ID: 1015764726

View in Genome Browser
Species Human (GRCh38)
Location 6:136704321-136704343
Sequence TAGAAAACCCTGTCATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015764724_1015764726 11 Left 1015764724 6:136704287-136704309 CCTTATCATGATTACAGACACTG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG 0: 1
1: 0
2: 1
3: 15
4: 152
1015764723_1015764726 17 Left 1015764723 6:136704281-136704303 CCTATACCTTATCATGATTACAG 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG 0: 1
1: 0
2: 1
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015764726 Original CRISPR TAGAAAACCCTGTCATATCA AGG Intronic
907914128 1:58853243-58853265 TAGAAAACCCTATTGTATCAGGG + Intergenic
909750155 1:79149417-79149439 TAAAAAACCCTGGCATTTCTAGG + Intergenic
911389602 1:97223325-97223347 TAGAAAATCCTGAAATATAACGG - Intronic
916065968 1:161135902-161135924 TAGAAAGCCCTGTGATATATAGG + Intergenic
918409078 1:184240008-184240030 AAGAAAACTCTGCCATTTCATGG + Intergenic
920183315 1:204145976-204145998 CAGGGAACCCTGTCTTATCAGGG + Intronic
920956623 1:210625635-210625657 TAGAAAAGGCAGGCATATCAGGG + Intronic
921783999 1:219204595-219204617 TAGAAAACACTGACATGTAATGG - Intronic
923249810 1:232169290-232169312 TAGAAAGCCCTGTTAAGTCATGG - Intergenic
923574063 1:235142021-235142043 TAGCAAACCCTGTCACTCCAGGG + Intronic
1065368838 10:24961115-24961137 TAGAAAACCGTGTTATATTTTGG + Intergenic
1066629328 10:37443337-37443359 TATATGACCCTGTCATTTCAAGG - Intergenic
1067107920 10:43377871-43377893 TAGCAAACCCTGTCCTTGCATGG + Intergenic
1068238990 10:54279250-54279272 TAGAACATCCTGTTATATGATGG - Intronic
1068499237 10:57821981-57822003 AACAAAACCCTGTACTATCATGG - Intergenic
1069617912 10:69817964-69817986 TAGAAAACCAGGTCAGTTCAGGG - Intronic
1071140878 10:82507938-82507960 TGGAAAACATTGTCAAATCATGG + Intronic
1074864505 10:117537057-117537079 TGGAAACCCGTGTCATAGCAAGG - Intergenic
1075377678 10:121992241-121992263 AAGAACAGCCTGGCATATCAGGG - Intronic
1081650222 11:44818796-44818818 TAGATGAGCCTGTCATATAAGGG + Intronic
1081926728 11:46835930-46835952 TAGAATACCATATCATATCAGGG - Intronic
1082274902 11:50211120-50211142 TATAAATCCCTGTGAAATCATGG + Intergenic
1082653463 11:55823629-55823651 TAGAAAAACAAGTCATATCATGG + Intergenic
1084234877 11:67780972-67780994 TAGAAAACCGTGTTGTAGCAGGG + Intergenic
1086185374 11:84008080-84008102 CACAAAACTATGTCATATCATGG + Intronic
1088186996 11:107181514-107181536 TGGAAAACCCTATAACATCAGGG - Intergenic
1090717654 11:129444366-129444388 TTGAAAACCCTTTCATTTCAGGG - Intronic
1093505144 12:19856446-19856468 AAGAAAACCCAGTCATAACTGGG - Intergenic
1093666274 12:21817058-21817080 CAGAAAACTCTCTCATATCTTGG - Intronic
1093677018 12:21954428-21954450 TAGATTACTTTGTCATATCAGGG + Intergenic
1093831825 12:23770327-23770349 AAGAAAACCCTGAATTATCAAGG + Intronic
1094719273 12:33046536-33046558 TAATAAACCATGTCATAACAAGG + Intergenic
1095299664 12:40568457-40568479 TATAAAACCCAGTCATATTTGGG - Intronic
1096457960 12:51802988-51803010 TAGAAAACCCTGACAGATTTTGG - Intronic
1099164744 12:79290323-79290345 TAGAAAATCTTGTAATTTCAAGG + Intronic
1102801400 12:115737649-115737671 TAGAAAACACTCTCATCTCCTGG + Intergenic
1107295798 13:38906000-38906022 AAGAAAAGCCTGTCACCTCAGGG - Intergenic
1109435880 13:62301636-62301658 AAGAAAAGCTTGTCATATCTAGG + Intergenic
1109633506 13:65084296-65084318 TAGAAAACCTTTTCATCTCTAGG + Intergenic
1117680080 14:58194864-58194886 TTGAAAACCCTGTAATACCTCGG + Intronic
1117720240 14:58622193-58622215 TAGAATACCCTGTCCTCCCAGGG - Intergenic
1118311291 14:64695251-64695273 CAGAGAACTCTTTCATATCAGGG + Intergenic
1120093486 14:80361229-80361251 AAGAACTCACTGTCATATCAAGG + Intronic
1120356166 14:83436768-83436790 TAGTCCACCCTGTCAAATCAGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1125189093 15:36968626-36968648 TAAGAAATCCAGTCATATCAAGG - Intronic
1126133639 15:45369095-45369117 TAGGAAAACTTGTCATTTCAAGG + Intronic
1130776404 15:86988847-86988869 CAGAAAACCCTGTCAATTCTGGG - Intronic
1131247534 15:90808552-90808574 TAGACAAGCCTGTCATTTAAAGG - Intronic
1132266204 15:100473044-100473066 TAGAAAATCCTGTAAGATGAGGG + Exonic
1140778766 16:78275040-78275062 GAAAAAAACCTGTTATATCATGG - Intronic
1146579583 17:34024813-34024835 AAGTAAACCCTGTCCTATCCAGG - Intronic
1147118980 17:38324223-38324245 TAGAGAACCCTGAGATATCCAGG - Intergenic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1155488824 18:26377485-26377507 TAGCAAACCTTGTCATTACATGG + Intronic
1155918133 18:31576016-31576038 TTGAAATCTCTGTCTTATCATGG - Intergenic
1157359991 18:46967700-46967722 TAGTTAACCCGGTCATCTCATGG + Intronic
1157360590 18:47021292-47021314 TAGTTAACCCGGTCATCTCATGG + Intronic
1157361579 18:47027207-47027229 TAGTTAACCCGGTCATCTCATGG + Intronic
1159501796 18:69280916-69280938 TAGAAAAGGTTGTCACATCATGG - Intergenic
1159753554 18:72334031-72334053 TATAACACATTGTCATATCAAGG - Intergenic
1162330615 19:10027022-10027044 GAGAGAACCATGTCAGATCATGG - Intergenic
925643746 2:6013193-6013215 CAGAGAACCCAGCCATATCATGG + Intergenic
925990161 2:9248346-9248368 TAGAAAACCCTTTGGTATCTTGG + Intronic
927133215 2:20078448-20078470 AAGAGCTCCCTGTCATATCAAGG + Intergenic
927522819 2:23710830-23710852 TACAAACCCCTTTAATATCAGGG + Intergenic
928882191 2:36109451-36109473 GAGAAAAACCTGTCATACCCTGG - Intergenic
929348211 2:40913989-40914011 CAGAAAACCCAGACATATAAGGG - Intergenic
929388395 2:41439607-41439629 GAGAGTACCCAGTCATATCAAGG - Intergenic
929772028 2:44900449-44900471 TAGAAAACCCTGTGTGGTCAAGG + Intergenic
930342524 2:50134842-50134864 TAGAAAATCCTGAAATAGCACGG + Intronic
931808340 2:65829740-65829762 TGGAAAACACAGTAATATCAGGG + Intergenic
934914090 2:98284368-98284390 AACAGAACCCAGTCATATCAGGG + Intronic
935494285 2:103759220-103759242 CAGAGAACCCTGTCTTAACAGGG + Intergenic
936622525 2:114115400-114115422 TAGTAAAGCCTGTCATATCCTGG + Intergenic
937472483 2:122186151-122186173 ATGACAACCCTGTCAGATCAGGG - Intergenic
937816515 2:126256635-126256657 CAGCAAACCCTGCCATGTCAGGG + Intergenic
938192576 2:129297088-129297110 TACATAACCTTGTAATATCATGG + Intergenic
940651507 2:156445207-156445229 CAGTGAACCCTGTCATATCAGGG + Intronic
945201117 2:207282512-207282534 CAGAAAAAGCTCTCATATCATGG + Intergenic
947929715 2:233953384-233953406 TAAATAACCCTGTAATTTCAAGG - Intronic
1170471577 20:16673277-16673299 TAGTAACCCCTGCCATTTCATGG - Intergenic
1171720585 20:28559026-28559048 TAGAAAACTTTATCATATCATGG - Intergenic
1171757466 20:29124283-29124305 TGGAAAACTTTATCATATCATGG + Intergenic
1171863489 20:30423165-30423187 TAGCAAACTTTATCATATCATGG + Intergenic
1171953111 20:31439071-31439093 TAGAAAACCATATAATATGATGG + Intergenic
1173083053 20:39888004-39888026 TGTAAAACCCTGTGAAATCAAGG + Intergenic
1173833955 20:46113028-46113050 TAGAGAGCCCTGTCATCTTATGG + Intergenic
1174847959 20:53962277-53962299 TAAAAAACCCTCTGATTTCATGG + Intronic
1177733713 21:25061996-25062018 TATAAATCCCTGTCACATCAGGG - Intergenic
1178140887 21:29682019-29682041 TGGAAAACCCTGTCATAGGCAGG - Intronic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
1184365375 22:44047784-44047806 TAGAAGAGCCTGTAATCTCAGGG + Intronic
949125000 3:436607-436629 TAATTAACCCTGTCATACCATGG - Intergenic
949263166 3:2125956-2125978 TTAAAAACCCTGTCATATTTAGG + Intronic
949956497 3:9273297-9273319 TAGAGAACCCTGTCTTATTGTGG + Intronic
950204368 3:11067385-11067407 CAGAAAGCCCAGTCATGTCATGG + Intergenic
950507671 3:13405604-13405626 CAGAAAACCCTGACTAATCAGGG + Intronic
950652996 3:14419254-14419276 TAGACACCCCTGCCATGTCAGGG - Intronic
957162335 3:76626174-76626196 TGGAAAACACTGTCATAAAATGG + Intronic
957241685 3:77668542-77668564 AAGAATTCCCTGGCATATCAAGG + Intergenic
958058404 3:88444842-88444864 TAGAAAACCATGACATATTAAGG - Intergenic
958728776 3:97937680-97937702 TAGAAAACCCTGTGAAGTCAAGG + Intronic
961489786 3:127246900-127246922 GAGATAACCATCTCATATCATGG + Intergenic
962101307 3:132345726-132345748 CAGGACACCCTGTCATATGAAGG + Intronic
963480175 3:145862638-145862660 TAGTAGACCCTCTCCTATCATGG + Intergenic
964380013 3:156088661-156088683 TAGAAAACCGTTTCTTATCCTGG - Intronic
965481579 3:169225446-169225468 AAAGAAACCCTGTCTTATCAAGG + Intronic
965551504 3:169969945-169969967 AATAAAACCTTGACATATCATGG + Intronic
969903303 4:10370110-10370132 TATAAAACCCTGTGTTAACAAGG + Intergenic
971085973 4:23275354-23275376 TAGAAAATCTAGTAATATCAGGG - Intergenic
972356744 4:38286526-38286548 TTGAAAACTCTGCCATTTCAGGG - Intergenic
973885444 4:55316295-55316317 TAGAAAACCCCAACAGATCATGG + Intergenic
974546918 4:63323292-63323314 TTGAAAACCCTGTCCTTTCCAGG + Intergenic
976391630 4:84511215-84511237 TATAAAGCTCTGTAATATCAAGG + Intergenic
977985379 4:103376462-103376484 TAGAAAACCCTGACTAATAAAGG + Intergenic
980821903 4:138027966-138027988 TGTAAAACCCCTTCATATCAAGG + Intergenic
981116037 4:140992632-140992654 TAGAAAGCCTTGTCATATCCAGG - Intronic
981312529 4:143311164-143311186 TGGAGAACTCTGTCAAATCAAGG - Intergenic
982225869 4:153165846-153165868 TAGAAAAACCCCTCAAATCATGG - Intronic
982531071 4:156544659-156544681 TAGAAAACCCTTTCCTAAAATGG - Intergenic
986595021 5:9412218-9412240 TAGAAAAATCAGTCTTATCATGG + Intronic
987801339 5:22700579-22700601 TAGAAAACATTTTCTTATCACGG - Intronic
990680263 5:58235137-58235159 TAAATAAGTCTGTCATATCATGG + Intergenic
993770006 5:91915304-91915326 TACAAAATCCTCTCAAATCAAGG - Intergenic
994028200 5:95109516-95109538 TAGAAAACTCTGTAATTTAAAGG - Intronic
994755009 5:103783644-103783666 CAGAAAACCCTGTTTTAACAGGG - Intergenic
998578377 5:143343034-143343056 TAGAAAACACTGTCCAACCAAGG + Intronic
1003409560 6:5850746-5850768 TAGAAAACTGTGACATAGCAAGG - Intergenic
1004868355 6:19876779-19876801 TAGAAAACCCTCACGTATCACGG + Intergenic
1007946728 6:45833739-45833761 TAAAAATCCCTGTCATAGTAGGG - Intergenic
1008663586 6:53694465-53694487 TAGAAAACCCTGCCTTACAAAGG + Intergenic
1011468467 6:87683511-87683533 TAGGAAACCCATTTATATCAAGG - Intronic
1011533150 6:88346900-88346922 TAGAAAACACTGGCAGATCTAGG + Intergenic
1012513904 6:100036391-100036413 TAGAAAATCCTCTCATTTCCTGG + Intergenic
1013862324 6:114650648-114650670 TAGAAAACCAAGTTATATTAAGG + Intergenic
1014324775 6:119979495-119979517 TACACAACTCTGTCATGTCAGGG - Intergenic
1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG + Intronic
1015764941 6:136706453-136706475 TAGAAAAGCCTGTTGTATCAAGG + Intronic
1019257518 7:61626-61648 CGGAAAACCCTGTCATTGCAAGG - Intergenic
1020495677 7:8850340-8850362 TAGAATACCCTGTCATCTGTTGG + Intergenic
1029349387 7:100002378-100002400 TAAAAATCCCTGTCATATCAAGG + Intergenic
1030747830 7:113189478-113189500 TAGAAGACCTTGTAATTTCAGGG - Intergenic
1030796818 7:113798963-113798985 TAGAAAACGTTGTCCTATCATGG + Intergenic
1032980448 7:137276135-137276157 AAGAAAAACCTGTCATACAAAGG + Intronic
1036966804 8:13307774-13307796 TAGAACACCCTGTAAAATCCTGG + Intronic
1037760663 8:21739512-21739534 TAGAGAACCCTGAGATAACAGGG + Intronic
1044931177 8:97253189-97253211 CAGAGAACACTGTCAGATCAGGG - Intergenic
1045230774 8:100304417-100304439 TAGAAAAGCCTGTTATCTTAGGG - Intronic
1045541441 8:103090037-103090059 TAGAAAACCAATTAATATCACGG - Intergenic
1046949268 8:120004191-120004213 GAGAAAACTCTGTCATCTAATGG + Intronic
1048956960 8:139545141-139545163 GAGAAAACCCAGCCATTTCAAGG + Intergenic
1051783742 9:20719636-20719658 TAGAATACCCTATCAAAGCAGGG - Intronic
1053748395 9:41224688-41224710 TGGAAAACTTTATCATATCATGG + Intergenic
1055566871 9:77578389-77578411 TAGAAAACTCTATTATATCTAGG + Intronic
1055873692 9:80917069-80917091 TAGAAAACTCCATCATCTCAGGG + Intergenic
1202784525 9_KI270718v1_random:35400-35422 TGGAAAACTTTATCATATCATGG + Intergenic
1187297424 X:18015368-18015390 TGGAAAACACTGACATAGCAAGG - Intergenic
1188266582 X:28083819-28083841 TAGAAAACACTTTCATAAAATGG - Intergenic
1188946316 X:36307684-36307706 TACAAAACCCTGACATCTGAGGG + Intronic
1192815493 X:74586359-74586381 AAGTGAACCCTGTCATATCATGG - Exonic
1194100608 X:89699244-89699266 TAGGAGACCATGTCATAGCATGG + Intergenic
1195285356 X:103377368-103377390 TAAAAAATCCTTTGATATCAGGG + Intronic
1195532513 X:105972843-105972865 ATAAAAAGCCTGTCATATCAAGG - Intergenic
1195762748 X:108264434-108264456 TATAGAAGCCTGTCTTATCATGG + Intronic
1196105463 X:111890480-111890502 TACTAAACCATTTCATATCAGGG + Intronic
1196292390 X:113958619-113958641 TACTCAACCCTGTCATAGCATGG - Intergenic
1200453563 Y:3360304-3360326 TAGGAGACCATGTCATAGCATGG + Intergenic
1201459181 Y:14203448-14203470 AACAGAACCATGTCATATCAGGG - Intergenic