ID: 1015757413

View in Genome Browser
Species Human (GRCh38)
Location 6:136621667-136621689
Sequence TGAGACAGGACAGCTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015757407_1015757413 -1 Left 1015757407 6:136621645-136621667 CCTTAGCTTTAGCCCCCTTAGGT 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG 0: 1
1: 0
2: 7
3: 55
4: 280
1015757405_1015757413 25 Left 1015757405 6:136621619-136621641 CCTGGGCTGTGAATTTTACAAGT 0: 2
1: 2
2: 24
3: 77
4: 287
Right 1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG 0: 1
1: 0
2: 7
3: 55
4: 280
1015757404_1015757413 26 Left 1015757404 6:136621618-136621640 CCCTGGGCTGTGAATTTTACAAG 0: 2
1: 2
2: 20
3: 76
4: 371
Right 1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG 0: 1
1: 0
2: 7
3: 55
4: 280
1015757403_1015757413 27 Left 1015757403 6:136621617-136621639 CCCCTGGGCTGTGAATTTTACAA 0: 1
1: 1
2: 11
3: 72
4: 350
Right 1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG 0: 1
1: 0
2: 7
3: 55
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015757413 Original CRISPR TGAGACAGGACAGCTAGAGT TGG Intronic
904348790 1:29891571-29891593 TGAGCCAGGTCATTTAGAGTTGG - Intergenic
905294436 1:36945333-36945355 TGAGACTGGGCAGCTAGAGGGGG + Intronic
905370600 1:37480730-37480752 TGAGTCGAGACAGCCAGAGTTGG + Intronic
905664039 1:39751451-39751473 TGAGGCAGGACTGCTTGAGCTGG - Intronic
905775732 1:40665936-40665958 TGAGAAAGAACAGATAGGGTAGG - Intergenic
907130971 1:52096619-52096641 TGAGGCAGGAGACCAAGAGTTGG + Intergenic
907322514 1:53614297-53614319 AGAGACAGGACAGTCAGAGAAGG + Intronic
908257895 1:62318023-62318045 TGACACAGGAAAGCTACACTGGG - Intronic
908438353 1:64129173-64129195 TGAGACAGAAAAGCAAGAATTGG + Intronic
909597651 1:77423948-77423970 TGGGACAGGATGGCTAGAGGTGG - Intronic
910084597 1:83384598-83384620 TGGGACAGGATGGCTACAGTGGG - Intergenic
910391169 1:86746196-86746218 TGAGACTGGGAAGCTAGTGTTGG + Intronic
911133587 1:94416586-94416608 AGAGACAGGAGGGCCAGAGTAGG - Intergenic
911373138 1:97018220-97018242 TGGGACAGGATGGCTAAAGTGGG - Intergenic
911713238 1:101098835-101098857 TGGAATAGGACAGCTAGAATAGG + Intergenic
911729696 1:101280033-101280055 TGACAGAGGAGAGCTTGAGTTGG + Intergenic
911847463 1:102772565-102772587 TGGGACAAGATAGCTAGAGTGGG + Intergenic
912553976 1:110502810-110502832 TGAGACAGCACTGCTAGTGGAGG + Intergenic
912961721 1:114201989-114202011 AGATACAGGTCAGCTAGACTTGG - Intergenic
913274533 1:117123929-117123951 TGAGAAAGGAAAGGTAGAGGTGG - Intergenic
913988919 1:143591319-143591341 TGCAACAGGACAGGTAGAGAGGG + Intergenic
915023478 1:152804645-152804667 TGACATAGGACAGACAGAGTTGG + Intronic
915473574 1:156139598-156139620 AGAGAGAGGACAGCTTGAGCCGG + Exonic
915806443 1:158858553-158858575 TGTAACAGGACAGCTAGAGAGGG - Intergenic
915977951 1:160402789-160402811 TGAGAGAGGACAGGGAGAGAAGG - Intronic
919102906 1:193116029-193116051 TGGGACAGGATAGCTAAAGCAGG - Intergenic
919581877 1:199386798-199386820 TGACACAGGAAGGCTAGAGGTGG - Intergenic
919733759 1:200931342-200931364 TGAGGCAGGACAGTTACAGCAGG - Intergenic
920034634 1:203057992-203058014 TGGGACTGGACAGCTAGGCTGGG + Intronic
920592047 1:207229667-207229689 TGATACAGGTCAGGAAGAGTAGG - Intergenic
920690063 1:208139418-208139440 TGAGGCATGAGAGCTAGAATGGG + Intronic
920795696 1:209134129-209134151 TGAGACAGGAGGGCCAGAGGGGG - Intergenic
921095306 1:211882085-211882107 AGACACAGGACTACTAGAGTGGG - Intergenic
922655529 1:227379277-227379299 TTGGACAGAACAGCTAAAGTGGG - Intergenic
922853952 1:228758047-228758069 AAAGACAGAACAGCTAGAGGTGG + Intergenic
1063895395 10:10676209-10676231 TGAGACAGGATGGCTGGAGTGGG + Intergenic
1066335796 10:34476989-34477011 TTAGTCAGGACAGTTAGAGGTGG - Intronic
1066498349 10:35964694-35964716 TGAGACAGGATTGCTAGAAGGGG - Intergenic
1066626066 10:37406966-37406988 TGAGACAGGATTGCTAGAAGGGG - Intergenic
1068829960 10:61482750-61482772 GGAGACAGGAGAGCAAGAGAAGG - Intergenic
1069043274 10:63717060-63717082 AGAGACAGGAGAGCTGGAGGAGG + Intergenic
1069210816 10:65758278-65758300 TGAGACAGGAAGGTTAGAGATGG + Intergenic
1069587077 10:69614241-69614263 TGAGACAGGAAGGCTAGAGGAGG - Intergenic
1069905864 10:71731731-71731753 AGAGATAGGACAGAAAGAGTTGG - Intronic
1071279187 10:84084415-84084437 TGAGACAGGAAGGCTAGAGACGG + Intergenic
1072120031 10:92398030-92398052 TGAGACAGGCTGGCTAGAATGGG - Intergenic
1072453682 10:95558990-95559012 AGAGGCAGGACAGCTAGCTTTGG - Intronic
1072825697 10:98603890-98603912 TGGAACAGGATGGCTAGAGTGGG - Intronic
1073177952 10:101568043-101568065 TAAGACAGGCCAGCAGGAGTAGG + Intergenic
1076637447 10:131891608-131891630 TCTGAGAGGACAGCTAGAGGGGG - Intergenic
1077360532 11:2138588-2138610 GGAGAGAGGACAGCGAGAGGCGG + Intronic
1077499078 11:2901121-2901143 AGAGACAGGAGAGCAAGAGAAGG + Intronic
1078733835 11:14001496-14001518 TGAGACAGGAAGGCTAGACAGGG - Intronic
1080286846 11:30624896-30624918 TGGGACAGGATGGCTACAGTAGG + Intergenic
1081133329 11:39407097-39407119 TGGGAAAGGAGAGCTAGAGTGGG - Intergenic
1081340376 11:41920406-41920428 AGGGACAGGACAGCTAAAGTGGG + Intergenic
1081678775 11:44987447-44987469 TTGGAGAGGACAGCTAGGGTGGG - Intergenic
1083034284 11:59622121-59622143 TGGGACAGGAAAGCAAGATTAGG - Intergenic
1088336758 11:108713937-108713959 TGGGAAAGGATGGCTAGAGTTGG + Intronic
1089143522 11:116307441-116307463 AGAGATGGGAAAGCTAGAGTGGG - Intergenic
1090009181 11:123030793-123030815 TGAGACAGGACTGCTTCAGGAGG - Intergenic
1090143525 11:124292753-124292775 TGGGACAGAATGGCTAGAGTGGG + Intergenic
1090395465 11:126415434-126415456 TGGGACAGGACAGATAAAGAGGG + Intronic
1091692093 12:2604268-2604290 TGAGACAGGAGGGCAAGAGAAGG + Intronic
1092750799 12:11717559-11717581 TCAGACATGACAGCTAGAGATGG - Intronic
1095231319 12:39743244-39743266 TGGGAAAGGACAGCTACAGTAGG - Intronic
1096836730 12:54355890-54355912 GGAGAGAGGAAAGCTGGAGTGGG - Intergenic
1096908509 12:54959240-54959262 TGGGACGGGATGGCTAGAGTAGG + Intronic
1098655017 12:73016931-73016953 TGAGACCGGAAGGCTAGAGAAGG + Intergenic
1098838674 12:75452733-75452755 TGAGACAAGATGGCTAGAGTGGG + Intergenic
1099420866 12:82458866-82458888 TGGCACAGGATGGCTAGAGTAGG - Intronic
1099656509 12:85499142-85499164 AAAGACAGGAGAGGTAGAGTAGG + Intergenic
1101470086 12:104987647-104987669 TGAGGCTGGAAAGGTAGAGTGGG + Intronic
1103857634 12:123984479-123984501 GGAGACAGGGTAGCTAGAGAAGG + Intronic
1104229889 12:126874516-126874538 AGAGAAAGGACAGCAGGAGTGGG + Intergenic
1107920023 13:45196840-45196862 TGAGTCAGGACAGCTGGAAGTGG + Intronic
1108035947 13:46290810-46290832 TCTGACAGGAGACCTAGAGTGGG - Intergenic
1111017997 13:82405943-82405965 TGAGGCAGGAAGGCTAGAGTAGG - Intergenic
1111187394 13:84756843-84756865 TGGGAAAGAACAGCTAGAGTGGG + Intergenic
1111766473 13:92536545-92536567 TCAGGCTGGACACCTAGAGTGGG - Intronic
1111818141 13:93180828-93180850 TGACACAGGATGGCTAGAGCTGG + Intergenic
1112605726 13:100904107-100904129 TGAGACAGGAAGGCTACTGTGGG + Intergenic
1113709605 13:112454765-112454787 TGACACAGGACAGATGGAGCTGG + Intergenic
1116355877 14:43929047-43929069 TGAGAAAGGATGGCTACAGTGGG - Intergenic
1116528042 14:45932040-45932062 TGAGACAGGAAAGGTAAAGGGGG - Intergenic
1117247315 14:53899239-53899261 TGAGGCAGCATAGCTAGACTGGG + Intergenic
1117420749 14:55542705-55542727 TGAGACAAGATAGCTAGAGGAGG - Intergenic
1118300815 14:64614431-64614453 AGAGACAGGACATCTTGTGTTGG - Intergenic
1118994025 14:70821418-70821440 TGAGAAAGGACAGCTGAGGTTGG + Intergenic
1119118076 14:72045730-72045752 TGAGATAGGAAGGCTAGAGGGGG + Intronic
1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG + Intergenic
1119390428 14:74287900-74287922 GGAGAGAGGACTGCTAGAGGAGG + Intronic
1119526061 14:75323394-75323416 TGAGCCAGGACAGCTGGAGCAGG - Intergenic
1122258100 14:100494667-100494689 TAGGACAGGACAGCTAGAATGGG + Intronic
1123928997 15:25148830-25148852 TAAAACAGGAAAGCTAGAGAAGG - Intergenic
1124171832 15:27381163-27381185 TGAGACAGGAAGGCTAGAGGGGG + Intronic
1124589635 15:31041531-31041553 TGGGACAGGATGGCTAGAGGGGG - Intronic
1124714068 15:32042265-32042287 TGCGATAGGATGGCTAGAGTGGG + Intronic
1125846482 15:42859466-42859488 TGAGACAGGATAGTTAGAATGGG - Intronic
1126032597 15:44514207-44514229 TGAGACAGGTCAGCTAGAGGTGG + Intronic
1126611316 15:50532383-50532405 TGGAACAGGATGGCTAGAGTGGG - Intronic
1126775229 15:52094603-52094625 TGAGTCAGAACAGCTAGATCTGG - Intergenic
1128400762 15:67278091-67278113 TGAGAGAGGAAGGTTAGAGTGGG + Intronic
1128712674 15:69883987-69884009 TGAGAGAGGACAGGGTGAGTAGG - Intergenic
1130462391 15:84168836-84168858 TGAGACAGGCCAGCGTGTGTGGG - Intergenic
1130474010 15:84247758-84247780 TGAGACAGGCCAGCGTGTGTGGG - Intergenic
1130481425 15:84361826-84361848 TGAGACAGGCCAGCGTGTGTGGG - Intergenic
1130501873 15:84504707-84504729 TGAGACAGGCCAGCGTGTGTGGG + Intergenic
1131409797 15:92197989-92198011 AGAAACAGGAGAGCTAGAGAAGG + Intergenic
1131837291 15:96403542-96403564 TGAGACACCTCAGCAAGAGTGGG - Intergenic
1132204348 15:99976227-99976249 AGAGACAGGACAGCCTGAGTGGG + Intronic
1132204362 15:99976301-99976323 GGAGACAGGACAGCCTGAGTGGG + Intronic
1132204380 15:99976376-99976398 GGAGACAGGACAGCCTGAGTGGG + Intronic
1135385422 16:22035243-22035265 TGAGACAGGAAAGCTAGAGAGGG + Intronic
1135718791 16:24796469-24796491 CTAGAAAGGACAGCTTGAGTTGG + Intronic
1136493570 16:30626920-30626942 TGAGACATGCAAGCTGGAGTGGG - Intergenic
1139766324 16:69233422-69233444 TGAGACAGGAGATCAAGATTGGG + Intronic
1140241204 16:73202637-73202659 TGAGCCTGGAAAGCTAGACTGGG - Intergenic
1140974996 16:80051188-80051210 TGAGACAGGACAGCTCCAGGTGG - Intergenic
1141680525 16:85541258-85541280 TGCAAGAGGACAGCTTGAGTTGG + Intergenic
1142020767 16:87780832-87780854 AGACACAGGAAAGCTAGACTGGG - Intergenic
1142929575 17:3271227-3271249 TGAGACAGGAAGTTTAGAGTTGG - Intergenic
1143557114 17:7668730-7668752 TGAGGCAGGACTGCTCGAGCCGG + Exonic
1144226448 17:13152991-13153013 TGGGACAGAATGGCTAGAGTGGG + Intergenic
1145228605 17:21152800-21152822 TGGGACAGGATGGCTAGAGAGGG - Intronic
1148980082 17:51566065-51566087 GGAGACAGAACAACTAGGGTAGG - Intergenic
1149375895 17:56043635-56043657 TGAGAAAGGACAGCTGGTGAGGG + Intergenic
1149891035 17:60391243-60391265 TGAGACTGGACAGCTGGCGTTGG - Intronic
1150420656 17:65032291-65032313 AGAGAAAGGACAGATAGGGTGGG - Intronic
1150575388 17:66426208-66426230 TCAGACAGTCCAGCTGGAGTGGG + Intronic
1151438848 17:74115267-74115289 TGAGACAGGCCTGCTAGTGACGG - Intergenic
1152491888 17:80640602-80640624 TGAGTCAGGGCAGGGAGAGTGGG + Intronic
1153051591 18:906771-906793 TGACACAGGACGGGTAGAGATGG - Intronic
1153105802 18:1524618-1524640 TGAGACAGGTAGGGTAGAGTAGG + Intergenic
1153816310 18:8793259-8793281 TGAGAGGGGACAGCTTGACTGGG - Intronic
1154115086 18:11607080-11607102 TGAGAAAGGACGCCGAGAGTGGG + Intergenic
1155855908 18:30834073-30834095 TGGGACAGAATGGCTAGAGTGGG - Intergenic
1155857975 18:30858738-30858760 TGCCCCAGGACAGGTAGAGTGGG + Intergenic
1155994119 18:32312037-32312059 TGAGACAGGACAGCTTTGGAGGG + Intronic
1156472898 18:37388550-37388572 TGCAACAGGAAAGCTAGAGAGGG - Intronic
1157560534 18:48642492-48642514 GGAGGCAGCACAGCTAGAGGAGG + Intronic
1158051520 18:53226345-53226367 TGAGAAAGGAGAGCTAGAAGAGG + Intronic
1158496533 18:57960119-57960141 TGAGATAGGAAACCTAGAGAAGG + Intergenic
1160480102 18:79232164-79232186 TGAGACAGGAAGACTAGAGGGGG - Intronic
1161122856 19:2539714-2539736 TGAGACAGGGCAGCTGGGGGAGG - Intronic
1163072365 19:14854942-14854964 TGAGACAAGACAGCAGGAGAAGG + Intergenic
1166345259 19:42161714-42161736 AGAGACAGGACAGATGGAGGAGG - Intronic
925154739 2:1640407-1640429 GGAGACAGGAAAGCTAGCATGGG - Intronic
925519781 2:4730634-4730656 TGAGACAGAAAGGCTGGAGTTGG - Intergenic
928478621 2:31657058-31657080 TGAGACAGGACAACTAAATATGG + Intergenic
928537545 2:32255031-32255053 TGAGAAAGGACGGCTGGGGTGGG - Intronic
928959687 2:36911246-36911268 TAAGATATGACAGCTAGAGAGGG - Intronic
929770512 2:44887892-44887914 TGAGAAAAGAAAGCTAGAGACGG + Intergenic
929900659 2:46000372-46000394 TAGGACAGGATGGCTAGAGTGGG + Intronic
930523921 2:52502203-52502225 TGGGACAGGATGGTTAGAGTGGG - Intergenic
931023276 2:58075720-58075742 TGAGATAGGAAAGCTAGAAGAGG + Intronic
931275448 2:60740096-60740118 TGAGGCAGGACAGCCTGAGCTGG - Intergenic
932786900 2:74613510-74613532 TGGGACAGGATGGCTAGAGTGGG + Intronic
933790302 2:85878912-85878934 GGAGACAGGACAGAGAGAGGAGG + Intronic
935184786 2:100722201-100722223 TGTGGCAGGACAGCCAGAGTGGG + Intergenic
935847798 2:107185720-107185742 TGAGACAGGAAAGCCAGAGAGGG - Intergenic
936070217 2:109364727-109364749 TGAAACAGGATGGCTACAGTGGG + Intronic
936161569 2:110087362-110087384 AGAGAGAGGAAAGCTGGAGTGGG + Intronic
936183094 2:110283992-110284014 AGAGAGAGGAAAGCTGGAGTGGG - Intergenic
938176668 2:129139256-129139278 TGAGACAGGCAGGCTAGAGGGGG + Intergenic
941206120 2:162575316-162575338 TCAGACAAGAAAGCCAGAGTAGG - Intronic
941288565 2:163645711-163645733 TGAGCGAGGCTAGCTAGAGTAGG - Intronic
941998903 2:171627052-171627074 GGAGACAGGAGACCCAGAGTGGG - Intergenic
942149583 2:173061866-173061888 GGATACAGCACAGCTAGAGGAGG - Intergenic
942527660 2:176872439-176872461 TGAGACAGGACGACTGGAGGGGG + Intergenic
942714293 2:178873599-178873621 AGAGAAAGGAGAGCTAAAGTAGG + Intronic
942810993 2:180001248-180001270 TGAGACAGTAAAACTAGAGAGGG - Intronic
944393670 2:199245953-199245975 TGAGACAGAAAGGCTATAGTGGG + Intergenic
944881178 2:204014488-204014510 TGAGACAGGAAGGCTAGGGAAGG + Intergenic
945812540 2:214566232-214566254 TGAGACTAGACAGCTACAGCTGG + Intronic
946051590 2:216867278-216867300 TGAGGCAGGAGAGACAGAGTGGG - Intergenic
948053709 2:234996371-234996393 AGAGACAGGACAGAAAGGGTGGG - Intronic
1168988101 20:2068189-2068211 TGGGACAAGATGGCTAGAGTTGG - Intergenic
1170754807 20:19191574-19191596 TGAGAATGGACAGATAGAGCAGG - Intergenic
1173066642 20:39719479-39719501 TGAGTCAGGAAATCTAGGGTGGG - Intergenic
1173365384 20:42380369-42380391 TGAGGCAGGACAGTGAGTGTGGG - Intronic
1174373149 20:50107508-50107530 TGAGTCAGGACAACTGGAGAAGG + Intronic
1175289582 20:57866635-57866657 TGAGACAAGAAGGCTAGAGGGGG + Intergenic
1175324860 20:58116561-58116583 TGAGACAGGAAAGCTAGAGGGGG - Intergenic
1175869254 20:62200130-62200152 TGAGAGGGGACAAATAGAGTGGG - Intronic
1177957658 21:27619984-27620006 TGAAACAGGAAGGCTAGAATGGG + Intergenic
1181770618 22:25122643-25122665 TGATACAGGACAGGCAAAGTGGG - Intronic
1184490120 22:44803589-44803611 GGAGAGAGGACAGCCACAGTAGG - Intronic
1184828824 22:46971166-46971188 TGAGAAATGACACCTAGAATAGG + Intronic
1184905789 22:47485615-47485637 TGAGACAGGAAAGCTACAGGGGG - Intronic
1185160077 22:49219217-49219239 TGGGGCAGGATAGCGAGAGTGGG - Intergenic
1185224838 22:49646577-49646599 GGGGACAGGACAGCTAGAACTGG - Intronic
949366332 3:3285464-3285486 TGAGGCAGGAAAGCTGGAGGAGG + Intergenic
949453031 3:4208232-4208254 TGGGACAGGATGGCTAGAGGGGG - Intronic
950249615 3:11453474-11453496 TGAGAGAGAACAGCTAGAAAAGG + Intronic
950843852 3:15995706-15995728 TGGGACAGGATGGCTAGAATGGG + Intergenic
951341256 3:21490117-21490139 TGAGTCAGGACAACAAGAGTTGG - Intronic
951620991 3:24602351-24602373 AGAGACTGGGCAGATAGAGTGGG - Intergenic
952917758 3:38262191-38262213 TGGGACAGGATGGCTAGAGCAGG + Intergenic
955146995 3:56329586-56329608 AGAGACAGGAAAGCTAGAAGGGG - Intronic
956013993 3:64861899-64861921 GGAGACAGGACAGCTAGCAGGGG - Intergenic
959300071 3:104587765-104587787 TGAGACAGGAGGTCTAAAGTAGG - Intergenic
959368013 3:105488119-105488141 TGAGACAGGAAAACAAGGGTTGG - Intronic
959456310 3:106566721-106566743 TGGGACAGGATGGCTAAAGTGGG - Intergenic
959652017 3:108759339-108759361 TGAGTCAGCAGAGCTAGAGCTGG - Intergenic
960749906 3:120937028-120937050 GGAGACAGGAAGGCTAGAGTTGG + Intronic
961932496 3:130548400-130548422 TGAGACTGGATGGCTAGAGTGGG + Intergenic
962899506 3:139746774-139746796 TGGGACATGATAGCTAGAGTAGG - Intergenic
963013184 3:140794696-140794718 TGACAGAGGATAGCTAGAGTGGG - Intergenic
965446348 3:168779499-168779521 TGAGATAGGATGGCTAGATTTGG - Intergenic
965567652 3:170137897-170137919 TGAGAAAGGACAGCTTGTTTTGG - Intronic
966165338 3:177010457-177010479 TGAGGCAGGACAGATGGGGTTGG + Intergenic
967138036 3:186529050-186529072 TGAGTCAGGAGAGGTAGATTTGG + Intergenic
967743537 3:193029395-193029417 TGAGGCAGGAGAGTCAGAGTCGG + Intergenic
968052428 3:195664273-195664295 TGAGACAGGACACATAGTGCTGG + Intergenic
968103382 3:195984067-195984089 TGAGACAGGACACGTAGTGCTGG - Intergenic
968284012 3:197497667-197497689 TGGGACAGCCCAGCTAGAGACGG - Intergenic
968301689 3:197621659-197621681 TGAGACAGGACACGTAGTGCTGG - Intergenic
968439613 4:616678-616700 TGAGACAGGATGGCTCGAGGGGG + Intergenic
971074317 4:23130130-23130152 TAAGACAGGATACCTAGAGTGGG - Intergenic
971079424 4:23192710-23192732 TGAGTCAGGAAAGCTAGAGAAGG + Intergenic
974331701 4:60487692-60487714 TGAGACAGAAAGGCTAGAGGGGG + Intergenic
974525890 4:63049763-63049785 TGAGACAGGAAGGCTAGAGTGGG + Intergenic
974573540 4:63687570-63687592 TGAGTCAGGAAAGCTAGAGAGGG - Intergenic
974808964 4:66920926-66920948 TGGGACAGGATGGCTAGAGGGGG + Intergenic
977812058 4:101367612-101367634 TGAGACAGGATAGCGAAATTGGG - Intergenic
979491951 4:121338335-121338357 TGAGATAGAAGGGCTAGAGTTGG + Intronic
980218639 4:129884274-129884296 GGAGACAGGAATGCTAGAGTTGG - Intergenic
980400026 4:132271199-132271221 TGATACAGAACATCTAGAATAGG + Intergenic
981571040 4:146150834-146150856 TGAGACAGGAAGGCTACAGAGGG + Intergenic
982458638 4:155640207-155640229 TGAAGCAGGAAGGCTAGAGTTGG - Intergenic
982571585 4:157057291-157057313 TGAGACAGAAAAGCTAGAGGAGG + Intergenic
982627386 4:157785108-157785130 TGGGACAGGAGAACTGGAGTGGG + Intergenic
984137699 4:175961832-175961854 TGAAACAGGAAGGCTAGAGTGGG - Intronic
984294404 4:177836018-177836040 TGAGACAGTAGATCTGGAGTAGG + Intronic
984298170 4:177880851-177880873 TGGGACAGGATGGCTAGAGTGGG + Intronic
984844018 4:184094771-184094793 TGAGATAAGACAGCAGGAGTGGG - Intronic
984861348 4:184243033-184243055 TGGGACAGGATGGCTAGAGTGGG + Intergenic
985498634 5:226069-226091 TGAGACAGGACACGTAGTGCTGG + Intronic
985759882 5:1742957-1742979 TGGAACAGGATGGCTAGAGTGGG + Intergenic
986350358 5:6872462-6872484 TGAGACAGTAATGCTAGTGTGGG - Intergenic
986616322 5:9621127-9621149 TCACACAGGACTGCAAGAGTGGG - Intergenic
986697684 5:10373337-10373359 TGGAACAGGACAGGTGGAGTGGG - Intronic
987666570 5:20949585-20949607 TGAGACAGCATAGCTAGAGGGGG + Intergenic
988648037 5:33117648-33117670 TGAGACAGAATGGCTAAAGTGGG + Intergenic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
989485629 5:41988231-41988253 TGGCACAGGATAGCTAAAGTGGG + Intergenic
990472641 5:56130372-56130394 TGGGACAGGATAGCTAGAGTGGG - Intronic
991428590 5:66518770-66518792 TGGGACAGGACAGCTAAAGCAGG + Intergenic
992033384 5:72746758-72746780 TGGGACAGGATGGCTAGAGGAGG - Intergenic
992601430 5:78404642-78404664 TGGGACAGAATGGCTAGAGTTGG + Intronic
992855871 5:80861360-80861382 TGGGATAGGAAGGCTAGAGTGGG + Intronic
994014139 5:94945748-94945770 TCAGAAAGGACAACGAGAGTGGG + Intronic
996807678 5:127475738-127475760 TGAGACAGGATGGCTACAGGGGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997921454 5:137983153-137983175 TGAGAAAGAACAGCCAGTGTAGG + Intronic
998421945 5:141995523-141995545 TGAGACAGGAAGGCTAGAAGGGG - Intronic
999468399 5:151829055-151829077 TCACATAGGACACCTAGAGTGGG + Exonic
999657287 5:153823003-153823025 AGAGACTGGACACCTACAGTTGG + Intergenic
1002040169 5:176507687-176507709 TAAGAAAGGACAGCAAGAGTTGG - Exonic
1002044563 5:176534625-176534647 TGTCACAGCACAGCTAGATTTGG + Intronic
1002213772 5:177613603-177613625 TGAGACAGGAAGGCTAGAGGCGG - Intergenic
1002970538 6:2013007-2013029 GGAGACAGGACAGATAGATGCGG - Intronic
1003748696 6:9031623-9031645 TGAGACAAGAAAGTTTGAGTGGG + Intergenic
1004994954 6:21181435-21181457 AGAGGGAGGACAGCAAGAGTGGG - Intronic
1005595980 6:27379901-27379923 TGGGACAGGATGACTAGAGTGGG - Intronic
1005633443 6:27731081-27731103 TGGGACTGGATGGCTAGAGTGGG + Intergenic
1005683579 6:28230508-28230530 AGAGACAGGACAGTTAGATATGG + Intronic
1008703814 6:54133118-54133140 TGAGACTGGATAGCAAGAGAGGG + Intronic
1010265678 6:73863230-73863252 TGAGCCAGGATAGTTAGAGGTGG - Intergenic
1011327055 6:86160223-86160245 TGATACAGGAGATTTAGAGTGGG - Intergenic
1012566985 6:100669476-100669498 TGAGACAGGAAAACTTGATTTGG + Intronic
1014086437 6:117351251-117351273 TGGGACACGACGGCTGGAGTGGG + Intronic
1014901048 6:126966074-126966096 TGAGGCAGGAAAGCAAAAGTGGG - Intergenic
1015053326 6:128868938-128868960 AGAGACAGGTCAGCGAGAATGGG - Intergenic
1015757413 6:136621667-136621689 TGAGACAGGACAGCTAGAGTTGG + Intronic
1016196331 6:141347042-141347064 TGAGACAGGAAGGCTAGAAGGGG + Intergenic
1017335851 6:153259124-153259146 TGGGACAGGATGGCTAGACTAGG + Intergenic
1017678520 6:156840088-156840110 TGAGACAGGAAAACTACAGGAGG - Intronic
1017721726 6:157247834-157247856 TGAGGCAGAACTGCTTGAGTCGG - Intergenic
1020587979 7:10095595-10095617 TGGGACAGGATGGCTAGAGGAGG + Intergenic
1021031286 7:15739569-15739591 TGAGACAGGAAGGCTAGAGAAGG - Intergenic
1021043668 7:15894416-15894438 TAGGACAGGATAGCTACAGTAGG - Intergenic
1021746860 7:23749855-23749877 TGGGATAGGATGGCTAGAGTAGG + Intronic
1023381500 7:39612802-39612824 GGAGGCAGGACAGTCAGAGTTGG + Intergenic
1023524976 7:41092680-41092702 TGGGACAGGAAAGCTAGAGTGGG + Intergenic
1024601893 7:50989263-50989285 TGACACTGGCCACCTAGAGTTGG - Intergenic
1024714044 7:52054260-52054282 TGAGACAGGGCAGCCGGAATAGG + Intergenic
1025972715 7:66342965-66342987 TAAGACAGGAAGGCTAGAGAGGG - Intronic
1027487666 7:78782184-78782206 TGAAACACGTCAGCTGGAGTTGG + Intronic
1027653126 7:80896361-80896383 TGAGAAAGGACTCCTAGAGTTGG - Intronic
1028063690 7:86353365-86353387 TGGTACAGCTCAGCTAGAGTGGG - Intergenic
1029977775 7:104850381-104850403 GGAGACAGGAGAGCAAGAGAAGG + Intronic
1030459368 7:109811868-109811890 TGAAACAGGATGGCTAGAATGGG + Intergenic
1030992352 7:116315532-116315554 TGAATCAGGACAGCTAGAGCTGG + Intronic
1031332697 7:120485695-120485717 TTAGAAAGAATAGCTAGAGTAGG - Intronic
1032774342 7:135095153-135095175 TGAGACAGGAAGACTAGAGGAGG - Intronic
1033910129 7:146253115-146253137 TGAGTCAGGAAAGCTAGATTGGG - Intronic
1037017407 8:13925628-13925650 TAAGACAGGATGGCTAGAGGGGG + Intergenic
1037119160 8:15262452-15262474 TGAGACAGGAAAGATAAAGGGGG - Intergenic
1037119466 8:15265960-15265982 TGAGACAGCATGGCTAGAGTGGG - Intergenic
1037133320 8:15432768-15432790 TGAGGCAGGATAGCTAGAGCGGG + Intronic
1037387255 8:18356655-18356677 TGAAGCAGGAAAGCTAGAGGAGG + Intergenic
1038512416 8:28151691-28151713 TGGGACAGGATGACTAGAGTGGG + Intronic
1040088040 8:43365745-43365767 GGAGGCAAGACAGCTAGGGTGGG - Intergenic
1041626022 8:60028023-60028045 TGAGATAGGAGAGCCAGGGTGGG - Intergenic
1042192786 8:66204819-66204841 TGAGACAGAACAGCTATCTTGGG + Intergenic
1042832072 8:73041527-73041549 TGAGACATGAAGGCTAGAGAGGG + Intronic
1044008973 8:86968063-86968085 TGGGACAGAATGGCTAGAGTGGG + Intronic
1045424498 8:102051097-102051119 AGAGACAGGGCAGAGAGAGTTGG - Intronic
1046260465 8:111760254-111760276 TGAGACAGGAAAGCTAGCTTGGG - Intergenic
1047019604 8:120760801-120760823 TGAGACAGGAAGGCTAGATGGGG - Intronic
1047573632 8:126129727-126129749 TGGGACAGGATGGCTGGAGTAGG - Intergenic
1047775522 8:128067371-128067393 GGAGACAGGACAGGCAGAATGGG - Intergenic
1047896885 8:129376208-129376230 TGACACAGGAAGGCTAGAGGGGG - Intergenic
1048179271 8:132180333-132180355 GGAGAGAGGACAGACAGAGTGGG + Intronic
1048954852 8:139527169-139527191 GGAGCAAGGACAGCTACAGTGGG + Intergenic
1049822737 8:144645995-144646017 CGAGGCAGGATAGCTAGAGAAGG + Intergenic
1049878579 8:145045294-145045316 TGAGACAGAAAGGCTAGAGCAGG + Intergenic
1049935227 9:495249-495271 TGACAAAGGACAGCCAGAGGAGG - Intronic
1050038883 9:1466447-1466469 TTCAACAAGACAGCTAGAGTTGG - Intergenic
1050080922 9:1914958-1914980 TGAGAGAGGAAAGCAAAAGTAGG + Intergenic
1053519219 9:38761350-38761372 TGAGACAGGAAATCTAAAGGGGG + Intergenic
1055078960 9:72248002-72248024 TGAGAAAGGACAGCTATAGGGGG + Intronic
1055211761 9:73803507-73803529 TGACACAGGAAATATAGAGTAGG + Intergenic
1055690347 9:78823488-78823510 TGAGGCAAGGCAGCTAGCGTTGG + Intergenic
1055906168 9:81295494-81295516 TGAGACAGAATGGCTAGAGTGGG - Intergenic
1055976926 9:81964793-81964815 TGAGACACGAAGGCTAGAGAGGG + Intergenic
1055987605 9:82067617-82067639 TGAGACAGGAAGTCTAGTGTGGG + Intergenic
1056689458 9:88794266-88794288 TGAGACAGGAAGTCTAGAGTGGG - Intergenic
1057294145 9:93825679-93825701 GCAGAGAGGACAGCTAGAGGAGG - Intergenic
1057872715 9:98730435-98730457 TGTGCCAGGGCAGCTAGAGAGGG - Intergenic
1060783842 9:126433534-126433556 CGGAACAGGAGAGCTAGAGTAGG - Intronic
1062526983 9:136981879-136981901 TGAGTCAGGACAGCTAGGAGGGG + Intronic
1186579719 X:10804751-10804773 TGAGACAGGAAAGCTACAGAGGG + Intronic
1187115528 X:16346500-16346522 TGGGACAGGATAGCTAGAAAAGG + Intergenic
1187531746 X:20103327-20103349 TGAGACAGGACAGAGAGGATTGG + Intronic
1188221224 X:27543800-27543822 TGAGACAGGAGGGCAAGAGATGG + Intergenic
1189052748 X:37663732-37663754 TGAGAGAGGCCAGCAAGAGCAGG + Intronic
1193336228 X:80293120-80293142 TGAGACAGGGCAACTGGGGTAGG - Intergenic
1193449762 X:81651452-81651474 TGGGACAGGATGGCTAGAATGGG + Intergenic
1196877249 X:120166174-120166196 TGAGACAGCAGAGATATAGTAGG - Intergenic
1198408654 X:136342769-136342791 TGAGACTGAAGAGCTAGAGAGGG + Intronic