ID: 1015762355

View in Genome Browser
Species Human (GRCh38)
Location 6:136677941-136677963
Sequence TGACAACTCTTTAAAGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015762350_1015762355 27 Left 1015762350 6:136677891-136677913 CCAGGTACAAGGCATTGAATGAG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1015762355 6:136677941-136677963 TGACAACTCTTTAAAGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015762355 Original CRISPR TGACAACTCTTTAAAGTAGG GGG Intronic
No off target data available for this crispr