ID: 1015754523

View in Genome Browser
Species Human (GRCh38)
Location 6:136594174-136594196
Sequence ATGTGGAAACAATACATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015754523_1015754527 -3 Left 1015754523 6:136594174-136594196 CCTGGCATGTATTGTTTCCACAT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1015754527 6:136594194-136594216 CATATTCTGGAGCAGCTCATGGG No data
1015754523_1015754526 -4 Left 1015754523 6:136594174-136594196 CCTGGCATGTATTGTTTCCACAT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1015754526 6:136594193-136594215 ACATATTCTGGAGCAGCTCATGG No data
1015754523_1015754531 25 Left 1015754523 6:136594174-136594196 CCTGGCATGTATTGTTTCCACAT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1015754531 6:136594222-136594244 CATTTCACGGACCATATTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 126
1015754523_1015754530 24 Left 1015754523 6:136594174-136594196 CCTGGCATGTATTGTTTCCACAT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1015754530 6:136594221-136594243 GCATTTCACGGACCATATTTTGG No data
1015754523_1015754528 12 Left 1015754523 6:136594174-136594196 CCTGGCATGTATTGTTTCCACAT 0: 1
1: 0
2: 1
3: 15
4: 221
Right 1015754528 6:136594209-136594231 CTCATGGGCCTAGCATTTCACGG 0: 1
1: 0
2: 2
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015754523 Original CRISPR ATGTGGAAACAATACATGCC AGG (reversed) Intronic
903054110 1:20623250-20623272 ATGTGGAAACAATCTATGGAAGG + Intergenic
904565725 1:31427094-31427116 ATTTGTAAACACTCCATGCCTGG + Intronic
905937688 1:41837822-41837844 ATGTGGAATAAATACTGGCCAGG - Intronic
906461741 1:46039793-46039815 ATGTGGAAACACTTCATTCTGGG + Intergenic
910330832 1:86070644-86070666 CAGTGGAAACCATACAGGCCAGG + Intronic
910536234 1:88300938-88300960 ATTTGGAAACAAAACCTGCTTGG - Intergenic
911752948 1:101519516-101519538 CAGTGGAAACCATACAGGCCAGG - Intergenic
912075517 1:105870481-105870503 AGATGGCAACAATACATGCTGGG - Intergenic
913399237 1:118410006-118410028 ATATGGAAACAATAAATCCTGGG + Intergenic
913451196 1:118993790-118993812 ATGTGGAAACAACACATACGTGG + Intergenic
914705580 1:150167196-150167218 AGGTGGCAACAATAGAAGCCAGG + Intergenic
915857034 1:159399097-159399119 CAGTGGAAACATTACAGGCCAGG + Intergenic
916323791 1:163534612-163534634 GTTAGGAAACAATAAATGCCTGG - Intergenic
920696886 1:208187710-208187732 AGGTGGAGAAAATACTTGCCAGG - Intronic
922045744 1:221944753-221944775 CAGTGGAAACCATACAGGCCAGG - Intergenic
922319921 1:224477994-224478016 CAGTGGAAACATTACAGGCCAGG - Intronic
923117156 1:230952263-230952285 ATGTGGAAATAATATCTGCATGG - Intronic
1069193280 10:65517836-65517858 CAGTGGAAACATTACAGGCCAGG - Intergenic
1069568929 10:69482598-69482620 ATGTGGAAACACTACAAACCTGG - Intronic
1070464423 10:76705340-76705362 AAGTGGAAACCTTACAGGCCAGG + Intergenic
1070862084 10:79678867-79678889 TTATGGAAACAATCCATACCTGG + Intergenic
1070875052 10:79795586-79795608 TTATGGAAACAATCCATACCTGG - Intergenic
1070891955 10:79947709-79947731 ATATGGAAAGAGGACATGCCAGG + Intronic
1071641978 10:87317756-87317778 TTATGGAAACAATCCATACCTGG - Intergenic
1076284521 10:129280176-129280198 TTGGAGAAGCAATACATGCCTGG - Intergenic
1076946415 10:133654554-133654576 ATGTGAAAAAAATTCAAGCCCGG + Intergenic
1080412620 11:32040077-32040099 GTGTGGCAACAATAAAGGCCTGG - Intronic
1080762502 11:35265423-35265445 ATGTGACAATAATACATGCAGGG + Intronic
1085306498 11:75488921-75488943 ATGGGGACACAAGATATGCCAGG + Intronic
1087690853 11:101319119-101319141 CTGTGGAAACATTACAGGCCAGG - Intergenic
1090161934 11:124504562-124504584 ATGTGGGAACAATACACACTGGG - Intergenic
1090697376 11:129261607-129261629 AGGTGGAAACAAAAAATGCTTGG - Intronic
1091162071 11:133433034-133433056 CTGTGGAAAGAATTCATGACTGG - Intronic
1091884358 12:4005078-4005100 ATATGGAGACAATACAAGACAGG - Intergenic
1092753815 12:11744119-11744141 ACGTGGCAATAGTACATGCCTGG + Intronic
1093829118 12:23734062-23734084 TTGTGGAAACAAGACATCACTGG + Intronic
1093929233 12:24938212-24938234 ATGTGGAAACAGTACTGGGCAGG + Intronic
1093988637 12:25565926-25565948 CAGTGGAAACATTACAGGCCAGG - Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1099100763 12:78437986-78438008 CAGTGGAAACATTACAGGCCAGG - Intergenic
1100494285 12:95110269-95110291 ATGTGGAAAGAATACAGGCCGGG - Intronic
1101792686 12:107942603-107942625 CAGTGGAAACCATACAGGCCAGG + Intergenic
1102554125 12:113714771-113714793 GTGTATAAACAATTCATGCCAGG - Intergenic
1107296692 13:38916587-38916609 ATGTGGCAACAATAAATGATGGG - Intergenic
1108014323 13:46058218-46058240 ATATGGAAACACTATATGCTGGG + Exonic
1109110154 13:58307061-58307083 AAGTGGAAGCAATTCATGCATGG + Intergenic
1111914296 13:94344683-94344705 GTGTGCAAACAATAAATGCTCGG - Intronic
1116542422 14:46114059-46114081 CTGTGGAAACATTACAGGCCAGG + Intergenic
1116588634 14:46742413-46742435 ATGTGGGAACAACACATCCATGG - Intergenic
1116930503 14:50686397-50686419 CAGTGGAAACATTACAGGCCAGG - Intergenic
1117159181 14:52971979-52972001 CAGTGGAAACATTACAGGCCAGG - Intergenic
1118672475 14:68144260-68144282 GTGGGGAAACAACACAGGCCAGG - Intronic
1120820241 14:88905542-88905564 AAGTGGAAACAACACGTGCTAGG - Intergenic
1123755227 15:23392707-23392729 GTGTGGAAACATTACATCCGTGG + Intergenic
1126068637 15:44846371-44846393 ATATGGAAACACTAGATGTCAGG - Intergenic
1126090190 15:45044426-45044448 ATATGGAAACACTAGATGTCAGG + Intronic
1126655165 15:50969181-50969203 AGAGGGAAACAATACATGCTGGG - Intronic
1126930753 15:53647840-53647862 AGGTGGAAACAAGAGAGGCCTGG + Intronic
1130512001 15:84597260-84597282 CTGTGAAAACCTTACATGCCAGG + Intergenic
1130539765 15:84813813-84813835 ATTAGGAAATAATACAGGCCAGG - Intergenic
1133638408 16:7693047-7693069 ATGTGTTACCAAAACATGCCAGG - Intronic
1134461148 16:14430294-14430316 GTGTGGAAACATTACATCCGTGG - Intergenic
1134832031 16:17331435-17331457 CTGTGGAAACAGTACATGGAAGG + Intronic
1135226842 16:20667970-20667992 AGTTGGAAACAATAGATGCTGGG + Intronic
1137492088 16:48941630-48941652 ATGTGAAAACAAGTCCTGCCTGG - Intergenic
1141174957 16:81712778-81712800 ATGTGGAGGCAGGACATGCCTGG - Intergenic
1141193145 16:81839630-81839652 ATATTGAAAAAATACATACCTGG - Intronic
1141254632 16:82389367-82389389 ATGTGGCATCATTACATCCCGGG - Intergenic
1153430636 18:5012771-5012793 AAGTGGAAACAATAGATGCTGGG + Intergenic
1153719678 18:7889238-7889260 TTCTTAAAACAATACATGCCAGG - Intronic
1154453886 18:14503340-14503362 AGGTGGAGACTATGCATGCCAGG - Intergenic
1155394202 18:25368855-25368877 ATATGGAAATATTACATGCCAGG - Intergenic
1156732773 18:40215533-40215555 ATGTGCAAGCTATACTTGCCTGG + Intergenic
1158077894 18:53552533-53552555 AGATGGAAATAATACATACCTGG + Intergenic
1158989025 18:62850092-62850114 ATTTAGAAACAAAACAGGCCGGG + Intronic
1159775170 18:72596748-72596770 CAGTGGAAACCATACAGGCCAGG - Intronic
1160613067 18:80104152-80104174 AAGTGGAAACAATAAAAGCATGG - Intergenic
1161929780 19:7330929-7330951 ATGAGGAAACAAGAAATGGCTGG - Intergenic
1163987286 19:20965406-20965428 ACATGGAAACAATAAATGCTGGG + Intergenic
1164889105 19:31807802-31807824 ATGTGGAAGGCATACATTCCAGG + Intergenic
1165590697 19:36966999-36967021 ATGTGGAAACCATGCATCTCAGG + Intronic
1165633416 19:37320741-37320763 ATATGGAAACACTACATGTAGGG - Intronic
926888459 2:17618877-17618899 ATATGGAAAAAACATATGCCTGG - Intronic
928036596 2:27829934-27829956 AGATGGAAACCATACATGCTAGG - Intronic
929025987 2:37602594-37602616 TTGTGGTAACAAGATATGCCTGG + Intergenic
930943229 2:57039402-57039424 CAATGGAAACAATACAGGCCAGG - Intergenic
932959302 2:76394091-76394113 CTGAGGAAAGAATACATTCCAGG + Intergenic
933100535 2:78250852-78250874 CAATGGAAACAATACAGGCCAGG - Intergenic
933195970 2:79390494-79390516 AGGTGGAAAAAATTCATGTCTGG - Intronic
936528844 2:113261048-113261070 GTGTGGAAACAACAGATGCACGG - Intronic
936530330 2:113271827-113271849 ATGTCGTAGCAATACCTGCCTGG + Intronic
936873688 2:117163094-117163116 ATGTAGAAGAAACACATGCCTGG + Intergenic
937031196 2:118742243-118742265 ATGTGGAAACCAAACGAGCCAGG - Intergenic
939717132 2:145598538-145598560 ATGTGTAAAAAATACTTCCCTGG - Intergenic
940529794 2:154867213-154867235 ATTTGGAAACAATATTTGTCAGG + Intergenic
941922851 2:170869516-170869538 AAGAAGAAACAATAGATGCCTGG - Intergenic
943005416 2:182383654-182383676 ATTTGGAAACCATTCATGCATGG + Intronic
943933769 2:193887642-193887664 CAGTGGAAACATTACAGGCCAGG + Intergenic
945575852 2:211527254-211527276 AAGTGGAAACCTTACAGGCCAGG + Intronic
948774872 2:240279544-240279566 TTGTGGAAACTTTACAGGCCAGG + Intergenic
948993012 2:241564208-241564230 CTGTGGCAACAAGACAAGCCCGG - Intronic
1169781763 20:9317678-9317700 TTGTGGAAACAACACAAGACAGG + Intronic
1170615221 20:17943110-17943132 AACTGGAAATAAAACATGCCAGG - Exonic
1172820454 20:37728680-37728702 ATGTGGAAATAAAACATATCAGG + Intronic
1176628644 21:9116789-9116811 ATGTGAAAAGAATAAATTCCTGG + Intergenic
1176687834 21:9868201-9868223 ATGTTGAACCAAAAGATGCCAGG - Intergenic
1177683424 21:24405200-24405222 ATGTGGATACAATATATCCTTGG + Intergenic
1178454643 21:32737253-32737275 ATGTGGAAAAAAGAAATGCAAGG - Exonic
1178525122 21:33321453-33321475 ATGTGGAACCAATACATATATGG + Intergenic
1179065602 21:38021687-38021709 ATGTGCATACAATTCATGCATGG - Intronic
1182642308 22:31778041-31778063 ACATGAAACCAATACATGCCTGG - Intronic
1183504225 22:38200205-38200227 ATGTTGAAGGAATACATGACTGG - Intronic
1185035118 22:48471049-48471071 ATGTGAAATCAATATATGGCAGG - Intergenic
949539921 3:5024520-5024542 ATGTGAAAACAATAAATGAATGG - Intergenic
949715798 3:6929868-6929890 ATGTGGAAAAGATCCATGGCAGG - Intronic
949776631 3:7640037-7640059 ATGTGGAAACAAAGCATTTCAGG - Intronic
950002165 3:9665439-9665461 AGGTGGAAACAATAGACGTCAGG + Intronic
951195506 3:19819138-19819160 ATTAGGAAACAATGCAGGCCAGG + Intergenic
954004350 3:47579287-47579309 CTGTGGAAACAAGCCAGGCCCGG + Exonic
955306818 3:57841303-57841325 TTGTGGAAACAATACACCCATGG - Exonic
955960189 3:64332747-64332769 ACCTGGAAACAAAGCATGCCAGG + Intronic
957081063 3:75635925-75635947 ATGTGAAAAAAATTCAAGCCCGG - Intergenic
957422050 3:79982784-79982806 GTGTGGAAACAAGAAAAGCCTGG + Intergenic
957925645 3:86806843-86806865 CAGTGGAAACCATACAGGCCAGG + Intergenic
959328779 3:104974970-104974992 ATGTGCAAACATTCCATGTCTGG + Intergenic
963904850 3:150764507-150764529 CTGTAGAAAGAATACATGCATGG + Intergenic
964014717 3:151930714-151930736 ATGCAGAAACAATACAGTCCTGG - Intergenic
964251318 3:154720905-154720927 ATGTAGAAACAAAACATGAAGGG - Intergenic
967581596 3:191162816-191162838 ATTTGGAAACAATATATCCCAGG + Intergenic
967688818 3:192449439-192449461 ATGTGGACACCATGCATCCCAGG + Intronic
968052548 3:195665186-195665208 ATATGAAAACAATCCATGGCCGG - Intergenic
969875663 4:10133984-10134006 ATGTAGAACCAAGACATTCCTGG + Intergenic
971765425 4:30824647-30824669 AGGAGGAAACAATACAGGCCCGG + Intronic
972090903 4:35282324-35282346 ATGTGTATACAATACATACTAGG + Intergenic
975295350 4:72727934-72727956 CAGTGGAAACATTACATGCTAGG + Intergenic
975625777 4:76345517-76345539 AACTGGAAATAAAACATGCCAGG + Intronic
975933161 4:79551910-79551932 TGATGGAAACAATACATGCTGGG + Intergenic
977025162 4:91809567-91809589 AAGTGGAAACAATAAATACTGGG + Intergenic
978158863 4:105521684-105521706 ATATGGAAACAATAGATACTGGG - Intergenic
978521239 4:109617933-109617955 ATGTGAAAACAAGACTTCCCAGG - Intronic
980351188 4:131686037-131686059 ATGTTGAACCAAAAGATGCCAGG - Intergenic
980647060 4:135655259-135655281 TTGTGGAAACCTTACAAGCCAGG + Intergenic
981011132 4:139926189-139926211 AAGTGGAAACAATAGATGTAAGG + Intronic
981837119 4:149066793-149066815 CAGTGGAAACATTACAGGCCAGG + Intergenic
982936670 4:161486466-161486488 TTGTGGAAACACTGCAGGCCTGG + Intronic
985449828 4:190055213-190055235 ATGTGAAAAAAATTCAAGCCCGG + Intergenic
985729733 5:1540430-1540452 ATGTGGAAACCAAACAGGCCAGG - Intergenic
986155734 5:5174279-5174301 CAGTGGAAACCATACAGGCCAGG - Intronic
986428664 5:7660001-7660023 AGATGGAAACAATAGATACCAGG + Intronic
987189621 5:15462479-15462501 AAATGGAAACCATACAAGCCAGG - Intergenic
988702840 5:33692393-33692415 ATTTGGAAATAAAACATCCCAGG - Intronic
989472226 5:41833316-41833338 CAGTGGAAACATTACAAGCCAGG + Intronic
992263754 5:74996749-74996771 AAATGGAAACAATAGATGCTGGG + Intergenic
996515472 5:124364607-124364629 ATAGGGAAACAATACACACCAGG + Intergenic
997543885 5:134689190-134689212 ATGTGGAAACATTAGAACCCTGG + Intronic
998413090 5:141925693-141925715 ATGAGGAAAACATACATGGCGGG - Intronic
999874888 5:155793222-155793244 AAATGGAAACAATAGATGCTGGG + Intergenic
1000806042 5:165793824-165793846 ATGTGGAAACCATACAGACCAGG - Intergenic
1003082096 6:3029068-3029090 ATGAGGAAACAAAACATGATTGG + Intergenic
1003467158 6:6391809-6391831 TTGTGGAAACAAAACACACCAGG - Intergenic
1006778019 6:36611308-36611330 AAGTGGAATAAATAGATGCCAGG + Intergenic
1008707409 6:54180149-54180171 CAGTGGAAACATTACAGGCCAGG - Intronic
1009039152 6:58156651-58156673 CTGTGGAAACCCTACAGGCCAGG - Intergenic
1009215049 6:60911491-60911513 CTGTGGAAACCCTACAGGCCAGG - Intergenic
1009857135 6:69279395-69279417 GTGTGAAAACAATACATGTTGGG - Intronic
1010324480 6:74549466-74549488 CAGTGGAAACATTACAGGCCAGG - Intergenic
1010975674 6:82310999-82311021 CAGTGGAAACATTACAGGCCAGG - Intergenic
1012428258 6:99138005-99138027 ATCTGAAATCAATACAAGCCAGG + Intergenic
1013827040 6:114225563-114225585 AAGTGGAAAGAATCCTTGCCTGG - Intronic
1015754523 6:136594174-136594196 ATGTGGAAACAATACATGCCAGG - Intronic
1016541685 6:145172463-145172485 CAGTGGAAACCTTACATGCCAGG + Intergenic
1016623626 6:146141211-146141233 CAGTGGAAACATTACAAGCCAGG - Intronic
1018283917 6:162217227-162217249 ATGTGGAAACCATGCATATCAGG - Intronic
1019090018 6:169521196-169521218 CAGTGGAAACTGTACATGCCAGG + Intronic
1021105499 7:16634596-16634618 ATGTGGAAACTACCCAAGCCTGG + Intronic
1022636523 7:32141453-32141475 ATGTGGATACCACATATGCCTGG + Intronic
1023241116 7:38148371-38148393 CAGTGGAAACCATACAAGCCAGG + Intergenic
1023897378 7:44445207-44445229 ATGTAGAAAGGATACATACCAGG - Intronic
1024814659 7:53254942-53254964 AGATGGAAACAATAGATACCAGG - Intergenic
1026772346 7:73210584-73210606 ATGTGGAAACTAGAAAGGCCTGG - Intergenic
1027013214 7:74763983-74764005 ATGTGGAAACTAGAAAGGCCTGG - Intergenic
1027074826 7:75182051-75182073 ATGTGGAAACTAGAAAGGCCTGG + Intergenic
1027862863 7:83607205-83607227 ATGTGGACACAATAACTGACTGG - Intronic
1028527908 7:91805606-91805628 AAATGGGAACAATACATGCTGGG + Intronic
1030053146 7:105557511-105557533 ATGTAAAAACATTAAATGCCTGG + Intronic
1030433528 7:109484548-109484570 ATTTAGAAAAAATACATGCCAGG + Intergenic
1030973578 7:116092232-116092254 AAGTGGAAAGAATAAATGGCAGG + Intronic
1031306472 7:120132824-120132846 CAGTGGAAACATTACAGGCCAGG + Intergenic
1031765712 7:125773930-125773952 ATGTGCAAACATAACATGGCAGG - Intergenic
1035445404 7:158938279-158938301 CAGTGGAAACCATACAGGCCAGG + Intronic
1038817606 8:30921262-30921284 AACTGGAAATAAAACATGCCAGG + Intergenic
1041658837 8:60380938-60380960 ATGTAGAAAAAATAAATGTCAGG + Intergenic
1042213793 8:66408547-66408569 AAATGGAAACAATCCAGGCCGGG + Intergenic
1042709430 8:71699889-71699911 AATTGGAAACAATAATTGCCTGG - Intergenic
1043515892 8:80994324-80994346 ATGTGCTAAGAATACATCCCTGG + Intronic
1047215867 8:122875700-122875722 ATGTGGAAACAGAAGCTGCCTGG + Intronic
1047935939 8:129778245-129778267 ATTTGGAAGCAATGGATGCCTGG + Intronic
1050873552 9:10606743-10606765 ATGTGAACACAATGCTTGCCTGG + Intronic
1051191711 9:14519662-14519684 ATGAGGACCCAATATATGCCTGG + Intergenic
1051793996 9:20843434-20843456 CTGTGGAAACATTACAGGCTAGG - Intronic
1053781524 9:41613671-41613693 ATGTTGAACCAAAAGATGCCAGG + Intergenic
1054169471 9:61823823-61823845 ATGTTGAACCAAAAGATGCCAGG + Intergenic
1054668066 9:67756992-67757014 ATGTTGAACCAAAAGATGCCAGG - Intergenic
1058248387 9:102659832-102659854 CTGAGGAAATAATACTTGCCAGG + Intergenic
1187064394 X:15819174-15819196 ATGTGAAAATAATATAAGCCGGG + Intronic
1187333027 X:18357962-18357984 ATGTTGAAACAATATCGGCCAGG + Intergenic
1188930024 X:36097578-36097600 TAGTGGAAACATTACAGGCCAGG - Intronic
1189177952 X:38976935-38976957 ATGTGGAAAGAACACAGTCCTGG - Intergenic
1189686394 X:43568093-43568115 ATGGGGAAAAAATCCATGACTGG + Intergenic
1190035638 X:47020816-47020838 ATGGGGAAATAAAACATGGCTGG + Intronic
1190594520 X:52039231-52039253 AAGTGGAAACCTTACAGGCCAGG + Intergenic
1190605093 X:52133345-52133367 AGAAGGAAACAATACATGCTGGG + Intergenic
1190630383 X:52380459-52380481 TTGTGGAAATTATACCTGCCAGG + Intergenic
1191118991 X:56883362-56883384 CCATGGAAACAATACAGGCCAGG - Intergenic
1192315990 X:70052239-70052261 ATGAGGACATAATATATGCCAGG + Intergenic
1192826536 X:74703070-74703092 CTGTGGAAACCTTACAGGCCAGG - Intergenic
1193172752 X:78356112-78356134 AAGTGGAAACATTACAGGTCAGG - Intergenic
1193401408 X:81048323-81048345 ATGTTGAAACATTACATCCCTGG + Intergenic
1193447683 X:81624522-81624544 CAGTGGAAACCTTACATGCCAGG - Intergenic
1193488150 X:82113738-82113760 CAGTGGAAACCATACAGGCCAGG - Intergenic
1193524323 X:82571046-82571068 CAGTGGAAACAGTACAGGCCAGG - Intergenic
1193691795 X:84655190-84655212 TAGTGGAAACATTACAGGCCAGG - Intergenic
1194077446 X:89414391-89414413 ATTTGGCAACAATACATGATGGG + Intergenic
1194253401 X:91605303-91605325 TAGTGGAAACATTACAGGCCAGG + Intergenic
1194371980 X:93085002-93085024 ATATGGAAACATCAAATGCCTGG - Intergenic
1194479184 X:94399622-94399644 ATTTGGAAACATTACAGGCCAGG - Intergenic
1194595343 X:95849915-95849937 CTGTGCAAACATTACAGGCCAGG + Intergenic
1194882944 X:99275930-99275952 TGGTGGAAACATTACAGGCCAGG + Intergenic
1194979391 X:100424814-100424836 AAGTGGAGACAACTCATGCCAGG + Intergenic
1196613947 X:117745542-117745564 CAGTGGAAACCTTACATGCCAGG + Intergenic
1197487538 X:127072688-127072710 CTGTGGAAACTATACAGGCCAGG - Intergenic
1198607171 X:138354460-138354482 TAGGGGAAACAATATATGCCTGG + Intergenic
1198646519 X:138812870-138812892 ATAGGGGAACAATACACGCCAGG - Intronic
1199005928 X:142695478-142695500 CAGTGGAAACAATACAGGCCAGG + Intergenic
1199459349 X:148067558-148067580 CAGTGGAAACCATACAGGCCAGG - Intergenic
1200430096 Y:3069930-3069952 ATTTGGCAACAATACATGATGGG + Intergenic
1200680025 Y:6199039-6199061 ATATGGAAACATCAAATGCCTGG - Intergenic
1201369103 Y:13241221-13241243 CTGTGGAAACTATACATACATGG + Intergenic