ID: 1015764791

View in Genome Browser
Species Human (GRCh38)
Location 6:136704880-136704902
Sequence AATTATATGCAGAAAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 13, 3: 60, 4: 581}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015764787_1015764791 26 Left 1015764787 6:136704831-136704853 CCATCATACCTGGCCTGAATATA 0: 1
1: 0
2: 10
3: 162
4: 1178
Right 1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG 0: 1
1: 0
2: 13
3: 60
4: 581
1015764789_1015764791 13 Left 1015764789 6:136704844-136704866 CCTGAATATACTATGAAACATTT 0: 1
1: 0
2: 0
3: 37
4: 371
Right 1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG 0: 1
1: 0
2: 13
3: 60
4: 581
1015764788_1015764791 18 Left 1015764788 6:136704839-136704861 CCTGGCCTGAATATACTATGAAA 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG 0: 1
1: 0
2: 13
3: 60
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015764791 Original CRISPR AATTATATGCAGAAAAAGAC AGG Intronic
903047956 1:20578528-20578550 AATAAAAGGCAGAAAAAGAGGGG + Intergenic
903601614 1:24546236-24546258 AATTCTAGGCTGAAAAGGACAGG + Intergenic
903898896 1:26628310-26628332 AACCATATGCAGGAAAAGGCTGG - Intergenic
904222554 1:28984322-28984344 AATTCTAGGCAGAAAAGGACGGG - Intronic
905093090 1:35445466-35445488 AAGTATTTGCAGATATAGACTGG - Intronic
905209338 1:36362620-36362642 TTTTATATGAAGAAAAATACAGG - Intronic
905565901 1:38964540-38964562 AATTAAAGGTAGAAAAAGAGAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907651430 1:56298659-56298681 AATTTTATCCAGAAAAAGAGGGG + Intergenic
908699623 1:66884451-66884473 CATCAGATGCAGAAAAAGAAGGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909245466 1:73276404-73276426 AATTATAGACAGAAAGTGACAGG - Intergenic
909247399 1:73303622-73303644 AATAATATACAGAATAAGAGAGG + Intergenic
909767900 1:79380848-79380870 CATTATATGTAGAAAAACACTGG + Intergenic
909831779 1:80201298-80201320 AATTAAATACAGATAATGACAGG - Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911286152 1:95995678-95995700 AATAATATGCAGAAAAACACAGG - Intergenic
911402114 1:97388432-97388454 AATAATATAGAGAAAAAGAAAGG + Intronic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912582028 1:110729633-110729655 AATTCTAGGCAGAAAAAGATGGG + Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
915292118 1:154891993-154892015 AAAAGTATGCAGAAAAAGAGGGG + Intergenic
916025461 1:160829816-160829838 AAATATATTCAGAAAGAGCCTGG - Intergenic
916028802 1:160858816-160858838 AAATATATCCAGAGAAAGAATGG + Intronic
916293759 1:163194117-163194139 AATTCTATGAAGAAAAAGGGTGG - Intronic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
917509697 1:175659948-175659970 ATTTATATCCAGAAAAAAACTGG - Intronic
919197040 1:194299274-194299296 AAGTATATGCAGGAAAATAAAGG - Intergenic
919497839 1:198298427-198298449 AATGCTATGCAGAAAAAAACAGG - Intronic
920191509 1:204196849-204196871 AATTAGACGTAGAAAACGACAGG + Intergenic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
921030001 1:211328087-211328109 AATTTTAGGCAGCAAAAGGCTGG + Intronic
921667132 1:217886493-217886515 AATTACATTCAGAAAATTACAGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
921827927 1:219694873-219694895 AAGTATATGGTGAACAAGACAGG + Intronic
922040340 1:221890194-221890216 CATTATTTCCAGAAAATGACAGG - Intergenic
922149926 1:222991568-222991590 AATAATATGGTGAAAAATACAGG + Exonic
922535451 1:226377180-226377202 AATTATATGAAGAAAAAACCGGG - Exonic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923180505 1:231513703-231513725 CAATATATGCATAAAAAGAAAGG - Intergenic
923429565 1:233906850-233906872 AATTATTTGCAGGAAGAAACAGG + Intronic
924294841 1:242576339-242576361 AATGATATCCAGAGAAAAACTGG - Intergenic
924417734 1:243876084-243876106 AATTGAATGCAGAAACAGACAGG + Intergenic
1062887734 10:1031521-1031543 AAGCATATGCAGAAGAAAACGGG - Intergenic
1063280392 10:4623029-4623051 AATGAAATGAAGAAAAAAACTGG + Intergenic
1063440289 10:6067448-6067470 AATTGAATGCAGAAAAAAAAAGG + Intergenic
1063764960 10:9128850-9128872 AATCATTTGCACAAAAAGAAGGG + Intergenic
1064037038 10:11922524-11922546 AAATAAATGCAGTAAATGACAGG + Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065217253 10:23460959-23460981 ACTTATCTGCATAATAAGACAGG - Intergenic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1066788321 10:39031419-39031441 AATTATCTTCAGACAAAAACTGG - Intergenic
1066788941 10:39042097-39042119 AATTATCTTCAGATAAAAACTGG + Intergenic
1066808757 10:39295911-39295933 AAATATCTTCAGAAAAAAACTGG - Intergenic
1066810062 10:39319153-39319175 AAATATCTTCAGAAAAACACTGG - Intergenic
1066810231 10:39322068-39322090 AATTATCTTCAGAAAAAAAGTGG - Intergenic
1066992555 10:42530031-42530053 AATGAAAAGCAAAAAAAGACGGG - Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067361051 10:45579198-45579220 ACATATATGCATAAAAAGAAAGG + Intronic
1068136847 10:52957501-52957523 AATTACAAGCAGAAATAGATGGG - Intergenic
1068524327 10:58110022-58110044 ACTGATGTGCAGAAAAAGAATGG + Intergenic
1069149659 10:64943155-64943177 TATCATGTACAGAAAAAGACAGG - Intergenic
1069580720 10:69564497-69564519 ATTTATAGGCAGCAAAGGACAGG + Intergenic
1070695562 10:78560884-78560906 TCTTATATGCCGAGAAAGACAGG - Intergenic
1070988260 10:80707436-80707458 AATTACATGAAAAAAAATACAGG + Intergenic
1071966131 10:90854625-90854647 AATCATTTTCTGAAAAAGACGGG + Intronic
1071971738 10:90914996-90915018 AATTATCTGAAAAAAAATACAGG + Intronic
1072229374 10:93400771-93400793 AAATATATTCAGCAAGAGACTGG - Intronic
1073224124 10:101902146-101902168 AATTATTTGCAGAAAGAAATAGG - Intronic
1073602019 10:104855302-104855324 AAATATATACAGAAAAGCACAGG - Intronic
1073845353 10:107547647-107547669 CATTATAGGCAGAAAAAAAGAGG - Intergenic
1074175310 10:110994693-110994715 ATTTATATGTATAAAAATACAGG - Intronic
1074180194 10:111055026-111055048 AATTTAATGGAGAAAAAGAATGG - Intergenic
1074325640 10:112447873-112447895 AATTATATGCGGCAAAATAGAGG + Intronic
1074998948 10:118781232-118781254 GAAGATATGGAGAAAAAGACAGG + Intergenic
1075771894 10:124945733-124945755 AAGGATATGTAGAAAAAGGCAGG - Intronic
1075977386 10:126707538-126707560 AATTATATTAAGATAAAGACCGG + Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1078163030 11:8858357-8858379 AATTTTAGGAAGAAAAAGAAAGG + Intronic
1078602441 11:12745764-12745786 AATTCTAAGCAGAAAAATATGGG - Intronic
1078885998 11:15500487-15500509 AATCATATGCAAAAATAGTCTGG - Intergenic
1079818042 11:25087614-25087636 TATTATCTAAAGAAAAAGACTGG + Intergenic
1080167993 11:29263254-29263276 CATTTTATACAGAAAAAAACTGG - Intergenic
1080371898 11:31657793-31657815 AGTCATATGCAGAATAACACTGG + Intronic
1080476794 11:32602395-32602417 AATTATAAGCATAAAAACTCAGG - Exonic
1080781627 11:35434937-35434959 ATTTAAATGCAGAAGAAAACTGG - Intronic
1081982583 11:47277591-47277613 AAATATATGTAGAAAGAGGCTGG - Intronic
1082308569 11:50615876-50615898 AATTATCTTCAGATAAAAACTGG - Intergenic
1082308743 11:50618243-50618265 AAATATATTCAGATAAAAACTGG - Intergenic
1082573898 11:54779063-54779085 AAATATATTCAGAAAAAAACTGG + Intergenic
1082576392 11:54810247-54810269 AAATATCTTCAGAAAAAAACCGG - Intergenic
1082580171 11:54856263-54856285 AATTATCTTCAGAGAAAAACTGG + Intergenic
1082587893 11:54965530-54965552 AAATATCTCCAGAAAAAAACAGG + Intergenic
1082589265 11:54985576-54985598 AAATATCTGCAGAATAAAACTGG + Intergenic
1082591200 11:55012685-55012707 AAATATCTTCAGAAAAAAACTGG - Intergenic
1082780847 11:57286409-57286431 AATGATAAGCAAAAGAAGACAGG + Intergenic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1084766786 11:71315142-71315164 GATTTTATGCAGAAAATTACAGG - Intergenic
1084792911 11:71486078-71486100 AATTTTATCCAGAAAACAACAGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1086783003 11:90930623-90930645 AATTCTAGACAGAAAAAGGCAGG + Intergenic
1087112122 11:94481970-94481992 AATGATATTCAGAAAGAGAAAGG + Intronic
1088404138 11:109453623-109453645 AACCATAAGCATAAAAAGACTGG - Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089873724 11:121699787-121699809 AAATCTATGCACAAAAAGGCAGG - Intergenic
1090597041 11:128330881-128330903 AATCATATGCTGAAAGATACTGG - Intergenic
1090719951 11:129462711-129462733 CAATATATGCAGAAAAACACTGG - Intergenic
1091317897 11:134628295-134628317 AATAATATGCAGAAACAGTATGG - Intergenic
1092329953 12:7576060-7576082 AATAATATGCAAGAAAAGATGGG + Intergenic
1093187223 12:16034465-16034487 AGTTTTATTAAGAAAAAGACAGG + Intronic
1093739550 12:22667585-22667607 TATTTTATACAGAAAAAGACAGG - Intronic
1094631225 12:32176886-32176908 AATCATGTCCACAAAAAGACTGG - Intronic
1094631677 12:32181568-32181590 ATTTATATGCATAAAATGAGAGG - Intronic
1095071290 12:37851839-37851861 AAATATATTCAGACAAAAACTGG - Intergenic
1095075925 12:37924976-37924998 AAATATATTCAGATAAAAACTGG - Intergenic
1095079173 12:37976400-37976422 AAATATCTTCAGAAAAAAACTGG + Intergenic
1095257907 12:40061944-40061966 CAGTATATACAGAAAAAGAAAGG + Intronic
1095552794 12:43463534-43463556 ATTTAAATTCAGAAAAAGAAAGG - Intronic
1095987266 12:48007242-48007264 AATTAGATGCAGAAAACTAGAGG + Intergenic
1096289161 12:50326279-50326301 ACTTTTATGCAAACAAAGACTGG - Intronic
1097403530 12:59160006-59160028 AATTATTTCTAGAAAAAGAGGGG - Intergenic
1097551227 12:61073318-61073340 AATTATATGCTGAAAATTATAGG - Intergenic
1097606343 12:61759105-61759127 TATTATATGTTGAAAAAGAAAGG + Intronic
1097658176 12:62395156-62395178 ATTTATATGAAGAAAAATACAGG - Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1097858365 12:64492077-64492099 ATTTAAATGCAGACAAATACTGG - Intronic
1098693621 12:73522803-73522825 TATGAGATGCAGAAGAAGACAGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101688788 12:107053999-107054021 AATTCTCTATAGAAAAAGACTGG - Intronic
1101727152 12:107397335-107397357 AGAGATATGCAGACAAAGACAGG - Intronic
1102128338 12:110503787-110503809 AATACTATGGAGAAAAAGAAAGG - Exonic
1102286700 12:111663495-111663517 AATTTTTTGCAGAGAAAGGCAGG - Intronic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1106339335 13:28813885-28813907 ATATATGTGCAAAAAAAGACAGG + Intergenic
1106503759 13:30354191-30354213 AATAATATGTAGAAATAGGCCGG + Intergenic
1107294140 13:38892394-38892416 AACTATATGAGGAAACAGACTGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108930710 13:55814750-55814772 AATTATAGGCAGAGAAAAATTGG + Intergenic
1109131756 13:58595598-58595620 AATAATATGAAGCAACAGACTGG - Intergenic
1109419975 13:62099608-62099630 AATTCTAGGCAGAAAAGGATGGG + Intergenic
1110136381 13:72072273-72072295 AAAAAAATACAGAAAAAGACAGG - Intergenic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1110634188 13:77746764-77746786 AATTATTTGAAGGAAAATACTGG - Exonic
1110958387 13:81586791-81586813 AGTTATGTGCAGAAAAAGTCAGG - Intergenic
1111003500 13:82216414-82216436 AATTAGAAGGACAAAAAGACTGG - Intergenic
1111094778 13:83498759-83498781 AATTAACTGCTGAAAAAGAACGG + Intergenic
1111359805 13:87161388-87161410 AATTATATCAAGCAAAAGCCAGG + Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112456081 13:99565335-99565357 AAATATATGAAGAAAAAGGCCGG - Intergenic
1113353099 13:109549089-109549111 AAATATATCAATAAAAAGACTGG - Intergenic
1114867626 14:26616709-26616731 AGCCATATGCAGAAAGAGACTGG + Intergenic
1114894747 14:26973556-26973578 TGTTATATGCAGAAAAAGATAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115730263 14:36260862-36260884 AATTATATATAGAAAATGAGAGG - Intergenic
1115924435 14:38414790-38414812 AATGATAAGCAGAAAAAAGCAGG + Intergenic
1115949424 14:38703328-38703350 AATTTTAAGAAGCAAAAGACTGG + Intergenic
1116014161 14:39386464-39386486 AAGTACAGGCAGTAAAAGACTGG - Intronic
1117265074 14:54078193-54078215 ATATATATGCATAGAAAGACTGG + Intergenic
1117358307 14:54947420-54947442 AATTAAATTCAGAACAAAACAGG + Intronic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118930803 14:70238434-70238456 TGCTATATGCAGGAAAAGACAGG + Intergenic
1119000773 14:70879695-70879717 AATTTGATGCATAAACAGACTGG - Intergenic
1119650323 14:76378492-76378514 AATTCTTTGCAAAAAAAAACCGG - Intronic
1119783876 14:77298026-77298048 AGGTATATGCAGAAAACTACTGG - Intronic
1120085191 14:80263994-80264016 AATTATATTCAGGCTAAGACAGG - Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120716222 14:87843722-87843744 TATAATATGCAGAAAAATTCTGG + Intronic
1121491755 14:94366121-94366143 AATTATGTGGAGAAAAGAACTGG - Intergenic
1122385722 14:101345274-101345296 AAATATATGTAGCAAAAGGCTGG + Intergenic
1122516478 14:102312440-102312462 AATAATAAGCAGTAGAAGACAGG - Intergenic
1202885352 14_KI270722v1_random:101291-101313 AAGTATATGCTAAGAAAGACAGG - Intergenic
1123671372 15:22662503-22662525 ATTTATATGAAGACAAAGATAGG - Intergenic
1124105449 15:26733609-26733631 TGTTTTATGCAGAAAAAGAAAGG + Intronic
1124323410 15:28735730-28735752 ATTTATATGAAGACAAAGATAGG - Intronic
1124527297 15:30468897-30468919 ATTTATATGAAGACAAAGATAGG - Intergenic
1124771356 15:32538786-32538808 ATTTATATGAAGACAAAGATAGG + Intergenic
1124858486 15:33413790-33413812 AAATACATGGGGAAAAAGACAGG - Intronic
1125262632 15:37845098-37845120 ATTTATATGCAGTTAAAAACAGG + Intergenic
1126424474 15:48512086-48512108 CATTTTAAGCAGAAAAAAACTGG - Intronic
1128271189 15:66311397-66311419 AATTAGATACACATAAAGACAGG + Intronic
1128981614 15:72191798-72191820 AATTATTTGTTGAAAAAAACAGG - Intronic
1130630686 15:85565818-85565840 AATCATATGCAGAAATAGAGTGG - Intronic
1131661272 15:94520316-94520338 AAAAATATGCAGAACAAGACTGG - Intergenic
1132660016 16:1057195-1057217 AATTCTAGGTAGAAAAAGATGGG - Intergenic
1134373440 16:13647300-13647322 AAATAAAGGCAGAAATAGACAGG + Intergenic
1134741410 16:16550402-16550424 AATTAAATGCAGAAAACAATAGG - Intergenic
1134926146 16:18162031-18162053 AATTAAATGCAGAAAACAATAGG + Intergenic
1135942927 16:26838524-26838546 TATGATTTGCAGAAAAAGATAGG - Intergenic
1138297138 16:55896659-55896681 ATTTATATGGAGAAAGACACTGG - Intronic
1138905909 16:61333019-61333041 GATTATATGGGGGAAAAGACAGG - Intergenic
1138931089 16:61656699-61656721 AATTATATGGAGATATATACTGG + Intronic
1140593673 16:76382781-76382803 AATTCCTTGCAGTAAAAGACTGG + Intronic
1141013778 16:80428250-80428272 AATTTTATGCAGATAAATAGAGG - Intergenic
1141686953 16:85575823-85575845 AAATATAACCATAAAAAGACTGG - Intergenic
1141722104 16:85762154-85762176 AATTATATCCCGAGAAGGACAGG + Intergenic
1142645547 17:1311972-1311994 AATTATAGGCAGGAAAAAAATGG - Intergenic
1143353363 17:6306226-6306248 ATTTACATGGAGAAAAAGCCTGG + Intergenic
1144226538 17:13154454-13154476 AATAATATGCAGATAAAGAAGGG + Intergenic
1145199920 17:20934585-20934607 AATGTTATACAGAAAAACACAGG + Intergenic
1145720072 17:27062957-27062979 AAATAGAAGCAGAATAAGACTGG + Intergenic
1147513402 17:41093649-41093671 AATTCTAGGCAGAAAAGGATAGG + Intronic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1149458210 17:56806700-56806722 AATTTTATTCAGAGTAAGACAGG + Intronic
1150386282 17:64764085-64764107 AATTGTATGTAGAATAAAACTGG + Intergenic
1150475889 17:65474605-65474627 AATGAGATGCAGAAAATGACAGG + Intergenic
1151245926 17:72794607-72794629 AATGAGATGCAGGAAAAGAAGGG - Intronic
1152498262 17:80690481-80690503 AATCAACTGCAGAAAGAGACAGG - Intronic
1152763924 17:82125240-82125262 AATTATATACAAAAAAGGCCGGG + Intronic
1153703892 18:7725405-7725427 AATTCTGGGCAGAAAAGGACGGG + Intronic
1153744516 18:8163425-8163447 AATTATACGGTGAAAGAGACTGG - Intronic
1153923604 18:9813021-9813043 AAAAATATGCAGATTAAGACTGG + Intronic
1155459351 18:26059525-26059547 ACTGATATGGAGACAAAGACTGG + Intronic
1157084178 18:44561324-44561346 GATTAAATGTAGAAAAAAACAGG - Intergenic
1157865482 18:51179971-51179993 AATATTCTGCAGAAAAACACTGG + Intronic
1158155327 18:54419529-54419551 AATTATATTAATGAAAAGACTGG + Intergenic
1158886547 18:61833276-61833298 AATTATTTTCTGAAATAGACTGG - Intronic
1159550257 18:69887435-69887457 AAGTTTATACAGAAAAATACAGG - Intronic
1159617044 18:70592788-70592810 AATGCTATGAAGAAAAAGCCAGG - Intergenic
1160142204 18:76335715-76335737 AATTACATTCAGAAACAGAGAGG - Intergenic
1160322301 18:77907005-77907027 AAATATTTGCAGAAATAGATGGG + Intergenic
1162257138 19:9499620-9499642 TATTCTGTGCAGAAAAAGAAAGG + Intergenic
1163339423 19:16695363-16695385 AATTATAAGGAAAAAAAGTCTGG + Intergenic
1163997929 19:21069534-21069556 AGTAATATGCAGAAGAAAACTGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164327999 19:24218689-24218711 AAATATATTCAGATAAAAACTGG - Intergenic
1164337024 19:24335101-24335123 AAATATCTGCAGATAAAAACTGG + Intergenic
1164365016 19:27569589-27569611 AAATATCTTCAGAAAAAAACTGG + Intergenic
1165588026 19:36938538-36938560 AATTATAAGCTCATAAAGACAGG - Intronic
1166195629 19:41203844-41203866 AAATATATGCAGAAAGGGAGGGG - Intronic
1166649110 19:44557196-44557218 AATTATAGGAAAAAAAAGACAGG + Intergenic
1168445453 19:56408052-56408074 AATTCTATGAAGACAAAGACAGG - Intronic
1202660757 1_KI270708v1_random:68320-68342 AAGTATATGCTAAGAAAGACAGG - Intergenic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925600299 2:5602102-5602124 TAATGTATGCAGAAAAAGAAAGG - Intergenic
926499077 2:13630445-13630467 AATTAAATGAATAAAAAGAATGG - Intergenic
926527381 2:13998071-13998093 AATTAAATTCACCAAAAGACTGG + Intergenic
927615493 2:24589550-24589572 AAATATATGCACAGAAACACAGG - Intronic
929478107 2:42273924-42273946 AATTATAACCAGAAAATAACTGG + Intronic
930336586 2:50056172-50056194 CACTATCTGCATAAAAAGACTGG + Intronic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
930637237 2:53819924-53819946 AATTATATGCAGATAGAGATAGG + Intergenic
930888478 2:56355710-56355732 AATTATATTAGGAAAAAGATTGG + Intronic
931182061 2:59912286-59912308 CATGAAATGCAGAAAATGACAGG - Intergenic
931346773 2:61454118-61454140 AATTATAGGCAGGAAAAGAGAGG + Intronic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
932122065 2:69110918-69110940 ATTTATATGCAGACAGAGACTGG + Intronic
932959349 2:76394588-76394610 ATTTCTAAGCAGACAAAGACAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933707484 2:85302838-85302860 AATTAAATGCAGTAAAGCACAGG + Intronic
934654735 2:96111325-96111347 AATTGTATGAAGGAAAAGACTGG - Intergenic
935915769 2:107947808-107947830 CATTATTTGAAGAAAAAGAGTGG - Intergenic
936868402 2:117104637-117104659 AATTATATGTTGAATAAGAGTGG + Intergenic
937383069 2:121399263-121399285 AATTATATGTAGGATAACACTGG - Intronic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
938478754 2:131640011-131640033 AATTAAATGAAGAAAAAAGCTGG + Intergenic
939299083 2:140310447-140310469 AATTATAAGCAAAAAGAAACAGG + Intronic
939842938 2:147210692-147210714 AATTATAGACAGAGAAAGAGAGG - Intergenic
940269370 2:151874546-151874568 AGTTATATGCTAAAAAAGATTGG + Intronic
940364639 2:152834252-152834274 AATTAAATGTAAAAACAGACTGG - Intergenic
940448074 2:153801916-153801938 AATTAGAAGCAGAAAGACACAGG - Intergenic
940518211 2:154708558-154708580 AATTAAATACAGAAAAAAATGGG - Intronic
940587683 2:155674773-155674795 AGTTATATGCAGAATGAAACTGG + Intergenic
940600776 2:155857069-155857091 AATTACATACAGAGAAAGATAGG - Intergenic
940782457 2:157947044-157947066 AGCTATATGCACACAAAGACTGG - Intronic
941264469 2:163343122-163343144 AATTATCTTAAGAAAAAGAGAGG + Intergenic
941267999 2:163387709-163387731 AATTATAGTAAGAAAAACACAGG - Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941505113 2:166333737-166333759 AATTATATGCACTCAAAGAAGGG - Intronic
941948843 2:171131813-171131835 AAGTATGTGGAAAAAAAGACTGG - Intronic
942456550 2:176142154-176142176 AATTCTATGGAGGAGAAGACAGG + Intergenic
942565344 2:177260873-177260895 TATTATATTAAGAAACAGACTGG + Intronic
942690310 2:178577959-178577981 CATTATATGAAGAAAAACCCAGG - Intronic
942999284 2:182304254-182304276 AATTATATGAAGATAGAGAGAGG - Intronic
943077161 2:183209471-183209493 AATGACAGACAGAAAAAGACTGG - Intergenic
943373304 2:187044047-187044069 AATTTTATGCAAAATAAAACAGG + Intergenic
943474838 2:188341136-188341158 AATTCTAGGCAGAAAAGGTCAGG - Intronic
943943368 2:194027736-194027758 TATTATGTGCAGTAAAAAACTGG + Intergenic
943969542 2:194386010-194386032 AATTCTAGGCAGAAAAATTCAGG + Intergenic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
944880887 2:204011955-204011977 AATTCAATGCAGAGAAAGACAGG + Intergenic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
945144937 2:206728264-206728286 AAATATTTGGAGAAAAAGGCAGG - Intergenic
945412428 2:209527227-209527249 AATGCTATGGAGAAAAATACAGG - Intronic
946476225 2:220009131-220009153 AATTAAATGCAAAAATCGACAGG - Intergenic
946499443 2:220230596-220230618 AATGATATGAAGAAAAATAAAGG - Intergenic
947506997 2:230715072-230715094 AAAAATACACAGAAAAAGACTGG - Intronic
948080384 2:235200682-235200704 CCTTACATGCAGAAAAAGGCAGG - Intergenic
1169584777 20:7068985-7069007 AATAATATGGAGAAAAAAACAGG - Intergenic
1169644597 20:7795891-7795913 AAATATTTTCAGAAAAAGAATGG + Intergenic
1171014432 20:21527215-21527237 AAGTACATGTAGAAAAAAACGGG - Intergenic
1171080250 20:22174529-22174551 ACTTATATGCAGCATAATACTGG - Intergenic
1171491606 20:25523203-25523225 ATATATATTCAGAAAAAGAAAGG - Intronic
1171722942 20:28583230-28583252 AACTATATTCAGAAAAAGACAGG + Intergenic
1171755145 20:29100227-29100249 AACTATGTTCAGAAAAAGACAGG - Intergenic
1171787541 20:29482665-29482687 AACTATATTCAGAAAAAGACAGG + Intergenic
1171860413 20:30396720-30396742 AACTATAATCAGAAAAAGACAGG - Intronic
1173372495 20:42449902-42449924 TTTTATATGCATAAAAAGATTGG - Intronic
1173589607 20:44214280-44214302 AAATATATGCAAAGAAAGAGTGG - Intergenic
1174592087 20:51654100-51654122 AATTGTGTGCAGAAAGAGAGAGG - Intronic
1174716452 20:52764109-52764131 AATTCTCTCCAGAAAAAGAGAGG + Intergenic
1177311206 21:19395663-19395685 AACTATTTGCAGAAATAGAATGG - Intergenic
1177413558 21:20764435-20764457 AATTTTATCCAGAAAAAGAAAGG + Intergenic
1177560980 21:22753423-22753445 AATTTCAAGCAGAAAAAGTCAGG - Intergenic
1177707199 21:24721711-24721733 AATTATATGTAAAAAAGGTCTGG - Intergenic
1179338594 21:40482176-40482198 AATTATGTGAATAAAAAGACTGG - Intronic
1179382154 21:40909916-40909938 AATTATCTACAGCAAATGACAGG + Intergenic
1180296499 22:10941896-10941918 AACTATATTCAGAAAAAGACAGG + Intergenic
1180412181 22:12624100-12624122 AAATATATTCAGAAAAAGACAGG - Intergenic
1182944358 22:34308064-34308086 AATTTTGTGCAGAAAAAAATGGG - Intergenic
1184568576 22:45308485-45308507 ACTTAAATGCAAAAAAAGGCCGG - Intergenic
1185034675 22:48466585-48466607 TATTACATGCAGAAGAACACAGG + Intergenic
1185212954 22:49582107-49582129 AATTACATGCAGACAAAGTACGG + Intronic
949665704 3:6337098-6337120 TATTATAAGCAGAAAATAACAGG - Intergenic
950976018 3:17246202-17246224 GATTATATGTAGAAAAACAAAGG + Intronic
951688043 3:25366379-25366401 AATAATAGGTAGAAAAACACAGG + Intronic
951890954 3:27567594-27567616 AATTATATCCATTAAAACACAGG - Intergenic
952573600 3:34747234-34747256 AATAATATGCAGAGAAACACTGG + Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
952967559 3:38630672-38630694 AATTATAGTCACAAAAAGAAGGG + Intronic
953764845 3:45730928-45730950 AATTATATGCAAATAAGGTCTGG + Intronic
954245451 3:49327907-49327929 AATTATTTACAGAAAGAAACAGG + Intronic
954309727 3:49756508-49756530 AATGAAATGCACAAAAAGAAAGG + Intronic
954786528 3:53097055-53097077 ATTTTTATTCAGAAAAACACTGG + Intronic
955136740 3:56226571-56226593 ATATATATACATAAAAAGACAGG + Intronic
956201328 3:66709359-66709381 GATTATTAGCAGAAAATGACAGG + Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957358380 3:79120760-79120782 AATTGTATACAGAAAAGGAAAGG + Intronic
957680528 3:83427610-83427632 AATAATATGCTGAAAAAGAACGG + Intergenic
958188039 3:90148281-90148303 AATCAAAAGTAGAAAAAGACTGG - Intergenic
958410559 3:93810106-93810128 AATCAAAAGTAGAAAAAGACTGG - Intergenic
958611671 3:96434587-96434609 AATTATATGAAAAAAAAAAACGG + Intergenic
959431681 3:106261665-106261687 AGTCATATGCAGAATAAAACTGG + Intergenic
961574658 3:127824366-127824388 AATTTTTTGCGGAGAAAGACAGG - Intergenic
962137289 3:132748557-132748579 AATTACATGCAGCAAAAGAGAGG + Intergenic
962191777 3:133318657-133318679 ATTTATTTGCTGAGAAAGACAGG - Intronic
962848843 3:139292832-139292854 AATGATGTGCAGAAAGAGAGGGG + Intronic
963219701 3:142795479-142795501 CATCATATACAGAAAAAGAAAGG + Intronic
963302176 3:143610762-143610784 AATTATCTGGAGAAATAGACTGG + Intronic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963463242 3:145644398-145644420 AATTATGTGGAGAAGGAGACAGG - Intergenic
964090401 3:152869468-152869490 AATTATATCCAGAAACATAATGG + Intergenic
965162201 3:165148682-165148704 AATTTCATGCAGAAAAAGAGAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965639252 3:170815377-170815399 AAATGCATACAGAAAAAGACTGG - Intronic
965778554 3:172259093-172259115 ATTTATATGCAGCTATAGACAGG - Intronic
965895099 3:173566016-173566038 AATTATTTGTAGAGAAAGAAGGG + Intronic
965919913 3:173900426-173900448 AATTATTTCCAGATGAAGACTGG + Intronic
966109285 3:176378559-176378581 AAATATAAGCAGAAAAAAATGGG - Intergenic
966963709 3:184968087-184968109 AATCAAATTCAGAAAAAGAATGG - Intronic
967488695 3:190063786-190063808 CAGGATATGCAGAAAAAGATGGG + Intronic
969562318 4:7957227-7957249 AATTATTTACAGAAAAAAAAGGG + Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
970746971 4:19310698-19310720 AATTATACGCACAGAAAAACTGG + Intergenic
971459883 4:26883416-26883438 AATTATATACAATATAAGACAGG - Intronic
971574479 4:28255887-28255909 AATCGTATGCAGAAAAAAATAGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972093919 4:35324667-35324689 AATAAAATTAAGAAAAAGACAGG - Intergenic
972369169 4:38406094-38406116 AATTATATGGTGAGAAACACAGG - Intergenic
972436238 4:39037843-39037865 AATTACATGCATAAACAGGCAGG + Intergenic
972747732 4:41955488-41955510 AATTACATGCAGACAGAAACTGG - Exonic
973058543 4:45690506-45690528 AATTCTATGGAGAAAAAAAAAGG - Intergenic
973303080 4:48612095-48612117 AAATATATGCAGAAAACTAATGG - Intronic
973898927 4:55446674-55446696 AATTATAAGCAGAAGAAAATAGG - Intronic
974206551 4:58710148-58710170 AATTATACACAAATAAAGACAGG - Intergenic
974511536 4:62848497-62848519 AATGATATGTAGAGAGAGACTGG + Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
974879482 4:67736294-67736316 AAATAAATGAAGAAAAAAACAGG + Intergenic
974970483 4:68819492-68819514 AAATATGTGCAGACAAACACAGG + Intronic
975876683 4:78847745-78847767 AATTATATCCAGATATATACAGG - Intronic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976430577 4:84959288-84959310 AATTTTAAGCAGAAAAAAAAAGG + Intronic
976583941 4:86773692-86773714 AATTATAGGCAAAAAAAAAAGGG - Intronic
976627858 4:87206410-87206432 AAATGAATGGAGAAAAAGACTGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977307069 4:95337823-95337845 AATGATATGCAAAGAAAAACTGG - Intronic
977514799 4:98007517-98007539 AAGTATAAGCATAAAAATACTGG + Intronic
977648904 4:99446652-99446674 AAATGTATCCAGAAAAACACAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979223873 4:118263301-118263323 AATTGAATGCAGAAATAGATAGG + Intergenic
979642400 4:123024375-123024397 AAGTACAGGCAGTAAAAGACTGG + Intronic
980316913 4:131213486-131213508 AATTATAAGCAGGATTAGACTGG + Intergenic
980490523 4:133520548-133520570 AATTATTTGAAGAGAAAGAAAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981115815 4:140989950-140989972 ACTTACCTGCATAAAAAGACTGG + Intronic
981487123 4:145299010-145299032 AAGTAAATGCAGTTAAAGACCGG - Intergenic
981720147 4:147793471-147793493 AGTTATATCTAGAAAAAGAATGG + Intronic
982465358 4:155723613-155723635 AAATAAATGCAGAAGAAGAAGGG - Intronic
982570525 4:157045288-157045310 TATTATGTTCAGAAAAAGAGAGG - Intergenic
982654791 4:158134636-158134658 AATTATACTCAGAAAAACCCAGG + Intronic
982655471 4:158143291-158143313 AAACATATGCAAAAGAAGACGGG - Intronic
982861183 4:160451183-160451205 AATTATCTGCAGAACAAAACTGG - Intergenic
982912427 4:161161203-161161225 AAGAATATGCAGGAATAGACAGG + Intergenic
982968924 4:161954394-161954416 AATTATATATAGCAAAATACTGG - Intronic
983087496 4:163465526-163465548 AATTATAGGAAGAAAAAGGGAGG - Intergenic
984154214 4:176174334-176174356 AATTACATGAAGAAACAGCCAGG + Intronic
984273402 4:177576178-177576200 ACTCATATGCAAAAAAAGCCTGG + Intergenic
984460428 4:180029481-180029503 AATTATATGCAAAAAAAAAGTGG + Intergenic
984583611 4:181537838-181537860 AAATTAATGCAGACAAAGACAGG - Intergenic
985236877 4:187884816-187884838 TATTATATACACAAAAAGAGAGG - Intergenic
986014437 5:3745779-3745801 AATTAAATGCAAGAGAAGACAGG - Intergenic
986178137 5:5369308-5369330 ATTATTGTGCAGAAAAAGACTGG - Intergenic
986456095 5:7920627-7920649 AAATATTTTCAGAAAAAGAAAGG - Intergenic
987029314 5:13961159-13961181 AAATATATACAGAAAAGAACTGG - Intergenic
987310394 5:16676189-16676211 ATTTATATGTAGGAAAATACAGG - Intronic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987629623 5:20451952-20451974 AACTATATGCAGAAATATATGGG - Intronic
987794827 5:22613999-22614021 AAATATGTGAAGAAGAAGACAGG - Intronic
988042086 5:25902609-25902631 AAGTAAAAACAGAAAAAGACAGG + Intergenic
988104659 5:26729178-26729200 AATAATCTGAGGAAAAAGACTGG - Intergenic
988777982 5:34494419-34494441 AATTATCTGGAGAGAAACACAGG + Intergenic
989461099 5:41699004-41699026 AATTAAATGCAAAAAAAAAATGG + Intergenic
989537437 5:42581079-42581101 AGTTATGTGCAGAATAAGAATGG - Intronic
989833637 5:45954325-45954347 AAATATCTTCAGATAAAGACTGG + Intergenic
989833645 5:45954497-45954519 AATTATCTTCAGATAAAAACTGG + Intergenic
989839045 5:46037014-46037036 AAATATATTCAGATAAAAACTGG + Intergenic
989848428 5:46176227-46176249 AAATATATTCAGATAAAAACTGG - Intergenic
989854296 5:46261154-46261176 AAATATATTCAGATAAAAACTGG - Intergenic
989854917 5:46272135-46272157 AAATATCTTCAGAAAAAAACTGG - Intergenic
989856684 5:46304077-46304099 AATTAACTTCAGAAAAAAACTGG - Intergenic
990068534 5:51749662-51749684 AATTTTTTCCAGTAAAAGACTGG + Intergenic
990822793 5:59861562-59861584 AATTATATGGAGAAAAAGAGAGG + Intronic
991004053 5:61810564-61810586 AATTATAAGCAGAAACAGCTGGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992908092 5:81367828-81367850 ACTTACATGTACAAAAAGACAGG + Intronic
993273463 5:85825293-85825315 AGTTATATACAGAAAAAAATAGG + Intergenic
993484527 5:88466733-88466755 AATAATAAGAAGAAAAAAACAGG + Intergenic
994301544 5:98154021-98154043 AATTATATGCCAAAAAAAATTGG + Intergenic
994392383 5:99203131-99203153 AATAATATCCAGAGGAAGACAGG - Intergenic
994492980 5:100471865-100471887 AATAATATGAAGAAAATGATAGG - Intergenic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
994787590 5:104184199-104184221 AATTATATGATGTAAAAGAAGGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
994844210 5:104964860-104964882 AATTATATGCATAAAGAGAGCGG - Intergenic
995263576 5:110133977-110133999 AATGAAAAGCAGAAAAACACAGG - Intergenic
995741927 5:115364566-115364588 AATTCTAGGCAGAAAAAGATGGG - Intergenic
995993484 5:118271108-118271130 AATAAAATACAGAAAAAAACTGG + Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996646135 5:125819475-125819497 AATTTTATGCAGAAAAAGATAGG - Intergenic
996695101 5:126385708-126385730 GCTTATAATCAGAAAAAGACAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997752073 5:136356348-136356370 AAATGCATGCAGTAAAAGACAGG - Intronic
998486930 5:142511185-142511207 AATTGTATTCACAAAAACACTGG - Intergenic
999010100 5:148027854-148027876 AAGTTTATGTAGAAATAGACAGG - Intronic
999553265 5:152713777-152713799 AATTATTTACAGAAAAATACAGG - Intergenic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1000783785 5:165517368-165517390 AATTACATGAAGAAAATTACAGG - Intergenic
1001246866 5:170111403-170111425 AATTTTGTGCTGAAGAAGACTGG - Intergenic
1001818414 5:174690695-174690717 AATTAGTTGGAGAAAAAGATGGG - Intergenic
1001899146 5:175409023-175409045 AATTAAAAGCAGAAAAAATCTGG - Intergenic
1003109622 6:3242645-3242667 AATTATATGTAGAAACATAGAGG - Intronic
1003816114 6:9842292-9842314 AATTCTATGCTGAAATAGAATGG - Intronic
1005410556 6:25540925-25540947 TATTATATGCACAGGAAGACAGG - Intronic
1005756120 6:28926242-28926264 AAATTTATTGAGAAAAAGACAGG - Intergenic
1006368042 6:33627398-33627420 ATATATATGCAAAAAAGGACAGG - Intronic
1006738918 6:36293669-36293691 TTTTATATGCAGAGAAAGTCAGG + Intronic
1006886983 6:37390114-37390136 AATTATATACAGGAATAGGCAGG - Intronic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008354199 6:50532207-50532229 AACTATATGAAGAGAAAGTCAGG - Intergenic
1008371570 6:50737800-50737822 AATGATATTCAGAAGAGGACTGG - Intronic
1008689940 6:53966684-53966706 TATTATATGAACAAAAAAACTGG - Intronic
1009044567 6:58222257-58222279 AGTGAAATGCAGAAAAACACTGG + Intergenic
1009220390 6:60976496-60976518 AGTGAAATGCAGAAAAACACTGG + Intergenic
1009251703 6:61309306-61309328 AAGTATCTTCAGAAAAAAACTGG + Intergenic
1009301327 6:62026712-62026734 ACTTTTATGCAGAAAAGCACTGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1011820857 6:91252241-91252263 AATTATTTGCAGTAATGGACAGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012154980 6:95807865-95807887 CAGTAGATGCAGAAAGAGACAGG + Intergenic
1012472077 6:99583451-99583473 AATAATGTGCATTAAAAGACTGG - Intergenic
1013164283 6:107575731-107575753 AATAATAAGAAGAAGAAGACAGG + Intronic
1014134452 6:117872148-117872170 AATTAAATTAAGAAAAAGAATGG + Intergenic
1014398816 6:120961714-120961736 AAAAATATACAGAAAAAGATAGG + Intergenic
1015531994 6:134230065-134230087 AATTAGATGCTGAGAAAGACTGG + Intronic
1015764791 6:136704880-136704902 AATTATATGCAGAAAAAGACAGG + Intronic
1015967946 6:138713740-138713762 AATTATATCGAGAAACAAACAGG + Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017105271 6:150881644-150881666 AATGACATGCAGAAAAATAAAGG - Intronic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1018623667 6:165756197-165756219 AATTGTATTAAGAAAAAGATTGG + Intronic
1019016515 6:168884368-168884390 AATAATATGCAGAAAAATTGGGG + Intergenic
1019020694 6:168915232-168915254 AGTTAGGTGCAGAATAAGACAGG + Intergenic
1019042263 6:169117148-169117170 AATTCTAGGCAGAAAAGGACAGG + Intergenic
1020246917 7:6436648-6436670 AATTATAAGTAGAAAAAGTCAGG - Intronic
1020394627 7:7700423-7700445 ATTTATATTAAGAAAAAGTCAGG + Intronic
1020524296 7:9238854-9238876 AATTATATGTCAAAAAAGCCTGG + Intergenic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1022004706 7:26256818-26256840 AATTAAATGCAAAAAATGCCTGG + Intergenic
1023279845 7:38558025-38558047 TGTTATATGAAGAAAAATACAGG + Intronic
1023758350 7:43440793-43440815 CATTATGTGCAGAAAAAAATAGG - Intronic
1024223546 7:47306259-47306281 AATTATATCCAAAAAAAGCAAGG + Intronic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1025060285 7:55799569-55799591 AATTATAGGCAAAAGAGGACAGG + Intronic
1025575449 7:62634256-62634278 AAATATATTCAGACAAAAACTGG - Intergenic
1025577140 7:62660725-62660747 AATTATCTTCAGATAAAAACTGG - Intergenic
1025580854 7:62714651-62714673 AATTATCTTCAGATAAAAACTGG + Intergenic
1025592255 7:62876386-62876408 AAATATATTCAGATAAAAACTGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026439372 7:70430652-70430674 AAGAATATGCAGAAAAGGAAGGG + Intronic
1027424491 7:78048599-78048621 TATTATAGGAAGAAAAAAACTGG - Intronic
1027459138 7:78430487-78430509 AAGTATATTCAGAAATAGAGGGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027698554 7:81439687-81439709 AGTTATATGCAGTAAAGGATTGG - Intergenic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028700370 7:93771753-93771775 AATTATATTCAGAAAACTAAAGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029226285 7:99030828-99030850 TATTAGAAGCAGAAAAACACAGG - Intronic
1030061704 7:105627220-105627242 AAATAAATACAGAAAAAGAAAGG - Intronic
1030960258 7:115911352-115911374 AATTGTATGGAGAACAAGAGAGG - Intergenic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031379074 7:121062533-121062555 AACTAAATGTAGAAAAAGAAGGG - Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032032955 7:128499857-128499879 GACTATATTCAAAAAAAGACTGG - Intronic
1032701317 7:134381895-134381917 AATGGTATGGAGAAAAAGACTGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1032917639 7:136510170-136510192 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1033083855 7:138324006-138324028 AATTTTATGAAGAGAAAGAAAGG - Intergenic
1033470599 7:141645257-141645279 GAATATATCCAGCAAAAGACAGG - Intronic
1033505853 7:141998983-141999005 AAGTATATGGAGAAAAAGTGGGG - Intronic
1033990719 7:147282764-147282786 ATTTATATGTAGAGAAAGATGGG + Intronic
1035345823 7:158197094-158197116 AATCGTATTCAGAAAAAGTCTGG + Intronic
1036974677 8:13397530-13397552 AATTAAATTAAGAAAGAGACTGG + Intronic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038630337 8:29236314-29236336 AATAATATGGGGAAGAAGACAGG + Intronic
1038815923 8:30903966-30903988 AATTATATGCAAAAGAAGTTGGG + Intergenic
1039090356 8:33821524-33821546 AATGATAAGCACAAAATGACAGG - Intergenic
1039214375 8:35252903-35252925 TATTATATCCAGTAAATGACTGG - Intronic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1039710260 8:40049008-40049030 AATAAAATGGAGAAAAACACCGG - Intergenic
1040117719 8:43643320-43643342 AAATATCTGCAGATAAAAACTGG + Intergenic
1040121534 8:43688963-43688985 AAATATTTGCAGATAAAAACTGG + Intergenic
1040281555 8:46053069-46053091 GAATATATGCAGATAAAAACTGG + Intergenic
1041259231 8:56005774-56005796 AATTTTATACAGAAAAAAAGAGG + Intronic
1041413828 8:57585730-57585752 AATTTTTTGCAGTAAAAGGCAGG + Intergenic
1041526021 8:58806916-58806938 TATTAGATGCAGAAACAGATTGG - Exonic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042322678 8:67494436-67494458 AATTATTTGAGGAAAAAAACTGG + Intronic
1042356044 8:67828819-67828841 AACTATAAGCAGAAAATGACAGG - Intergenic
1042825205 8:72972841-72972863 AATTGTAGGCAGAAAAATTCAGG + Intergenic
1043222079 8:77679218-77679240 GATTATGTGGAAAAAAAGACAGG - Intergenic
1043734480 8:83726432-83726454 TACTAGATGCAGATAAAGACTGG + Intergenic
1044262753 8:90146872-90146894 AATTATTTACTTAAAAAGACTGG + Intergenic
1044267123 8:90195034-90195056 TATAATATGCAGAAAAAAATTGG + Intergenic
1044418922 8:91968657-91968679 TTTTGTATGCAGATAAAGACAGG - Intronic
1044506137 8:93022189-93022211 TATTAAATGCACAAAAAGAAAGG - Intergenic
1045523515 8:102923671-102923693 AATTTAATGCAGAAATACACCGG - Intronic
1046686766 8:117236505-117236527 AATTAAATGAAGAAGAAGAGAGG - Intergenic
1047750830 8:127879181-127879203 AATTATGTGATGAGAAAGACTGG - Intergenic
1047867918 8:129049251-129049273 AACTTAAGGCAGAAAAAGACAGG + Intergenic
1049086533 8:140482694-140482716 ACTTATAGGCAGAAGAACACTGG - Intergenic
1049448760 8:142647022-142647044 AGGTATAGGCAGAAAAAGCCTGG + Intergenic
1050819222 9:9856401-9856423 AATTCTAGGCAGAAAAGGATGGG - Intronic
1050838979 9:10122483-10122505 AATTGGATGCAGAGAAAGACTGG + Intronic
1051255575 9:15209520-15209542 ACCTATATGTAGAAAAAAACTGG + Intronic
1051954191 9:22670043-22670065 AATTATATGGAGAAAAGGTAGGG - Intergenic
1052351582 9:27464415-27464437 TATTATATGCAAAAAAATACTGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052533591 9:29719638-29719660 ATTTATATGCACTAAAAAACTGG + Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1052649080 9:31276403-31276425 ATTTATCAGCAGATAAAGACAGG + Intergenic
1052659323 9:31407895-31407917 AGTTATATGAAGAAAAGGAAGGG - Intergenic
1053747596 9:41215877-41215899 AACTATATTCAGAAAAAGACAGG - Intergenic
1054338787 9:63834647-63834669 AACTATATTCAGAAAAAGACAGG + Intergenic
1054479687 9:65649492-65649514 AACTATATTCAGAAAAAGACAGG + Intergenic
1054902302 9:70382412-70382434 ATTTATATACAGCAAAAGCCAGG - Intergenic
1055145385 9:72927818-72927840 AAATACATGAAGAAAATGACAGG + Intronic
1055777860 9:79785317-79785339 AATAATATAAAGAAAAAGAAGGG - Intergenic
1055814962 9:80194187-80194209 AAGTATAGGCACAAAAAGAAGGG + Intergenic
1055923205 9:81483507-81483529 AATTATAAGCTGAAAAAGCCAGG - Intergenic
1055988729 9:82082239-82082261 AACTATATTCAGAAAAATTCTGG - Intergenic
1056180228 9:84075865-84075887 AATGATATGAAGTTAAAGACAGG - Intergenic
1057989146 9:99749750-99749772 AAATATAAGCAGGAAAATACCGG + Intergenic
1058167754 9:101639390-101639412 AATTATATAAACAAAAAGCCGGG - Intronic
1058246984 9:102639363-102639385 AATAATATGCATAGAAAGATGGG - Intergenic
1058779337 9:108317669-108317691 AAATAGAAGCAGAAAAAGAATGG + Intergenic
1059002725 9:110366983-110367005 AATTATCTGGAGAAAAGGCCAGG + Intronic
1059083774 9:111277602-111277624 AATTGTAAACAGAAAAGGACTGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059228273 9:112693408-112693430 AAATATATGGAGAAAACGAATGG - Intronic
1059292948 9:113243702-113243724 AATTCTAATCAGAACAAGACAGG - Intronic
1060442092 9:123650508-123650530 ACTTATATACAGAAATTGACTGG - Intronic
1060971198 9:127739079-127739101 AATTATATGCTGCAAATAACAGG - Intronic
1202783730 9_KI270718v1_random:26648-26670 AACTATATTCAGAAAAAGACAGG - Intergenic
1202803340 9_KI270720v1_random:22934-22956 AACTATATTCAGAAAAAGACAGG + Intergenic
1203448144 Un_GL000219v1:80148-80170 AACTATATTCAGAAAAAGACAGG + Intergenic
1185917818 X:4055564-4055586 AAATATTTGCAGAAATATACAGG - Intergenic
1186253168 X:7691087-7691109 AGACATATGCAGAAAAAAACTGG + Intergenic
1186717542 X:12268341-12268363 AATCATAGGCAGAAAAAGATAGG + Intronic
1186901530 X:14062315-14062337 AATTACATGCAGGAAAAGGATGG - Intergenic
1186995964 X:15122740-15122762 AATTATGTGCAGGAGAAGAAAGG - Intergenic
1187228040 X:17393141-17393163 AGGTATATTCAGCAAAAGACAGG - Intronic
1188432285 X:30117770-30117792 AAGTAAATGCAGGAAAAGAGGGG + Intergenic
1188568752 X:31556812-31556834 AATAATATTCAGAAACAGAGAGG + Intronic
1188594576 X:31882997-31883019 ACATATATGCAGCAAAGGACAGG + Intronic
1188625086 X:32274307-32274329 AATTACTTTGAGAAAAAGACTGG + Intronic
1188706045 X:33331860-33331882 AATTATATGCCTAACATGACTGG - Intronic
1188833062 X:34924672-34924694 ACATATATACAGAAAAATACAGG + Intergenic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1191053021 X:56214295-56214317 AATTCTAGGCAGAAAAAGCTGGG - Intergenic
1191268600 X:58431585-58431607 AAATATATTCAGAAAAAAACTGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191823856 X:65342082-65342104 AATGAAAGGCAGAAAAAAACAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192623962 X:72708641-72708663 AATTATATGAATCAACAGACTGG + Intronic
1193133068 X:77938677-77938699 AATTATTTACAGAAATAAACAGG - Intronic
1193219192 X:78902043-78902065 AATTATATGCCGAAACTAACAGG + Intergenic
1193549682 X:82875884-82875906 AATTATAAGCATAAAAACTCAGG - Intergenic
1193642410 X:84026990-84027012 AATAATTTCCAGAACAAGACAGG - Intergenic
1193647297 X:84085224-84085246 AATTATATGCTGAATAGGAGTGG + Intronic
1193772995 X:85609776-85609798 GACTATTTGCAGAAAAAGATTGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194473408 X:94326628-94326650 AATTAAAAGCAGAAAAATATTGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194941169 X:100012234-100012256 AAAAAAATGCAGAAAAAGATGGG + Intergenic
1194978146 X:100413136-100413158 GATTATCTGTAGAAATAGACTGG - Intergenic
1195772598 X:108367596-108367618 AATTATTTCCAGAAAACAACTGG + Intronic
1196177204 X:112652201-112652223 AATGATATGAAGGAAGAGACAGG - Intronic
1196810477 X:119625178-119625200 TATAATATGCAGAAATAGTCTGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197212535 X:123840056-123840078 ATTTATATGAAGAAAACTACGGG - Intergenic
1197340751 X:125263641-125263663 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198493871 X:137170690-137170712 AATTCCATGGGGAAAAAGACTGG + Intergenic
1199432570 X:147777552-147777574 AATTATATCTAGAAAAAAATAGG + Intergenic
1199470321 X:148188030-148188052 AATTATATACAATAATAGACTGG - Intergenic
1199621833 X:149708468-149708490 AATTCTATGAAGAAAAAGAAAGG + Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1200549578 Y:4560956-4560978 AAATATAGACAGAAAAAAACTGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic