ID: 1015768278

View in Genome Browser
Species Human (GRCh38)
Location 6:136742477-136742499
Sequence TAATTTCTGCAGAGGGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10805
Summary {0: 1, 1: 1, 2: 13, 3: 446, 4: 10344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015768278_1015768282 30 Left 1015768278 6:136742477-136742499 CCTTACACCCTCTGCAGAAATTA 0: 1
1: 1
2: 13
3: 446
4: 10344
Right 1015768282 6:136742530-136742552 ATGAAAAACTATAAAACTCCTGG 0: 2
1: 9
2: 39
3: 151
4: 780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015768278 Original CRISPR TAATTTCTGCAGAGGGTGTA AGG (reversed) Intronic
Too many off-targets to display for this crispr