTCCTTTTAAGGCTGGGCAAGG - Intergenic
954323345 3:49846888-49846910 TTATAAATTAGGGCTGGGCACGG + Intronic
954600757 3:51866170-51866192 TATAAATTTAGGGCCGGGCATGG + Intergenic
954643017 3:52113410-52113432 CTGTAGTTTGGGGCTGGGCACGG + Intronic
954710294 3:52502086-52502108 TGCCAGGTAAGGGCTGGGCAAGG + Exonic
954996854 3:54889583-54889605 ATCAGGTTTAGGGCTGGGCATGG + Intronic
955045189 3:55352995-55353017 TTGGAGTTTACAGCTGGGCAAGG - Intergenic
955195857 3:56804173-56804195 GATCATTTTAGGGCTGGGCATGG - Intronic
955250129 3:57272887-57272909 TTTCATTTTAGGGCCGGGCACGG - Exonic
955289411 3:57677112-57677134 TAACAGTTTGAGGCTGGGCACGG - Intronic
956095374 3:65710565-65710587 TGTAAGGTTAAGGCTGGGCACGG - Intronic
956629396 3:71300373-71300395 TTTCACTTTGGGGAGGGGCAGGG + Intronic
957234056 3:77561811-77561833 TTTCTTTTTCTGGCTGGGCACGG + Intronic
957857444 3:85895998-85896020 GTTGAGGTTAAGGCTGGGCATGG + Intronic
958268015 3:91462731-91462753 ATACATTTTGGGGCTGGGCATGG - Intergenic
958725283 3:97897928-97897950 TGAAAGTTTTGGGCTGGGCACGG + Intronic
959808376 3:110586953-110586975 ATTGAGTTCAGGGCTGGGCGTGG - Intergenic
960088698 3:113616976-113616998 TTTCATTATTGGGCAGGGCACGG - Intronic
960117979 3:113916856-113916878 TTTTATTTTGGGGCTGGGTATGG + Intronic
960119921 3:113937712-113937734 TGTCAGTTGAGGGCTGGGTGCGG + Intronic
961853557 3:129846161-129846183 ATTCTCTTTTGGGCTGGGCATGG + Intronic
962588822 3:136868204-136868226 TTACAATGTAAGGCTGGGCATGG - Intronic
962916357 3:139907523-139907545 AATGAGTTTATGGCTGGGCACGG - Intergenic
963110723 3:141685793-141685815 TTGGATTTAAGGGCTGGGCACGG - Intergenic
963184818 3:142402471-142402493 AGTCTGTTTATGGCTGGGCATGG - Intronic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
963898078 3:150706979-150707001 TGGCAGTTTCTGGCTGGGCATGG - Intergenic
964058346 3:152489189-152489211 ATGAAGTTTCGGGCTGGGCATGG + Intergenic
964538102 3:157747740-157747762 TCTCAGGATAGGGCAGGGCATGG - Intergenic
965608083 3:170516425-170516447 TTTAAATTTAGGGGTGGGCCAGG + Intronic
966995495 3:185276038-185276060 AAGCAGTTTGGGGCTGGGCATGG - Intronic
968781488 4:2585633-2585655 TTTAAATTTTAGGCTGGGCATGG + Intronic
970305769 4:14730681-14730703 TTTCTGTTTAGGTCTAAGCACGG - Intergenic
970455627 4:16221022-16221044 TCACAGTTGACGGCTGGGCACGG - Intronic
970579430 4:17461305-17461327 TTATAGTTTAGGGCCGGGCATGG - Intronic
971020133 4:22526815-22526837 TTTTAATTTAAGGCTGGGCGCGG + Intergenic
971210562 4:24611950-24611972 TTTAAGTTTTTGGCTGGGCGTGG + Intergenic
972199650 4:36699317-36699339 TTCTAGATTAGGGCTGGGCTTGG - Intergenic
972407000 4:38756386-38756408 TCTCAGGTTGGGGCTGGGCGCGG - Intergenic
972516607 4:39815467-39815489 CTCCAGTTTCGGGCTGGGCGCGG - Intergenic
972556317 4:40184663-40184685 ATTGAGATTTGGGCTGGGCATGG + Intergenic
972697100 4:41458425-41458447 GTTCAGTTTGGGTTTGGGCAAGG + Intronic
972946426 4:44262214-44262236 TTTCAGTAGAGGGATGGGGAAGG + Intronic
973623084 4:52746936-52746958 TTCCAGCTGAGGGCCGGGCACGG + Intronic
974004590 4:56543400-56543422 ATAAAGTTTAGGGCTGGGCATGG + Intronic
975155036 4:71061908-71061930 TTTCAGCTATTGGCTGGGCATGG + Intergenic
975291040 4:72678480-72678502 TGCCAGTTTGGGGCTGGGCCTGG + Intergenic
975547957 4:75579979-75580001 ATACAGTTAGGGGCTGGGCATGG + Intronic
976176817 4:82362888-82362910 TTAGAGTTTGGGGCTGGGTATGG - Intronic
976564274 4:86535609-86535631 TTTCAGTGTAGTCTTGGGCAGGG - Intronic
976615525 4:87072071-87072093 TTTAAATTCAGGGCTGGGCGTGG + Intronic
976922431 4:90456155-90456177 TTTAAGTTCAGGGGTGGGGAAGG + Intronic
977583132 4:98746621-98746643 TTTGAGAGTTGGGCTGGGCACGG - Intergenic
977810666 4:101351728-101351750 CTTCTGATTATGGCTGGGCATGG + Intergenic
977851980 4:101841114-101841136 TTTTAATTTTAGGCTGGGCACGG - Intronic
978218811 4:106243974-106243996 TTTTAATTTTAGGCTGGGCATGG - Intronic
978497329 4:109374522-109374544 TTTCAGAGGAGGGTTGGGCAAGG - Intergenic
978946515 4:114505482-114505504 TTTTAGTTTTGGGCCGGGCGTGG + Intergenic
979304564 4:119127472-119127494 GTACAGTTTTGGGCCGGGCACGG - Intergenic
979548239 4:121961551-121961573 TCTCAAGATAGGGCTGGGCATGG + Intergenic
979712889 4:123801770-123801792 CTTCTGTTATGGGCTGGGCATGG + Intergenic
979893357 4:126129033-126129055 TCTCAGTCTAGGGATGGGCTTGG + Intergenic
980087762 4:128409555-128409577 ATTCAGGTTTTGGCTGGGCACGG + Intergenic
981874056 4:149519712-149519734 ATCCTGTTTTGGGCTGGGCATGG + Intergenic
981896751 4:149810738-149810760 TATATGTTTTGGGCTGGGCATGG - Intergenic
982593570 4:157348527-157348549 TTTCATTTTTGGGCTGGGTGAGG - Intronic
982803242 4:159731119-159731141 TATCCACTTAGGGCTGGGCACGG + Intergenic
983224117 4:165070196-165070218 TTTCAAATTGGGGCGGGGCATGG - Intergenic
983291470 4:165812141-165812163 TTTAAATGCAGGGCTGGGCATGG - Intergenic
983473778 4:168189629-168189651 CTGCACTTTAGGGTTGGGCATGG + Intergenic
983587620 4:169372573-169372595 TTTAATTTAGGGGCTGGGCATGG - Intergenic
984835292 4:184014023-184014045 TTTCATGTCAGGGCTGGGCATGG - Intronic
984868858 4:184309753-184309775 AGTCACTATAGGGCTGGGCAAGG + Intergenic
985431990 4:189889689-189889711 TTAGACTTTAGGACTGGGCATGG - Intergenic
987069195 5:14319989-14320011 TTCCAATTTAGAGCTGGGCGGGG + Intronic
987281302 5:16416483-16416505 TTGAAATTTAGGGCCGGGCATGG + Intergenic
987364845 5:17139958-17139980 TTTCAACTTCAGGCTGGGCATGG - Intronic
987727360 5:21719270-21719292 TTTAAGTTTAGAACTGGGCCAGG + Intergenic
988309884 5:29543413-29543435 TTTCAGTTTATTCCTGGGCCTGG + Intergenic
988565734 5:32319044-32319066 TTGAAATCTAGGGCTGGGCATGG - Intergenic
989047436 5:37286401-37286423 GTTCGGGTTATGGCTGGGCACGG - Intergenic
989238762 5:39179767-39179789 TTTAAGTGCAGGGCTGGGCGTGG - Intronic
989481918 5:41940550-41940572 ATGTATTTTAGGGCTGGGCACGG - Intronic
989549815 5:42721212-42721234 ATGATGTTTAGGGCTGGGCACGG - Exonic
990258182 5:53993317-53993339 ATGCAGTTTTGGGCTGGGCATGG + Intronic
990264549 5:54061317-54061339 TTGAAGTTTGGGGCTGGACATGG + Intronic
990302809 5:54465797-54465819 ATTTAGTTTTGGGCTGGGCACGG + Intergenic
990591125 5:57266192-57266214 TTTAACTATGGGGCTGGGCATGG + Intergenic
990784213 5:59401152-59401174 TTCATGTTTATGGCTGGGCATGG + Intronic
991176118 5:63689298-63689320 TTCCAGTTTAGTTCTGTGCAGGG + Intergenic
991721524 5:69498201-69498223 ATTCAGTTTATGGCTGGGCATGG + Intronic
991723067 5:69511732-69511754 TTTTAGTTTTGGGCCGGGCATGG + Intronic
992133786 5:73721726-73721748 AGCTAGTTTAGGGCTGGGCATGG - Intronic
992292738 5:75296404-75296426 TTATATTTTTGGGCTGGGCATGG + Intergenic
992695963 5:79287488-79287510 AGTCAGTTAAAGGCTGGGCATGG + Intronic
992709296 5:79433272-79433294 TTTAAGATCAGGGCTGGGCGTGG + Intronic
993648542 5:90489555-90489577 TTTCAGTATTAGGCCGGGCATGG - Intronic
993999409 5:94760973-94760995 TTTTGTTATAGGGCTGGGCATGG - Intronic
994460359 5:100063323-100063345 TTAAAAATTAGGGCTGGGCATGG + Intergenic
994484503 5:100376736-100376758 TTAAAAATTAGGGCTGGGCATGG + Intergenic
996046949 5:118884714-118884736 TTCCAGGTTGGGGCTGGGCGTGG + Intronic
996048033 5:118898153-118898175 TTTAATTTTTTGGCTGGGCATGG - Intronic
996418073 5:123231279-123231301 ATTCATTTTCTGGCTGGGCATGG + Intergenic
996479347 5:123956710-123956732 ATTCAGATTTGGGCCGGGCATGG + Intergenic
997370273 5:133355365-133355387 GTCTAGTTTTGGGCTGGGCATGG + Intronic
997535069 5:134614014-134614036 TTTCCATTTCAGGCTGGGCATGG + Intronic
997705580 5:135948963-135948985 TTTAAATTTTCGGCTGGGCACGG - Intronic
997883714 5:137612704-137612726 TCCCAGAATAGGGCTGGGCAGGG - Intergenic
998542252 5:142993593-142993615 AATGAATTTAGGGCTGGGCATGG - Intronic
998836825 5:146210655-146210677 TTTCTGTTTATAGCCGGGCACGG + Intronic
1000594855 5:163203023-163203045 TTCCAGTTAAGGGCTTGGCGTGG - Intergenic
1000629256 5:163573295-163573317 TATTTGTTTAAGGCTGGGCATGG + Intergenic
1001567540 5:172709734-172709756 TTTCATCCAAGGGCTGGGCATGG - Intergenic
1001723493 5:173876458-173876480 TTTCTATTTACGGCTGGGCACGG - Intergenic
1002144273 5:177166255-177166277 TTTGCTTTTAGGGTTGGGCAAGG + Intronic
1002166032 5:177346791-177346813 TTTCTGTGTATGGCTGGGCAAGG - Intronic
1002191879 5:177482638-177482660 CTTGAGGTTAGGGCAGGGCAAGG - Intergenic
1002555110 5:180031194-180031216 ATTAAATTTAGGGCTGGGCACGG + Intronic
1003474245 6:6466861-6466883 TTTCAGTGATAGGCTGGGCATGG - Intergenic
1004036616 6:11930756-11930778 TCTCAGCTTTAGGCTGGGCACGG + Intergenic
1004175203 6:13333840-13333862 TGGTAGTTTAGGGCTGGGCGCGG + Intergenic
1004326710 6:14681564-14681586 TGCATGTTTAGGGCTGGGCACGG - Intergenic
1005295680 6:24424440-24424462 TTTCTTTTTGGGGCAGGGCAGGG - Exonic
1005547628 6:26886404-26886426 TTAAAAATTAGGGCTGGGCATGG + Intergenic
1005914080 6:30337110-30337132 TTTCAGTAAAGGGTTGGGCACGG + Intronic
1006114951 6:31770597-31770619 TGTCAGTGCAGGGCGGGGCAGGG + Intronic
1006186118 6:32182585-32182607 TTTGAGGAGAGGGCTGGGCAGGG + Exonic
1006344878 6:33472732-33472754 TTTCAGTTGTGGGCTGGGCGCGG + Intergenic
1006795104 6:36727089-36727111 TTTCCCTATCGGGCTGGGCACGG - Intronic
1006986897 6:38181694-38181716 TTTCAGTTAGGGGCCGGGCATGG + Intronic
1007264224 6:40585260-40585282 TCTAAATTGAGGGCTGGGCAGGG + Intronic
1007652214 6:43430068-43430090 TTTCTATTTCTGGCTGGGCATGG - Intronic
1007807353 6:44460287-44460309 TTATAGGATAGGGCTGGGCATGG - Intergenic
1008049335 6:46884030-46884052 CATCAGTTTACGACTGGGCATGG - Intronic
1008737656 6:54565511-54565533 TTGAAGTTTATGGCTGGTCATGG + Intergenic
1008987189 6:57558835-57558857 ATACATTTTGGGGCTGGGCACGG + Intronic
1009005454 6:57781238-57781260 TTTCATTTTTGGGCCGGGCGCGG + Intergenic
1009175148 6:60451402-60451424 ATACATTTTGGGGCTGGGCACGG + Intergenic
1009575598 6:65454578-65454600 TTACAACTTTGGGCTGGGCAAGG - Intronic
1010456442 6:76061672-76061694 TTCCATTTTAGGACTTGGCAAGG + Intronic
1010567089 6:77429319-77429341 ATACTGTTTCGGGCTGGGCATGG - Intergenic
1010705325 6:79102007-79102029 TTTTAGTTCACGGCCGGGCATGG + Intergenic
1011688956 6:89847952-89847974 TTTCTATTTTGGGCTGGGCACGG - Intronic
1013140441 6:107328564-107328586 TAACAGTTTCAGGCTGGGCACGG - Intronic
1014041386 6:116831018-116831040 TTTCAGTTTAGTTTTGGGAAGGG - Intergenic
1015730196 6:136339434-136339456 TTTGTGTTTAAGGCCGGGCATGG - Intergenic
1015752300 6:136572545-136572567 TTTCAGTTTAGGGCTGGGCATGG - Intronic
1016074537 6:139780054-139780076 TTATAGTTTGGGGCTGGGCTTGG - Intergenic
1016626798 6:146179803-146179825 TCTGAGTTCTGGGCTGGGCAGGG - Intronic
1016886167 6:148961747-148961769 TTTCATTTTGGGGCTGAGAATGG - Intronic
1016956805 6:149634659-149634681 TATCAAAGTAGGGCTGGGCATGG - Intronic
1017169828 6:151446491-151446513 TTTCAGCTTGGGGCTGGGCATGG + Intronic
1017333033 6:153222070-153222092 TTTCAGTTTAGGGGAATGCATGG - Intergenic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1018375986 6:163213066-163213088 TGTCAGTTTCTGGTTGGGCATGG - Intronic
1018688582 6:166323848-166323870 TTTGGATTTGGGGCTGGGCATGG + Intronic
1019070002 6:169337532-169337554 TCTTTGTTTGGGGCTGGGCATGG - Intergenic
1021143740 7:17059577-17059599 TTTTAGAATATGGCTGGGCATGG + Intergenic
1021336112 7:19404556-19404578 TTTCCATTTTGGGCTGGGCACGG - Intergenic
1021596003 7:22317528-22317550 TTGCATTTTTTGGCTGGGCATGG - Intronic
1021646748 7:22796413-22796435 TTGAGGTTTAAGGCTGGGCATGG - Intergenic
1021722621 7:23518629-23518651 TACCAGTTTTGGGCTGGGCACGG - Intronic
1022312453 7:29209903-29209925 TTTCAGTTTTGTGATGGGCCAGG + Intronic
1023436987 7:40149496-40149518 TTATACTTTAGGGCTGGGCGCGG + Intronic
1023539429 7:41249794-41249816 TAACAATTCAGGGCTGGGCATGG - Intergenic
1023783611 7:43683146-43683168 TATCAGTTGGTGGCTGGGCATGG - Intronic
1023957555 7:44899085-44899107 TTTCTGTATATGGCTGGGCATGG - Intergenic
1024485852 7:49918777-49918799 TTTCAGTGATGGGCTGGGCGTGG + Exonic
1024739881 7:52342087-52342109 AAACATTTTAGGGCTGGGCATGG - Intergenic
1025601471 7:63002630-63002652 ATTCAGTTGTGGGCTGGGCACGG + Intergenic
1026238377 7:68549320-68549342 GTGCAGTTTTGGGCCGGGCACGG - Intergenic
1026269428 7:68823469-68823491 TTAAAAATTAGGGCTGGGCATGG - Intergenic
1026584772 7:71647357-71647379 TAGCAGATTTGGGCTGGGCATGG - Intronic
1026735895 7:72948535-72948557 TTTCTCTTTGGGGCTGGGCTGGG + Exonic
1026786242 7:73303467-73303489 TTTCTCTTTGGGGCTGGGCTGGG + Exonic
1026961192 7:74408740-74408762 TAACATTTTGGGGCTGGGCATGG - Intergenic
1027107838 7:75416526-75416548 TTTCTCTTTGGGGCTGGGCTGGG - Intergenic
1027320832 7:77009153-77009175 ATTCAGCTCAAGGCTGGGCATGG - Intergenic
1027772574 7:82425836-82425858 ATTCTGTTTGGGGCTGGGCGTGG + Intronic
1028214307 7:88113009-88113031 GTTCAGTTTTGAGCTGGGCATGG - Intronic
1029164297 7:98576091-98576113 TTTCGATTGAGTGCTGGGCATGG + Intergenic
1029381260 7:100216508-100216530 GTTCAGTTTAGGGCTGGGTGCGG + Intronic
1029400686 7:100343791-100343813 GTTCAGTTTAGTGCTGGGTGCGG + Intronic
1029667719 7:102006671-102006693 ATTCATTCTAGGGCCGGGCACGG - Intronic
1029885120 7:103861351-103861373 TATCAGTTTGGGGATGGGAAGGG + Intronic
1030049419 7:105524514-105524536 TATGCGTTTAAGGCTGGGCATGG - Intergenic
1030089477 7:105844912-105844934 AATCAGTTGTGGGCTGGGCAAGG + Intronic
1031077588 7:117227761-117227783 TTTCAGTTTAGAGCTGGATTGGG - Intronic
1031119559 7:117705486-117705508 TTTCAGTTAAAGGCTAGGCATGG - Intronic
1031216544 7:118900097-118900119 ATTGAGTATGGGGCTGGGCATGG + Intergenic
1031774579 7:125891755-125891777 TTTCATTTTTGGGCTGGGCGCGG + Intergenic
1032337659 7:131041447-131041469 ATTCTGTTTACGGCTGGGCGCGG - Intergenic
1032816298 7:135478449-135478471 TATAAGAATAGGGCTGGGCACGG + Intronic
1033230705 7:139595266-139595288 CTTCAGTCTGGGGCTGGGCAGGG + Intronic
1033233330 7:139618972-139618994 TTTAGCCTTAGGGCTGGGCAAGG + Intronic
1033715143 7:143993726-143993748 TTTATGTTTTAGGCTGGGCACGG + Intergenic
1034041676 7:147884146-147884168 TCCCACTTTAGGGCTTGGCAGGG - Intronic
1034374640 7:150631282-150631304 TTGCAGTGCTGGGCTGGGCATGG + Intronic
1034540233 7:151753705-151753727 TAACACTTTAGGGCTGGGCGAGG - Intronic
1034645987 7:152648122-152648144 TAAAACTTTAGGGCTGGGCACGG + Exonic
1036931339 8:12959192-12959214 TTTCAGGTTAGGGATGCCCAAGG - Intronic
1037234099 8:16696176-16696198 TATCAGATGAAGGCTGGGCATGG - Intergenic
1037895103 8:22646733-22646755 TTTCTGTTTAGGTCTGAGAAAGG - Intronic
1038878631 8:31581049-31581071 TGTCAATTTTGGGCCGGGCACGG - Intergenic
1039628223 8:39078489-39078511 TTTTAAATTAGGGCTGGGCACGG + Intronic
1040479687 8:47813406-47813428 TTTCTATTTCTGGCTGGGCATGG - Intronic
1040925229 8:52674476-52674498 TATCACTCTAGGGCTGGGCGTGG + Intronic
1041071206 8:54127610-54127632 TTTAACATTAGTGCTGGGCACGG + Intergenic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1041269974 8:56102108-56102130 GGTCAGTTTAAGGCTGGGCGCGG - Intergenic
1041912006 8:63098927-63098949 TGTCACTTTCTGGCTGGGCACGG + Intergenic
1043096346 8:75979945-75979967 TTTCAAGTTAAGGCTGGGCATGG + Intergenic
1043220338 8:77654817-77654839 TTTCGGTTTGGGGGTTGGCAGGG + Intergenic
1043770464 8:84192831-84192853 ATTCAGTTGCGGGCTGGGCACGG - Intronic
1043961071 8:86419127-86419149 TATCAGACTAGGGCTGGGCGCGG + Intronic
1044680149 8:94769350-94769372 ACTAAGTTTAGGGCTGAGCATGG - Intronic
1044824803 8:96185675-96185697 TTCCACTTCAGGGTTGGGCATGG + Intergenic
1045126483 8:99096463-99096485 TTTCAATTTTTGGCCGGGCATGG + Intronic
1045203982 8:100017270-100017292 TTTCAATAAAGGACTGGGCATGG - Intronic
1045253931 8:100503426-100503448 GTTCAGTGCAGGGCTGGGGAAGG - Intergenic
1046542860 8:115609134-115609156 TTTAAATTTTAGGCTGGGCATGG - Intronic
1046802785 8:118447591-118447613 TTTCAATTGAAGGCTGGACACGG - Intronic
1047094676 8:121611132-121611154 ATACATTTTAGGACTGGGCATGG - Intergenic
1047533919 8:125701885-125701907 CTTCAGTTTTTGACTGGGCACGG - Intergenic
1047724663 8:127673544-127673566 ATTCTTTTTAAGGCTGGGCACGG - Intergenic
1049186206 8:141255368-141255390 TTTCCCTTTTTGGCTGGGCACGG - Intronic
1050750768 9:8933967-8933989 TTTCCTTTTGGGGCTGGGAAAGG + Intronic
1050899022 9:10921293-10921315 CTTCAGTTTAGGGCTGATGAGGG + Intergenic
1051427155 9:16943834-16943856 ATTCATTTGAAGGCTGGGCACGG + Intergenic
1051607818 9:18933754-18933776 TGTCATTTTTGGGCCGGGCACGG + Intronic
1051630836 9:19139517-19139539 TTGCCCTTTATGGCTGGGCACGG + Intronic
1052311298 9:27072328-27072350 TTACAGATTTGGGCTGGACATGG - Intergenic
1053187824 9:36033931-36033953 TTGCATATTGGGGCTGGGCATGG + Intergenic
1053721159 9:40947736-40947758 TTAGACTTTAGGACTGGGCATGG - Intergenic
1055448676 9:76410139-76410161 TTTAAAATTTGGGCTGGGCACGG + Intergenic
1055471632 9:76617695-76617717 GTTCATTTCAGGGCTGGGCATGG - Intronic
1055892120 9:81134589-81134611 TATTACATTAGGGCTGGGCATGG - Intergenic
1056197182 9:84240174-84240196 TTGCACTTATGGGCTGGGCATGG + Intergenic
1056296961 9:85202701-85202723 TTTGAATTTCAGGCTGGGCATGG - Intergenic
1056963898 9:91150156-91150178 CTTAATTTTTGGGCTGGGCATGG - Intergenic
1057069028 9:92079944-92079966 ATTCAATTTTAGGCTGGGCATGG - Intronic
1057077693 9:92147499-92147521 TCTCAGTTAGGGGCTGGACAGGG + Intergenic
1057124003 9:92602014-92602036 TTTGATTCTAGAGCTGGGCAGGG + Intronic
1057622527 9:96649061-96649083 TAGCACTTTAGGGCTGGGCGCGG - Intronic
1059153452 9:111969385-111969407 TTCCAGTTTTGAGCTGGGCCAGG + Intergenic
1059977008 9:119728524-119728546 AGTCAGTTTTTGGCTGGGCATGG + Intergenic
1060153672 9:121304255-121304277 TCACAGTCCAGGGCTGGGCAGGG + Intronic
1060250400 9:121982424-121982446 AGTCATTTTTGGGCTGGGCATGG + Intronic
1060326626 9:122622433-122622455 TGTAGCTTTAGGGCTGGGCATGG - Intergenic
1060370306 9:123063077-123063099 TATGAGATTTGGGCTGGGCATGG - Intronic
1060606363 9:124918140-124918162 TATCAGATCAGGGCTGGGCTTGG - Intronic
1060724559 9:125998356-125998378 CTTCAGATTGAGGCTGGGCAAGG + Intergenic
1061236831 9:129348135-129348157 TTACAATTTTTGGCTGGGCACGG + Intergenic
1061378505 9:130240357-130240379 TGTGAGTTTGGGGCTTGGCAGGG - Intergenic
1061845208 9:133384146-133384168 TTTAAATATTGGGCTGGGCACGG + Intronic
1062197694 9:135283240-135283262 TTTCAGGTTCAGGCTGGGTAGGG + Intergenic
1062620558 9:137419377-137419399 ATGCAGTTTAAGGCCGGGCACGG + Intronic
1203454030 Un_GL000219v1:148414-148436 TTAGACTTTAGGACTGGGCATGG + Intergenic
1185879139 X:3725022-3725044 TTTGAATGTAGGGCTGGGGAAGG + Intergenic
1186375152 X:8990572-8990594 TTGAGATTTAGGGCTGGGCATGG - Intergenic
1186417345 X:9395196-9395218 TTACATTTTCTGGCTGGGCATGG - Intergenic
1186866905 X:13729616-13729638 TTAAATGTTAGGGCTGGGCACGG + Intronic
1186961527 X:14742013-14742035 TTTTAGTGTAGTGCTGGGCATGG - Intergenic
1187056409 X:15744877-15744899 TTTCTGTTTATGGCCAGGCACGG + Intronic
1187122548 X:16423336-16423358 TTTCCCTTTAGGTCTGGGGATGG - Intergenic
1187278016 X:17833229-17833251 TATGAATTTCGGGCTGGGCATGG + Intronic
1187339314 X:18407229-18407251 GTAAAGATTAGGGCTGGGCATGG + Intergenic
1187532506 X:20109753-20109775 ATTCAGATTAAGGCTGGGCGTGG + Intronic
1187711063 X:22054881-22054903 TGTCAGATTAGGGCTGGGCGTGG + Intronic
1187897342 X:23994965-23994987 TTACATTTTCAGGCTGGGCAAGG - Intronic
1188374557 X:29411978-29412000 TATTGGTTTATGGCTGGGCATGG + Intronic
1189116263 X:38345829-38345851 TTACGGTTTAGGGTCGGGCACGG - Intronic
1189462960 X:41257181-41257203 ATTCAGTTTTTGGCTGGGCGTGG - Intergenic
1189476467 X:41360085-41360107 TTTCAATTTCCGGCTGGGCATGG + Intronic
1189486726 X:41438966-41438988 TTTTTGTTTCTGGCTGGGCATGG - Intergenic
1189836736 X:45030983-45031005 TATGAATTTAGGGCAGGGCATGG - Intronic
1190288717 X:48977613-48977635 TCTTAGTTCAGGGCTGGGCGCGG - Intronic
1190328943 X:49224074-49224096 TTTCAGCTTGGGACTGGGCCTGG + Intronic
1190718111 X:53121289-53121311 AATAAGTTTAGGGCCGGGCATGG - Intergenic
1190855107 X:54286620-54286642 ATTCAATCAAGGGCTGGGCATGG + Intronic
1190994775 X:55595881-55595903 TACCAGTTTTAGGCTGGGCATGG + Intergenic
1191115040 X:56843426-56843448 TTACAATTTGAGGCTGGGCATGG - Intergenic
1193588168 X:83353175-83353197 CTTCAGTTTTTGACTGGGCATGG - Intergenic
1194079606 X:89443626-89443648 TTTAAGATTAGGCCTGGTCATGG + Intergenic
1194283403 X:91980723-91980745 CTCCAGTTTGGGGCTGGGCATGG - Intronic
1195026757 X:100885342-100885364 AGTCAGTTTAGGGCTGGGTGGGG + Intergenic
1196025716 X:111039754-111039776 TTTCAGCCTAGGGCGGGGCTGGG - Intronic
1196142607 X:112280783-112280805 TTTCATTTTAGGGCCGGGTTTGG - Intergenic
1196439922 X:115709520-115709542 TATCAGATTAGAGCGGGGCACGG + Intergenic
1196542912 X:116930598-116930620 TTTCAGTTTCGGGCGGGGGGCGG + Intergenic
1196801279 X:119545604-119545626 TTTCATTTGGGGGCCGGGCACGG + Intronic
1196851822 X:119945295-119945317 ATTGAATTTGGGGCTGGGCATGG + Intergenic
1198657692 X:138932633-138932655 TTTCAGTTTAGTTCTGGGAAGGG - Intronic
1198740439 X:139836223-139836245 TTGCAGGTTTGGGCCGGGCACGG + Intronic
1198752573 X:139950337-139950359 TTTCATATTGAGGCTGGGCACGG + Intergenic
1199006467 X:142703936-142703958 ATGCATTTTATGGCTGGGCATGG - Intergenic
1199760845 X:150902935-150902957 TTTCAGTTTGGGGACGGGTAGGG - Intergenic
1200432227 Y:3098933-3098955 TTTAAGATTAGGCCTGGTCATGG + Intergenic
1200600976 Y:5205257-5205279 CTCCAGTTTGGGGCTGGGCATGG - Intronic