ID: 1015763753

View in Genome Browser
Species Human (GRCh38)
Location 6:136693349-136693371
Sequence CTGGAAAAGCACAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015763753_1015763759 25 Left 1015763753 6:136693349-136693371 CCTTCCACCTTGTGCTTTTCCAG 0: 1
1: 0
2: 1
3: 35
4: 342
Right 1015763759 6:136693397-136693419 TTATTCTTTCAAATAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015763753 Original CRISPR CTGGAAAAGCACAAGGTGGA AGG (reversed) Intronic
901235327 1:7664559-7664581 CTGGAACTGCATGAGGTGGAGGG - Exonic
901235327 1:7664559-7664581 CTGGAACTGCATGAGGTGGAGGG - Exonic
901342807 1:8510634-8510656 ATAGAAAAGGACAAGTTGGAAGG - Intronic
901342807 1:8510634-8510656 ATAGAAAAGGACAAGTTGGAAGG - Intronic
903766150 1:25735930-25735952 ATGGAAAAGCACAAGGTTAATGG + Intronic
903766150 1:25735930-25735952 ATGGAAAAGCACAAGGTTAATGG + Intronic
905513312 1:38541698-38541720 ATGGAAAAGCACACAGTTGAGGG + Intergenic
905513312 1:38541698-38541720 ATGGAAAAGCACACAGTTGAGGG + Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905949116 1:41931536-41931558 CTGAAAAAGCACAAAGTTGGAGG - Intronic
905949116 1:41931536-41931558 CTGAAAAAGCACAAAGTTGGAGG - Intronic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906711491 1:47933429-47933451 CTGCCAAAGCACAAAGTGCAAGG - Intronic
906711491 1:47933429-47933451 CTGCCAAAGCACAAAGTGCAAGG - Intronic
907499226 1:54866182-54866204 CTGGAAAAGCACAAGCTTTAGGG + Intronic
907499226 1:54866182-54866204 CTGGAAAAGCACAAGCTTTAGGG + Intronic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908439959 1:64143510-64143532 CTGGAAAAGCAAAAGCTACAGGG + Intronic
908439959 1:64143510-64143532 CTGGAAAAGCAAAAGCTACAGGG + Intronic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
909521620 1:76575278-76575300 ATTGAAAATCACAAGATGGAGGG - Intronic
909521620 1:76575278-76575300 ATTGAAAATCACAAGATGGAGGG - Intronic
909669403 1:78171415-78171437 CTGAAAAAGAACAAAGTTGAGGG - Intergenic
909669403 1:78171415-78171437 CTGAAAAAGAACAAAGTTGAGGG - Intergenic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
915881245 1:159674108-159674130 CTGGAAAAGGAAAATGTAGATGG + Intergenic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916674383 1:167053902-167053924 CTGGAGGGGCACCAGGTGGAGGG - Exonic
916674383 1:167053902-167053924 CTGGAGGGGCACCAGGTGGAGGG - Exonic
916996891 1:170310681-170310703 CTGGAAAGGCACAAAGTTAAGGG + Intergenic
916996891 1:170310681-170310703 CTGGAAAGGCACAAAGTTAAGGG + Intergenic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917763025 1:178184756-178184778 CTGAAAAAGAACAAAGTTGAAGG - Intronic
917763025 1:178184756-178184778 CTGAAAAAGAACAAAGTTGAAGG - Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920526464 1:206670550-206670572 TTGGAAAAGCACGGGGTTGAAGG + Intronic
920526464 1:206670550-206670572 TTGGAAAAGCACGGGGTTGAAGG + Intronic
920824321 1:209411342-209411364 CTTGGAAAGCACAATGTTGATGG - Intergenic
920824321 1:209411342-209411364 CTTGGAAAGCACAATGTTGATGG - Intergenic
921320551 1:213934347-213934369 CTGGAAACGGAAAAGGGGGATGG + Intergenic
921320551 1:213934347-213934369 CTGGAAACGGAAAAGGGGGATGG + Intergenic
921349653 1:214222555-214222577 CTGTAAATGCAAAAGCTGGAAGG + Intergenic
921349653 1:214222555-214222577 CTGTAAATGCAAAAGCTGGAAGG + Intergenic
921615030 1:217256598-217256620 ATAGCAAAGCACAGGGTGGAAGG - Intergenic
921615030 1:217256598-217256620 ATAGCAAAGCACAGGGTGGAAGG - Intergenic
921961100 1:221035191-221035213 GTGAAAGAGCACAAGGTAGAGGG - Intergenic
921961100 1:221035191-221035213 GTGAAAGAGCACAAGGTAGAGGG - Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922013692 1:221620873-221620895 CTGGAAGAGGGCCAGGTGGATGG - Intergenic
922677167 1:227560229-227560251 CAGAAAGAGCGCAAGGTGGAGGG - Intergenic
922677167 1:227560229-227560251 CAGAAAGAGCGCAAGGTGGAGGG - Intergenic
922677625 1:227562184-227562206 CAGAAAGAGCACGAGGTGGAGGG - Intergenic
922677625 1:227562184-227562206 CAGAAAGAGCACGAGGTGGAGGG - Intergenic
924852247 1:247841921-247841943 CTGGAAAAGCACAGGATGCAAGG + Intergenic
924852247 1:247841921-247841943 CTGGAAAAGCACAGGATGCAAGG + Intergenic
1063005382 10:1965204-1965226 CTGCAAAAACACAGGATGGAAGG + Intergenic
1063005382 10:1965204-1965226 CTGCAAAAACACAGGATGGAAGG + Intergenic
1063101021 10:2950381-2950403 CTGGAAAGGCTCCAGGTGCACGG - Intergenic
1063101021 10:2950381-2950403 CTGGAAAGGCTCCAGGTGCACGG - Intergenic
1063160660 10:3415965-3415987 CTGGAAAACCCCGAGATGGACGG + Intergenic
1063160660 10:3415965-3415987 CTGGAAAACCCCGAGATGGACGG + Intergenic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1065120646 10:22526948-22526970 CTTGAAAAGTACAAAGTTGAAGG - Intergenic
1065120646 10:22526948-22526970 CTTGAAAAGTACAAAGTTGAAGG - Intergenic
1067795947 10:49322379-49322401 CTGCAAAAGAAAAAGGTGCAGGG - Intronic
1067795947 10:49322379-49322401 CTGCAAAAGAAAAAGGTGCAGGG - Intronic
1068616999 10:59129809-59129831 CAGGAAAGCCACAAGTTGGAAGG + Intergenic
1068616999 10:59129809-59129831 CAGGAAAGCCACAAGTTGGAAGG + Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1069562572 10:69441226-69441248 CTATAAAAGAACATGGTGGAAGG - Intergenic
1071111338 10:82161069-82161091 CTGGGAAAGAACAAGGTATAGGG + Intronic
1071111338 10:82161069-82161091 CTGGGAAAGAACAAGGTATAGGG + Intronic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072742204 10:97916120-97916142 CTTGAAAATGACAAGGTGGAAGG - Intronic
1072742204 10:97916120-97916142 CTTGAAAATGACAAGGTGGAAGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073802270 10:107055066-107055088 CTGGAAGAGCACAGAGTGGAAGG + Intronic
1073802270 10:107055066-107055088 CTGGAAGAGCACAGAGTGGAAGG + Intronic
1073897051 10:108173989-108174011 CTGAAAAAGAACAAAGTTGAAGG - Intergenic
1073897051 10:108173989-108174011 CTGAAAAAGAACAAAGTTGAAGG - Intergenic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1078142581 11:8702809-8702831 CTGGAAAAGAGCAGGTTGGAAGG - Intronic
1078142581 11:8702809-8702831 CTGGAAAAGAGCAGGTTGGAAGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079519867 11:21313913-21313935 CAAGAACAGCACAAAGTGGATGG - Intronic
1079519867 11:21313913-21313935 CAAGAACAGCACAAAGTGGATGG - Intronic
1081745406 11:45469367-45469389 CTGGAAAAAGACAAGGTGAGGGG - Intergenic
1081745406 11:45469367-45469389 CTGGAAAAAGACAAGGTGAGGGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087166246 11:95006605-95006627 CTTGAAAAACACAAGATGCAAGG + Intergenic
1087166246 11:95006605-95006627 CTTGAAAAACACAAGATGCAAGG + Intergenic
1087392867 11:97560753-97560775 GTGGAAAGACACAGGGTGGAGGG - Intergenic
1087392867 11:97560753-97560775 GTGGAAAGACACAGGGTGGAGGG - Intergenic
1087467649 11:98529562-98529584 CTGGAAAAGCACAAACTAGTGGG + Intergenic
1087467649 11:98529562-98529584 CTGGAAAAGCACAAACTAGTGGG + Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090049053 11:123361160-123361182 GTGGAAAAGCAAAGGCTGGAAGG - Intergenic
1090049053 11:123361160-123361182 GTGGAAAAGCAAAGGCTGGAAGG - Intergenic
1090216965 11:124976689-124976711 CTGGAAAAACACCAGTTGAAAGG - Intronic
1090216965 11:124976689-124976711 CTGGAAAAACACCAGTTGAAAGG - Intronic
1090481597 11:127073801-127073823 ATGGGAAACCACAGGGTGGATGG + Intergenic
1090481597 11:127073801-127073823 ATGGGAAACCACAGGGTGGATGG + Intergenic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090663388 11:128898094-128898116 TTGGAAAAGAATAAAGTGGAAGG - Intronic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091651423 12:2313153-2313175 GTGGAGAAGCCCAAGCTGGATGG - Intronic
1091651423 12:2313153-2313175 GTGGAGAAGCCCAAGCTGGATGG - Intronic
1091937292 12:4443965-4443987 CTGAAGAAGCACAAGCTGCAAGG + Intronic
1091937292 12:4443965-4443987 CTGAAGAAGCACAAGCTGCAAGG + Intronic
1092535907 12:9386873-9386895 CTGACAAAGAACAAGGTGGGAGG - Intergenic
1092535907 12:9386873-9386895 CTGACAAAGAACAAGGTGGGAGG - Intergenic
1094818304 12:34206689-34206711 CAGAAAGAGCACAAGGTGGAAGG - Intergenic
1094818304 12:34206689-34206711 CAGAAAGAGCACAAGGTGGAAGG - Intergenic
1098499533 12:71174843-71174865 AAGGAAAAGCACAAGGTGTCAGG + Intronic
1098499533 12:71174843-71174865 AAGGAAAAGCACAAGGTGTCAGG + Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100573587 12:95867485-95867507 CTAGAAAAGCACCATGTTGAAGG + Intronic
1100573587 12:95867485-95867507 CTAGAAAAGCACCATGTTGAAGG + Intronic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1102319841 12:111923119-111923141 CTGAAGAAGCACAAAGTTGAAGG + Intergenic
1102319841 12:111923119-111923141 CTGAAGAAGCACAAAGTTGAAGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1105212219 13:18263674-18263696 CTGTCTAACCACAAGGTGGAAGG - Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1108790162 13:53960549-53960571 CTGCATCAGCACATGGTGGAAGG + Intergenic
1108790162 13:53960549-53960571 CTGCATCAGCACATGGTGGAAGG + Intergenic
1110522773 13:76500145-76500167 CTGGCAAAGTACCAGGTGAAAGG + Intergenic
1110522773 13:76500145-76500167 CTGGCAAAGTACCAGGTGAAAGG + Intergenic
1110738452 13:78965963-78965985 CTGGATAACCACAGGGTGTAGGG + Intergenic
1110738452 13:78965963-78965985 CTGGATAACCACAGGGTGTAGGG + Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113188572 13:107717985-107718007 CTGGAACAACAGCAGGTGGAGGG - Intronic
1113307256 13:109091802-109091824 CTGGAAGAGCACGAGGTTAATGG + Intronic
1113307256 13:109091802-109091824 CTGGAAGAGCACGAGGTTAATGG + Intronic
1113559011 13:111262754-111262776 CAGCAACAGCACAAGGTGAAAGG - Intronic
1113559011 13:111262754-111262776 CAGCAACAGCACAAGGTGAAAGG - Intronic
1114569253 14:23654441-23654463 CTGAGACAGCACTAGGTGGATGG - Intergenic
1114569253 14:23654441-23654463 CTGAGACAGCACTAGGTGGATGG - Intergenic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115743073 14:36408605-36408627 CTAGAAAGCCACTAGGTGGAAGG + Intergenic
1115743073 14:36408605-36408627 CTAGAAAGCCACTAGGTGGAAGG + Intergenic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1116837383 14:49783409-49783431 CTGGAAAAACAAAGTGTGGAGGG + Exonic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121217739 14:92261689-92261711 CTGAGAAAGTTCAAGGTGGAAGG - Intergenic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1121527201 14:94627455-94627477 CTGGAAAGGGAACAGGTGGAGGG + Intergenic
1122090373 14:99334507-99334529 CTGGAAAAGCTCCAGGGAGAGGG + Intergenic
1122090373 14:99334507-99334529 CTGGAAAAGCTCCAGGGAGAGGG + Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1124402415 15:29361033-29361055 CAGGAAAAGCACCAGGTGCAGGG - Intronic
1124402415 15:29361033-29361055 CAGGAAAAGCACCAGGTGCAGGG - Intronic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1124800062 15:32823878-32823900 CTGCGAACTCACAAGGTGGAAGG + Intronic
1125426770 15:39556753-39556775 CTGCCAAAGCACAAGGTGGGTGG + Intergenic
1125426770 15:39556753-39556775 CTGCCAAAGCACAAGGTGGGTGG + Intergenic
1126302542 15:47214346-47214368 GTGGAAAAGCACAGTCTGGAAGG + Intronic
1126302542 15:47214346-47214368 GTGGAAAAGCACAGTCTGGAAGG + Intronic
1126369120 15:47927110-47927132 CTGGAACAGCCCAAGGTGACAGG + Intergenic
1126369120 15:47927110-47927132 CTGGAACAGCCCAAGGTGACAGG + Intergenic
1127001134 15:54507398-54507420 ATGGAAAACCACAAGTTGGCTGG - Intronic
1127001134 15:54507398-54507420 ATGGAAAACCACAAGTTGGCTGG - Intronic
1127773785 15:62250462-62250484 CTGTCAAAGCACCAGGTTGAAGG + Intergenic
1127773785 15:62250462-62250484 CTGTCAAAGCACCAGGTTGAAGG + Intergenic
1127814864 15:62599006-62599028 CTGGAATAGCACATTGAGGATGG + Intronic
1127814864 15:62599006-62599028 CTGGAATAGCACATTGAGGATGG + Intronic
1128092536 15:64928746-64928768 CTGGACATCCCCAAGGTGGAGGG + Intronic
1128092536 15:64928746-64928768 CTGGACATCCCCAAGGTGGAGGG + Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1128635749 15:69301298-69301320 CTGGAAAAGCACATGGGGGCTGG - Intronic
1129223723 15:74152540-74152562 CTGAAAAAGTTCAAAGTGGAAGG - Intergenic
1129223723 15:74152540-74152562 CTGAAAAAGTTCAAAGTGGAAGG - Intergenic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1129450786 15:75650055-75650077 CTGGGAGAGCACAGGGTGGCTGG - Exonic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130444751 15:83990409-83990431 TTCGATAAGCACAAGGTGTAGGG - Intronic
1130444751 15:83990409-83990431 TTCGATAAGCACAAGGTGTAGGG - Intronic
1130750791 15:86710784-86710806 CTGGAAAAGCACAAAATGCCAGG + Intronic
1130750791 15:86710784-86710806 CTGGAAAAGCACAAAATGCCAGG + Intronic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131067221 15:89442226-89442248 CTGGAAAAGCAGAAAGGGGCGGG + Intergenic
1131283658 15:91040245-91040267 CTGGCAGAGCACAGGGTGGGTGG - Intergenic
1131283658 15:91040245-91040267 CTGGCAGAGCACAGGGTGGGTGG - Intergenic
1133089513 16:3392925-3392947 CTGGAAAAGATTAAGTTGGATGG + Intronic
1133089513 16:3392925-3392947 CTGGAAAAGATTAAGTTGGATGG + Intronic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133534910 16:6692604-6692626 ATGGAAAAGTGCATGGTGGAAGG - Intronic
1133534910 16:6692604-6692626 ATGGAAAAGTGCATGGTGGAAGG - Intronic
1135731400 16:24897951-24897973 CTGGAAAAGATCAAGGGGGTTGG - Intronic
1135731400 16:24897951-24897973 CTGGAAAAGATCAAGGGGGTTGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136086529 16:27889274-27889296 CTGGAAAAGCACAACTCGGCTGG - Intronic
1136086529 16:27889274-27889296 CTGGAAAAGCACAACTCGGCTGG - Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137968642 16:52961790-52961812 CTGGAAGAGCACAAGGGGTTGGG - Intergenic
1137968642 16:52961790-52961812 CTGGAAGAGCACAAGGGGTTGGG - Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140118198 16:72060935-72060957 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140118198 16:72060935-72060957 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140120231 16:72077126-72077148 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1140120231 16:72077126-72077148 CTGGAAGAGGGCAAAGTGGACGG + Exonic
1141436481 16:84002548-84002570 CTGGTGAAGCCCAAGGTTGAAGG + Exonic
1141436481 16:84002548-84002570 CTGGTGAAGCCCAAGGTTGAAGG + Exonic
1142343686 16:89540151-89540173 CTGGTAAAGAACAAAGTGGGAGG - Intronic
1142343686 16:89540151-89540173 CTGGTAAAGAACAAAGTGGGAGG - Intronic
1143236525 17:5406353-5406375 GAGGCAAAGTACAAGGTGGAAGG + Intronic
1143236525 17:5406353-5406375 GAGGCAAAGTACAAGGTGGAAGG + Intronic
1143609889 17:8012172-8012194 CAGGAAAAGCCCCAGGTAGAGGG - Exonic
1143609889 17:8012172-8012194 CAGGAAAAGCCCCAGGTAGAGGG - Exonic
1144220266 17:13093461-13093483 CTGTAAAATCACCAGATGGATGG - Intergenic
1144220266 17:13093461-13093483 CTGTAAAATCACCAGATGGATGG - Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1147262937 17:39219205-39219227 CTGCAAAGGCACAGGTTGGAAGG - Intronic
1147262937 17:39219205-39219227 CTGCAAAGGCACAGGTTGGAAGG - Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1148681201 17:49474556-49474578 CTAGGAAAGAACAAGGAGGAAGG - Intronic
1148681201 17:49474556-49474578 CTAGGAAAGAACAAGGAGGAAGG - Intronic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1151370971 17:73645697-73645719 CTGGAAATGCTCAGGGCGGAGGG + Intergenic
1151370971 17:73645697-73645719 CTGGAAATGCTCAGGGCGGAGGG + Intergenic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152140483 17:78533616-78533638 CTGGAGAATCCCAAGGTGGTCGG + Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153764690 18:8364374-8364396 CTGCAACATCACAAGGTAGATGG + Intronic
1153764690 18:8364374-8364396 CTGCAACATCACAAGGTAGATGG + Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156899331 18:42282701-42282723 CTGGAAAAAAACTAGGTGCAAGG - Intergenic
1156899331 18:42282701-42282723 CTGGAAAAAAACTAGGTGCAAGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1157867107 18:51196977-51196999 CTGGAAGAGGACGAGGAGGAGGG - Exonic
1158207646 18:55011277-55011299 CAGGAAATACACATGGTGGAAGG - Intergenic
1158207646 18:55011277-55011299 CAGGAAATACACATGGTGGAAGG - Intergenic
1159890800 18:73951393-73951415 ATGGAATGGCACAAGGTTGAAGG - Intergenic
1159890800 18:73951393-73951415 ATGGAATGGCACAAGGTTGAAGG - Intergenic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1160837481 19:1131678-1131700 CTGGAGAAGCCTCAGGTGGAGGG - Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162068535 19:8140073-8140095 CTGCAAAAGCAAGAGGAGGACGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1165724107 19:38100692-38100714 CTGCAAAAGCAAAATCTGGAGGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168075846 19:53980621-53980643 CTGGAAAAGCCAAAGGGGGAGGG + Intronic
1168707501 19:58478244-58478266 CTGGAAAACCACCAGGCAGAGGG - Intronic
1168707501 19:58478244-58478266 CTGGAAAACCACCAGGCAGAGGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926183252 2:10664924-10664946 CAGGAATAGGACAGGGTGGAAGG + Intronic
926183252 2:10664924-10664946 CAGGAATAGGACAGGGTGGAAGG + Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927456990 2:23261516-23261538 CAGGAAACCCACAAGTTGGATGG - Intergenic
927456990 2:23261516-23261538 CAGGAAACCCACAAGTTGGATGG - Intergenic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
928414246 2:31078601-31078623 CAGGCACAGCACAAGGTGAATGG - Intronic
928414246 2:31078601-31078623 CAGGCACAGCACAAGGTGAATGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
929799250 2:45085366-45085388 GTGCAAAGGCACAAGGTGGAGGG + Intergenic
929799250 2:45085366-45085388 GTGCAAAGGCACAAGGTGGAGGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930494195 2:52118367-52118389 CTTGAAAAGCATCAGTTGGATGG - Intergenic
930494195 2:52118367-52118389 CTTGAAAAGCATCAGTTGGATGG - Intergenic
932926470 2:75980720-75980742 CTAGTAAAGGACAAGTTGGAAGG + Intergenic
932926470 2:75980720-75980742 CTAGTAAAGGACAAGTTGGAAGG + Intergenic
932926930 2:75987406-75987428 CTGTAATATCACGAGGTGGAAGG + Intergenic
932926930 2:75987406-75987428 CTGTAATATCACGAGGTGGAAGG + Intergenic
933309510 2:80643031-80643053 CTGTAATAGCACAAGATGGGAGG + Intronic
933309510 2:80643031-80643053 CTGTAATAGCACAAGATGGGAGG + Intronic
934654624 2:96110741-96110763 CTGGCAATTCACCAGGTGGACGG - Intergenic
934654624 2:96110741-96110763 CTGGCAATTCACCAGGTGGACGG - Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935341909 2:102066073-102066095 CAGGAAAGGCACAAGGTTGGGGG - Intronic
935341909 2:102066073-102066095 CAGGAAAGGCACAAGGTTGGGGG - Intronic
935924674 2:108054248-108054270 CTGGGAAAGCACAGTGTGCAAGG + Intergenic
935924674 2:108054248-108054270 CTGGGAAAGCACAGTGTGCAAGG + Intergenic
936055980 2:109262318-109262340 GTGGAAAAGCACCAGGAGGGTGG + Intronic
936055980 2:109262318-109262340 GTGGAAAAGCACCAGGAGGGTGG + Intronic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
937031862 2:118747518-118747540 CTGGAAGAGGAAGAGGTGGAGGG - Intergenic
939279650 2:140045866-140045888 CTTGAAAAGCATAAGGTATATGG - Intergenic
939279650 2:140045866-140045888 CTTGAAAAGCATAAGGTATATGG - Intergenic
939801881 2:146720773-146720795 CTGGAAAAGCACCATCTGGTTGG - Intergenic
939801881 2:146720773-146720795 CTGGAAAAGCACCATCTGGTTGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942334955 2:174873585-174873607 CTGGAATAGCAAAAGGGGCATGG - Intronic
942334955 2:174873585-174873607 CTGGAATAGCAAAAGGGGCATGG - Intronic
942892338 2:181006394-181006416 CTGGAACGGCAAAAGGTGGAAGG - Intronic
942892338 2:181006394-181006416 CTGGAACGGCAAAAGGTGGAAGG - Intronic
945465150 2:210160849-210160871 TTGGAAAAGAACAAAGTTGAAGG + Intronic
945465150 2:210160849-210160871 TTGGAAAAGAACAAAGTTGAAGG + Intronic
945569393 2:211446016-211446038 CTGGAAGAGAACAAGATGGGGGG + Intronic
945569393 2:211446016-211446038 CTGGAAGAGAACAAGATGGGGGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
947392820 2:229656425-229656447 CTGGAAAAGTGCAAGGTGAGGGG + Intronic
947392820 2:229656425-229656447 CTGGAAAAGTGCAAGGTGAGGGG + Intronic
947736422 2:232457685-232457707 CTGGCAAAGCACCAGGTGATGGG + Exonic
947736422 2:232457685-232457707 CTGGCAAAGCACCAGGTGATGGG + Exonic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1169154238 20:3315890-3315912 CTGGACATGGACATGGTGGAAGG - Intronic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1169744712 20:8931934-8931956 CTGGAAAAGAGAAGGGTGGATGG - Intronic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175385497 20:58592419-58592441 CTGGAAGTGCACAGGGTGGAAGG - Intergenic
1175385497 20:58592419-58592441 CTGGAAGTGCACAGGGTGGAAGG - Intergenic
1175804398 20:61819454-61819476 GTGGAAAATCACAGTGTGGAGGG - Intronic
1175804398 20:61819454-61819476 GTGGAAAATCACAGTGTGGAGGG - Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177939285 21:27389317-27389339 CTGCATAAGCTCAAGATGGACGG - Intergenic
1177939285 21:27389317-27389339 CTGCATAAGCTCAAGATGGACGG - Intergenic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1181977419 22:26740789-26740811 CTGGCAAACGACAAGTTGGAGGG - Intergenic
1181977419 22:26740789-26740811 CTGGCAAACGACAAGTTGGAGGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1182855286 22:33511622-33511644 CTGGAAAAGGACTTGGTAGAAGG + Intronic
1182855286 22:33511622-33511644 CTGGAAAAGGACTTGGTAGAAGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185308383 22:50136813-50136835 CTGGAAAAGAACCAGCTGGAAGG + Intronic
1185308383 22:50136813-50136835 CTGGAAAAGAACCAGCTGGAAGG + Intronic
949474899 3:4434180-4434202 CTGGAAATGCATAATGTTGATGG + Intronic
949474899 3:4434180-4434202 CTGGAAATGCATAATGTTGATGG + Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950755316 3:15166128-15166150 CTTAAAAAGCACAACTTGGATGG - Intergenic
950755316 3:15166128-15166150 CTTAAAAAGCACAACTTGGATGG - Intergenic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
951144154 3:19206383-19206405 CTGCAAAAGCATAAGGGGAAAGG + Intronic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953528931 3:43721081-43721103 CTAGAAAAGAACAATGTGGAAGG + Intronic
953528931 3:43721081-43721103 CTAGAAAAGAACAATGTGGAAGG + Intronic
953978357 3:47399692-47399714 CTGGAAAAGCACAGGTCTGAAGG - Intronic
953978357 3:47399692-47399714 CTGGAAAAGCACAGGTCTGAAGG - Intronic
955097446 3:55813584-55813606 CTGGAAAGGTACAAGGTGACTGG + Intronic
955097446 3:55813584-55813606 CTGGAAAGGTACAAGGTGACTGG + Intronic
959474251 3:106790285-106790307 CTGGAACAGCCCCAGCTGGAGGG + Intergenic
959474251 3:106790285-106790307 CTGGAACAGCCCCAGCTGGAGGG + Intergenic
959535401 3:107479223-107479245 TTGAAAAAGAACAAGGTTGAAGG + Intergenic
959535401 3:107479223-107479245 TTGAAAAAGAACAAGGTTGAAGG + Intergenic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961022989 3:123525219-123525241 TTGGAAAGGAAAAAGGTGGATGG + Intronic
961618323 3:128202126-128202148 CTGGAAAAGAACAAAGTTGGAGG - Intronic
961618323 3:128202126-128202148 CTGGAAAAGAACAAAGTTGGAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
962893137 3:139690547-139690569 ATGGAAAATCACAAGTGGGATGG + Intergenic
962893137 3:139690547-139690569 ATGGAAAATCACAAGTGGGATGG + Intergenic
963274939 3:143320541-143320563 CAGGCACAGCACATGGTGGAGGG + Intronic
963274939 3:143320541-143320563 CAGGCACAGCACATGGTGGAGGG + Intronic
963409589 3:144910170-144910192 CTGTAAATGCACAGGGTGTACGG + Intergenic
963409589 3:144910170-144910192 CTGTAAATGCACAGGGTGTACGG + Intergenic
964080399 3:152747230-152747252 CAGGAAAAGAACCACGTGGAAGG - Intergenic
964080399 3:152747230-152747252 CAGGAAAAGAACCACGTGGAAGG - Intergenic
964692779 3:159470928-159470950 CTGGAAAAGGCAAAGGTAGAGGG + Intronic
964692779 3:159470928-159470950 CTGGAAAAGGCAAAGGTAGAGGG + Intronic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
967260732 3:187639274-187639296 CTGGAAGATGACAAGGTGGGAGG - Intergenic
967260732 3:187639274-187639296 CTGGAAGATGACAAGGTGGGAGG - Intergenic
968751690 4:2393232-2393254 CTAGAAAAGGAAAAGGTGAATGG - Intronic
968751690 4:2393232-2393254 CTAGAAAAGGAAAAGGTGAATGG - Intronic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969401189 4:6956742-6956764 CTAGAAAGCCACAAGGTGGGAGG - Intronic
969401189 4:6956742-6956764 CTAGAAAGCCACAAGGTGGGAGG - Intronic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
970413894 4:15837622-15837644 CTGGAAAAGCACAGAGAGAAAGG - Intronic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
971527961 4:27645276-27645298 CTGGAAAAGTGCAATTTGGAGGG + Intergenic
971527961 4:27645276-27645298 CTGGAAAAGTGCAATTTGGAGGG + Intergenic
971903024 4:32686945-32686967 CTGCAAAAGCAAATGGTGGTGGG + Intergenic
971903024 4:32686945-32686967 CTGCAAAAGCAAATGGTGGTGGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
973689763 4:53414825-53414847 CTGAAAAAGCATAAGTTGGAGGG - Intronic
975696448 4:77018692-77018714 CTGAAAAAGACCAAGGTAGATGG - Intronic
975696448 4:77018692-77018714 CTGAAAAAGACCAAGGTAGATGG - Intronic
975826535 4:78325765-78325787 CTGAAATAGCACAAAGTAGACGG + Intronic
975826535 4:78325765-78325787 CTGAAATAGCACAAAGTAGACGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976068772 4:81218307-81218329 CTGGAAAAAAAAAAAGTGGAGGG + Intergenic
976068772 4:81218307-81218329 CTGGAAAAAAAAAAAGTGGAGGG + Intergenic
976429370 4:84945192-84945214 CATGAAAACCACCAGGTGGAAGG + Intronic
976429370 4:84945192-84945214 CATGAAAACCACCAGGTGGAAGG + Intronic
977686945 4:99857587-99857609 CTGGAAAAGGGCAACGTGCAAGG - Intronic
977686945 4:99857587-99857609 CTGGAAAAGGGCAACGTGCAAGG - Intronic
979372292 4:119903575-119903597 CTGAAAAAGAACAAAGTTGAAGG + Intergenic
979372292 4:119903575-119903597 CTGAAAAAGAACAAAGTTGAAGG + Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
980407548 4:132373227-132373249 ATGGTAGAGCAAAAGGTGGAAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
984173771 4:176391145-176391167 CTGGAAAAGGGCAAGATGCAGGG - Intergenic
984173771 4:176391145-176391167 CTGGAAAAGGGCAAGATGCAGGG - Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
987287321 5:16469620-16469642 CTGGAACAGCACCAAGGGGATGG - Intergenic
987287321 5:16469620-16469642 CTGGAACAGCACCAAGGGGATGG - Intergenic
988372221 5:30385849-30385871 TTGGAAAAGAACAAGTTTGAAGG + Intergenic
988372221 5:30385849-30385871 TTGGAAAAGAACAAGTTTGAAGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
991369234 5:65901061-65901083 CAGGAACAGCACCAAGTGGATGG + Intergenic
991369234 5:65901061-65901083 CAGGAACAGCACCAAGTGGATGG + Intergenic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
994000314 5:94772063-94772085 CTGGGAAAGTACAGGGTGCACGG - Intronic
994000314 5:94772063-94772085 CTGGGAAAGTACAGGGTGCACGG - Intronic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
997303623 5:132823674-132823696 CTGGTCAAGCACAGGGTGGGTGG + Exonic
997303623 5:132823674-132823696 CTGGTCAAGCACAGGGTGGGTGG + Exonic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999680790 5:154058204-154058226 ATGGAAAAGCACAAGGTGTTAGG + Intronic
999680790 5:154058204-154058226 ATGGAAAAGCACAAGGTGTTAGG + Intronic
999734553 5:154503096-154503118 CTGGAACAGGTCAAGCTGGAAGG + Intergenic
999734553 5:154503096-154503118 CTGGAACAGGTCAAGCTGGAAGG + Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
999846614 5:155488388-155488410 CTGTATAATCACATGGTGGAAGG - Intergenic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1000294476 5:159901303-159901325 CTGGAAGAGCAAAGGGTGAAGGG - Intergenic
1001233715 5:170011827-170011849 CTGGAAAAGGACAATATGGCTGG + Intronic
1001233715 5:170011827-170011849 CTGGAAAAGGACAATATGGCTGG + Intronic
1001255852 5:170183108-170183130 CTGGAAGAGGCCAGGGTGGAGGG + Intergenic
1001255852 5:170183108-170183130 CTGGAAGAGGCCAGGGTGGAGGG + Intergenic
1001325997 5:170724994-170725016 CTGAAAAAGAACAAAGTTGAAGG + Intronic
1001325997 5:170724994-170725016 CTGAAAAAGAACAAAGTTGAAGG + Intronic
1001562283 5:172677550-172677572 CTGGAAAAGCACGAGGTCAGTGG + Intronic
1001562283 5:172677550-172677572 CTGGAAAAGCACGAGGTCAGTGG + Intronic
1002577915 5:180187040-180187062 CTGAAAAAGAACAAAGTTGAAGG + Intronic
1002577915 5:180187040-180187062 CTGAAAAAGAACAAAGTTGAAGG + Intronic
1002790315 6:432705-432727 CTGGAAAAGCACAATGGAAATGG - Intergenic
1002790315 6:432705-432727 CTGGAAAAGCACAATGGAAATGG - Intergenic
1003176655 6:3757240-3757262 CTGGAAAGGCCCTGGGTGGAGGG + Intergenic
1003176655 6:3757240-3757262 CTGGAAAGGCCCTGGGTGGAGGG + Intergenic
1005137430 6:22585976-22585998 CTGGCAATGTACTAGGTGGAGGG + Intergenic
1005137430 6:22585976-22585998 CTGGCAATGTACTAGGTGGAGGG + Intergenic
1006133580 6:31882823-31882845 CTGGAAAAGCCCCAGGGGCAGGG + Intronic
1006133580 6:31882823-31882845 CTGGAAAAGCCCCAGGGGCAGGG + Intronic
1007088964 6:39170064-39170086 CTGGAAAAACACAAAGTTAAAGG + Intergenic
1007088964 6:39170064-39170086 CTGGAAAAACACAAAGTTAAAGG + Intergenic
1007115657 6:39341315-39341337 CTGGAGAAGCACAAGCTCCAAGG - Intronic
1007115657 6:39341315-39341337 CTGGAGAAGCACAAGCTCCAAGG - Intronic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1009190660 6:60625707-60625729 CTGGCAAAGAACATGGTAGATGG + Intergenic
1009190660 6:60625707-60625729 CTGGCAAAGAACATGGTAGATGG + Intergenic
1010014415 6:71087598-71087620 CTGGAAAAGCTTAAGGTTTAAGG - Intergenic
1010014415 6:71087598-71087620 CTGGAAAAGCTTAAGGTTTAAGG - Intergenic
1012848488 6:104419425-104419447 CGTGAAAAGCAAAAGGTGGCAGG + Intergenic
1012848488 6:104419425-104419447 CGTGAAAAGCAAAAGGTGGCAGG + Intergenic
1015356649 6:132285279-132285301 GTGGAAAAGCACAAGGTGTTAGG - Intergenic
1015356649 6:132285279-132285301 GTGGAAAAGCACAAGGTGTTAGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016318354 6:142815002-142815024 CTGCAACAGCCCATGGTGGAAGG + Intronic
1016318354 6:142815002-142815024 CTGCAACAGCCCATGGTGGAAGG + Intronic
1017006456 6:150030983-150031005 TTGGAAAATCACAACATGGATGG - Intergenic
1017006456 6:150030983-150031005 TTGGAAAATCACAACATGGATGG - Intergenic
1017909460 6:158780606-158780628 CTGGAAATGCACTAGGTCCAGGG - Intronic
1017909460 6:158780606-158780628 CTGGAAATGCACTAGGTCCAGGG - Intronic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018478068 6:164162445-164162467 CTGGTAAAGCACAACTTGGCTGG + Intergenic
1018478068 6:164162445-164162467 CTGGTAAAGCACAACTTGGCTGG + Intergenic
1018808825 6:167282425-167282447 CTGGAACAGAAAAAGGTGGGGGG + Intronic
1018808825 6:167282425-167282447 CTGGAACAGAAAAAGGTGGGGGG + Intronic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1024939387 7:54746347-54746369 CTGGAACAGCATAAGGGGAAAGG - Intergenic
1024939387 7:54746347-54746369 CTGGAACAGCATAAGGGGAAAGG - Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1025843760 7:65176736-65176758 ATGGAAAAGCACAGGGAGGCCGG - Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1031372481 7:120984902-120984924 ATGGAAAGTCACCAGGTGGAAGG + Intergenic
1031372481 7:120984902-120984924 ATGGAAAGTCACCAGGTGGAAGG + Intergenic
1031870638 7:127086858-127086880 CTGGTAAACAACAAGCTGGAGGG - Intronic
1031870638 7:127086858-127086880 CTGGTAAACAACAAGCTGGAGGG - Intronic
1032325308 7:130922582-130922604 CAGGAAAACCACAGGCTGGAGGG + Intergenic
1032325308 7:130922582-130922604 CAGGAAAACCACAGGCTGGAGGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1035575355 8:701144-701166 CTGGAGAAGAACCAGGTGGACGG + Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1036438729 8:8760808-8760830 ATGGAAAATCCCAAGGTGGTGGG - Intergenic
1036652815 8:10655848-10655870 CTGGAAATTAACTAGGTGGAAGG + Intronic
1036652815 8:10655848-10655870 CTGGAAATTAACTAGGTGGAAGG + Intronic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038008492 8:23455194-23455216 GTGGAAAAACACAAGATGCAAGG + Intronic
1038008492 8:23455194-23455216 GTGGAAAAACACAAGATGCAAGG + Intronic
1038401779 8:27289281-27289303 CTGGAAAAGTACAATGGGTATGG + Intronic
1038401779 8:27289281-27289303 CTGGAAAAGTACAATGGGTATGG + Intronic
1040648824 8:49428075-49428097 CTGGAAAAGCACAAGAGACAGGG - Intergenic
1040648824 8:49428075-49428097 CTGGAAAAGCACAAGAGACAGGG - Intergenic
1041478572 8:58293036-58293058 CTGAAAAAGAACAAGGTAGGAGG - Intergenic
1041478572 8:58293036-58293058 CTGAAAAAGAACAAGGTAGGAGG - Intergenic
1041541079 8:58985836-58985858 CTGGAAAAGCCCAAAGTGTAGGG - Intronic
1041541079 8:58985836-58985858 CTGGAAAAGCCCAAAGTGTAGGG - Intronic
1041796006 8:61749396-61749418 AGGAAAAAGCACATGGTGGAAGG - Intergenic
1041796006 8:61749396-61749418 AGGAAAAAGCACATGGTGGAAGG - Intergenic
1042200376 8:66275238-66275260 CTGGAAAAGATCAGGGTGGTGGG - Intergenic
1042200376 8:66275238-66275260 CTGGAAAAGATCAGGGTGGTGGG - Intergenic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043004361 8:74799839-74799861 CTGGAAAAACTAAAGGTTGAAGG - Intronic
1043004361 8:74799839-74799861 CTGGAAAAACTAAAGGTTGAAGG - Intronic
1043737802 8:83769027-83769049 CTGGAAAGGGCCAAGGTGGCAGG + Intergenic
1043737802 8:83769027-83769049 CTGGAAAGGGCCAAGGTGGCAGG + Intergenic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1045239880 8:100390769-100390791 TTGGAAAAGAACAGGGTTGAAGG + Intronic
1045239880 8:100390769-100390791 TTGGAAAAGAACAGGGTTGAAGG + Intronic
1046249545 8:111612006-111612028 CTGCAGAGGCACAAGGTGTAGGG + Intergenic
1046249545 8:111612006-111612028 CTGCAGAGGCACAAGGTGTAGGG + Intergenic
1046356359 8:113090619-113090641 TTGGCAAAGCACAGTGTGGATGG - Intronic
1046356359 8:113090619-113090641 TTGGCAAAGCACAGTGTGGATGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1048043899 8:130755555-130755577 CTGGAAGAGGACAGGGAGGAGGG - Intergenic
1048043899 8:130755555-130755577 CTGGAAGAGGACAGGGAGGAGGG - Intergenic
1048059273 8:130900697-130900719 CTTGAGGAGCACAAGTTGGAAGG - Intronic
1048059273 8:130900697-130900719 CTTGAGGAGCACAAGTTGGAAGG - Intronic
1048365883 8:133738195-133738217 CCAGGAAAGCACAAGTTGGATGG - Intergenic
1048365883 8:133738195-133738217 CCAGGAAAGCACAAGTTGGATGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1049664945 8:143838848-143838870 AGGGCAGAGCACAAGGTGGAGGG + Intronic
1049664945 8:143838848-143838870 AGGGCAGAGCACAAGGTGGAGGG + Intronic
1051001983 9:12293284-12293306 CTGGAAAAGAAAAGAGTGGAGGG - Intergenic
1051001983 9:12293284-12293306 CTGGAAAAGAAAAGAGTGGAGGG - Intergenic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1051882977 9:21859026-21859048 CTGGAACCTCACACGGTGGAAGG + Intronic
1051882977 9:21859026-21859048 CTGGAACCTCACACGGTGGAAGG + Intronic
1054867825 9:70020623-70020645 CTGGAAAAGCCCTCGGAGGAGGG - Intergenic
1054867825 9:70020623-70020645 CTGGAAAAGCCCTCGGAGGAGGG - Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057622271 9:96646706-96646728 GTGGCAAAGCACAAGATGGAGGG + Intronic
1057622271 9:96646706-96646728 GTGGCAAAGCACAAGATGGAGGG + Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058478603 9:105367654-105367676 CTGCAAAAGCAAAAGGTGCCTGG - Intronic
1058478603 9:105367654-105367676 CTGCAAAAGCAAAAGGTGCCTGG - Intronic
1058983858 9:110194348-110194370 CTGGAAATCCACAAGTTGCAAGG + Intronic
1058983858 9:110194348-110194370 CTGGAAATCCACAAGTTGCAAGG + Intronic
1059901428 9:118930635-118930657 TTGGAAGAGGACAAGGTGGTGGG - Intergenic
1059901428 9:118930635-118930657 TTGGAAGAGGACAAGGTGGTGGG - Intergenic
1060498696 9:124136699-124136721 AAGGAAAAGAACAAGATGGAGGG - Intergenic
1060498696 9:124136699-124136721 AAGGAAAAGAACAAGATGGAGGG - Intergenic
1061245313 9:129398582-129398604 CTGGAAATGCACACGGGGTAGGG - Intergenic
1061245313 9:129398582-129398604 CTGGAAATGCACACGGGGTAGGG - Intergenic
1061309517 9:129753069-129753091 CAGGGAAAGCACAAAGTGGGAGG + Intergenic
1061309517 9:129753069-129753091 CAGGGAAAGCACAAAGTGGGAGG + Intergenic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1185535366 X:857197-857219 CAGGAAAAGCAAAAACTGGAGGG + Intergenic
1185535366 X:857197-857219 CAGGAAAAGCAAAAACTGGAGGG + Intergenic
1185810423 X:3103822-3103844 CTGGAAAGGTACCAGCTGGACGG + Exonic
1185810423 X:3103822-3103844 CTGGAAAGGTACCAGCTGGACGG + Exonic
1186095603 X:6098339-6098361 CTAGAAAAGCACAAGGTCTTAGG + Intronic
1186095603 X:6098339-6098361 CTAGAAAAGCACAAGGTCTTAGG + Intronic
1187375739 X:18751935-18751957 CTGCAAAAGAACAAAGTTGAAGG - Intronic
1187375739 X:18751935-18751957 CTGCAAAAGAACAAAGTTGAAGG - Intronic
1188170266 X:26915997-26916019 ATGGAATAGAACAAAGTGGAAGG + Intergenic
1188170266 X:26915997-26916019 ATGGAATAGAACAAAGTGGAAGG + Intergenic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1188473905 X:30569630-30569652 CTGGAACAGTACAAGGAGGAAGG + Intronic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191177186 X:57516849-57516871 CTGGCAAAGCAATAGGAGGATGG + Intergenic
1191706918 X:64103481-64103503 CTTGAAAATCACAAGTTGGATGG - Intergenic
1191706918 X:64103481-64103503 CTTGAAAATCACAAGTTGGATGG - Intergenic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1193000241 X:76555328-76555350 TTGGAATAGCCCAGGGTGGAGGG + Intergenic
1193000241 X:76555328-76555350 TTGGAATAGCCCAGGGTGGAGGG + Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1194341922 X:92716072-92716094 CTGGAGAAGCTCAAACTGGACGG + Intergenic
1194341922 X:92716072-92716094 CTGGAGAAGCTCAAACTGGACGG + Intergenic
1194494682 X:94599912-94599934 CAGGAAATGCACAAGGGGAAAGG + Intergenic
1194494682 X:94599912-94599934 CAGGAAATGCACAAGGGGAAAGG + Intergenic
1194917306 X:99722141-99722163 CTGGAAAAGGGCAAAGTGGGAGG + Intergenic
1194917306 X:99722141-99722163 CTGGAAAAGGGCAAAGTGGGAGG + Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196471713 X:116036072-116036094 CTGGAAAAGAAAAATCTGGAGGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1196603076 X:117623554-117623576 CTGGAAAAGAATAATGGGGAGGG - Intergenic
1198181238 X:134211535-134211557 CTGAAAAAGAACAAAGTTGAAGG + Intergenic
1198181238 X:134211535-134211557 CTGAAAAAGAACAAAGTTGAAGG + Intergenic
1198360869 X:135893513-135893535 CCGGAAAGGCTCAAGGCGGATGG + Intronic
1198360869 X:135893513-135893535 CCGGAAAGGCTCAAGGCGGATGG + Intronic
1201424546 Y:13833882-13833904 CTTGAAAAGGCCAAGGTGGGAGG - Intergenic
1201424546 Y:13833882-13833904 CTTGAAAAGGCCAAGGTGGGAGG - Intergenic