ID: 1015768282

View in Genome Browser
Species Human (GRCh38)
Location 6:136742530-136742552
Sequence ATGAAAAACTATAAAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 2, 1: 9, 2: 39, 3: 151, 4: 780}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015768279_1015768282 23 Left 1015768279 6:136742484-136742506 CCCTCTGCAGAAATTAACTCAAA 0: 1
1: 6
2: 138
3: 1221
4: 6853
Right 1015768282 6:136742530-136742552 ATGAAAAACTATAAAACTCCTGG 0: 2
1: 9
2: 39
3: 151
4: 780
1015768280_1015768282 22 Left 1015768280 6:136742485-136742507 CCTCTGCAGAAATTAACTCAAAT 0: 1
1: 0
2: 2
3: 40
4: 399
Right 1015768282 6:136742530-136742552 ATGAAAAACTATAAAACTCCTGG 0: 2
1: 9
2: 39
3: 151
4: 780
1015768278_1015768282 30 Left 1015768278 6:136742477-136742499 CCTTACACCCTCTGCAGAAATTA 0: 1
1: 1
2: 13
3: 446
4: 10344
Right 1015768282 6:136742530-136742552 ATGAAAAACTATAAAACTCCTGG 0: 2
1: 9
2: 39
3: 151
4: 780

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015768282 Original CRISPR ATGAAAAACTATAAAACTCC TGG Intronic
900750425 1:4392875-4392897 ATGCAAAACTATAAAACTCTTGG + Intergenic
901120618 1:6890161-6890183 ATGAAAAAATATGAAATTACAGG - Intronic
901339566 1:8483728-8483750 ATGAAAAACTATGAAGCCACTGG + Intronic
901910890 1:12456974-12456996 ATGTAAAACTAAAAAACACCTGG - Intronic
901911696 1:12463963-12463985 ATAAAGAACTATAAAAATGCTGG + Intronic
904961433 1:34336287-34336309 ATGGATAAATATGAAACTCCTGG - Intergenic
904985322 1:34542744-34542766 AGACAAAACTATAAAACACCTGG + Intergenic
904986575 1:34555011-34555033 ACCAAAAACTATAAAAACCCTGG + Intergenic
905520212 1:38593068-38593090 ATGAAAAACAATAAAACTTATGG - Intergenic
905712025 1:40113328-40113350 ACCTAAAACTATAAAAATCCTGG + Intergenic
906582082 1:46944208-46944230 ATGTAAAACCATAAAAAGCCTGG + Intergenic
906601634 1:47134692-47134714 ATGTAAAACCATAAAAAGCCTGG - Intergenic
907007041 1:50925244-50925266 ACTCAAAACTATAAAACTGCTGG + Intronic
907351615 1:53836829-53836851 AGCTAAAACTATAAAACTCTTGG + Intronic
907467291 1:54647246-54647268 AGCAAAAACTATAAAACTCTTGG - Intronic
907686077 1:56613037-56613059 ACCTAAAACTATAAAAATCCTGG + Intronic
907722741 1:56987318-56987340 AAAAAAAACTGTAAAAATCCAGG - Intergenic
908198026 1:61765024-61765046 AAGAAAAAATAAAAAACCCCTGG - Intronic
908818964 1:68063254-68063276 ATCTAAAACTATAAAAATCCTGG + Intergenic
909101348 1:71353134-71353156 ATCCAAAACTATAAAAACCCTGG + Intergenic
909131714 1:71745371-71745393 AGAACAAACTATAAAACTCAGGG - Intronic
909245788 1:73281390-73281412 ACACAAAACTATAAAACTTCTGG - Intergenic
909274107 1:73663126-73663148 ATGTAAAACTATAAGAATTCTGG - Intergenic
910395301 1:86787344-86787366 ATCTGAAACTATAAAACTCCAGG + Intergenic
910599635 1:89017398-89017420 AGCTAAAACTATAAAACTCATGG + Intronic
911160849 1:94681628-94681650 TTGAAAAACTATAAAATACCTGG - Intergenic
911262026 1:95698074-95698096 AGGTAAAACTATAAAGCTACAGG + Intergenic
911275835 1:95856341-95856363 AAGATAAACTATAATACTTCTGG - Intergenic
911343122 1:96663321-96663343 ATGCAAAATTGTAAAACTCCTGG - Intergenic
911414982 1:97560490-97560512 ATTAAAAATTATGAAACACCTGG - Intronic
911667766 1:100573326-100573348 ACCCAAAACTATAAAAATCCTGG + Intergenic
911781215 1:101881603-101881625 ATTAAGAACTATAAAACTACAGG - Intronic
911838621 1:102653388-102653410 ATCAAAAACATTAAACCTCCTGG + Intergenic
911970807 1:104434859-104434881 ATGAAAGTCTATAAAACTTTGGG + Intergenic
911992963 1:104725943-104725965 ATACAAAACTGTAAAACTACTGG + Intergenic
912047518 1:105478650-105478672 ATGAAAAAATAGGAAAATCCTGG + Intergenic
912279640 1:108299365-108299387 ACATAAAACTATAAAAATCCTGG - Intergenic
912288586 1:108394992-108395014 ACATAAAACTATAAAAATCCTGG + Intronic
912604137 1:110970983-110971005 ACTCAAAACTATAAAAATCCTGG + Intergenic
912613215 1:111069922-111069944 ATCAAAATCTATAAAAATGCTGG - Intergenic
912885003 1:113461602-113461624 ATTCAAAACTATAAAAACCCTGG + Intronic
913408108 1:118518281-118518303 ACTCGAAACTATAAAACTCCTGG - Intergenic
914329359 1:146651676-146651698 ACCTAAAACTATAAAAATCCTGG + Intergenic
914842132 1:151257055-151257077 ACCCAAAACTATAAAAATCCTGG - Intronic
915442819 1:155956518-155956540 AAGAAAAATTATAAAAATCTTGG + Intronic
915714975 1:157936689-157936711 ATAAAAATCTATGAAAGTCCAGG - Intergenic
915816168 1:158967972-158967994 ATCTAAAACTATAAAAACCCTGG + Intronic
916251764 1:162745437-162745459 ATCTAAAAGTATAAAACTCCTGG - Intronic
916396703 1:164398151-164398173 AGCTAAAACTATAAAACTCTTGG + Intergenic
916643273 1:166755329-166755351 ATACAAAACTATAAAAACCCTGG + Intergenic
916984058 1:170171482-170171504 ACCCAAAACTATAAAAATCCTGG - Intergenic
917524821 1:175778938-175778960 ATGCAAAACTATAAAAACCCTGG + Intergenic
917585294 1:176420288-176420310 ACCAAAAACTATAAAAACCCTGG - Intergenic
918051772 1:180979570-180979592 ATGCAAAATTATCAAACTCCTGG + Intronic
918147022 1:181765978-181766000 ATGAAACATAATAAAACGCCAGG + Intronic
918629361 1:186697506-186697528 ACCAAAAACTATAAAAACCCTGG + Intergenic
918749468 1:188254632-188254654 ATGCATAATTATAAAACTTCTGG - Intergenic
918835165 1:189452983-189453005 ATCTGAAACTATAAAACTACTGG - Intergenic
919108613 1:193188703-193188725 ATCAAAATCTATAATAATCCAGG - Intronic
919117406 1:193297634-193297656 ACACAAAACTATAAAACTTCTGG + Intergenic
919453102 1:197794024-197794046 ATGTAAAACTATAAAAACCCTGG - Intergenic
919740177 1:200976673-200976695 ATGAAAAATTATAAGACTTCTGG - Intronic
920787579 1:209056946-209056968 ATCCAAAACTATAAAAACCCTGG + Intergenic
920935108 1:210425454-210425476 ACCCAAAACTATAAAAATCCTGG - Intronic
920997220 1:211005636-211005658 ATGGAAAACAATAAAACTAGCGG + Intronic
921127667 1:212191694-212191716 ACCTGAAACTATAAAACTCCTGG + Intergenic
921351192 1:214237269-214237291 ACCTAAAACTATAAAAGTCCTGG - Intergenic
921372887 1:214443690-214443712 TTGAAAAACCAAAAAACTTCAGG + Intronic
921504559 1:215952203-215952225 ATGGAAAACTAAAAAAGTCAGGG - Intronic
922318965 1:224467805-224467827 ATGTAAAACTATGAAACTTTTGG - Intronic
922493187 1:226035140-226035162 AAAAAAACCTATAAAAATCCGGG - Intergenic
922672771 1:227525348-227525370 TTAAAAAATTATAAAACTCTTGG - Intergenic
924771483 1:247084275-247084297 AACCAAAACTATAAAAATCCTGG + Intergenic
1063304213 10:4881662-4881684 ATGAAAAACTAGAAAACCTTGGG - Intergenic
1063732785 10:8718585-8718607 ATATAAAAGTATAAAACTCATGG - Intergenic
1063758657 10:9045908-9045930 ACTCAAAACTATAAAAATCCTGG - Intergenic
1064515196 10:16139817-16139839 ATGCAAAACTATAAAAACCCTGG - Intergenic
1064707941 10:18092201-18092223 ATGAAAACCTAAAGAACTTCCGG + Intergenic
1064828784 10:19438014-19438036 ATAAAAAAATCTAAAACTCACGG - Intronic
1065372668 10:25004873-25004895 ACCCAAAACTATAAAAATCCTGG - Intronic
1065592240 10:27276020-27276042 ACTAAAAACTATAAAAACCCTGG + Intergenic
1065598514 10:27343972-27343994 ATACAAAACTATAAAACTTCTGG - Intergenic
1066356777 10:34692283-34692305 ATCTAAAACTATAAAAACCCTGG + Intronic
1066665046 10:37774522-37774544 ATGCTAGGCTATAAAACTCCAGG + Intergenic
1067168757 10:43886876-43886898 ATGTGAAACGATAAAATTCCTGG + Intergenic
1067319153 10:45200700-45200722 ATACAAAACTATAAAACTTCTGG - Intergenic
1068055656 10:52010051-52010073 ACCTAAAACTATAAAACTCATGG + Intronic
1068221223 10:54048512-54048534 ATGCAAAACTATAAAAATCCTGG - Intronic
1068483718 10:57629019-57629041 ACAAGAAACTATAAAACTTCTGG + Intergenic
1068640641 10:59402229-59402251 AACAAAAACTGTAAAACTCTTGG - Intergenic
1068663780 10:59650680-59650702 ATGTAAAACTATAAATTACCTGG - Intergenic
1068696800 10:59976353-59976375 ATGCAATACTATAAAACTCCTGG - Intergenic
1069167708 10:65184136-65184158 ATGTAAAATTATAAAACTTCCGG + Intergenic
1069274581 10:66573448-66573470 ATTAATAACTGTAACACTCCAGG + Intronic
1069330805 10:67290467-67290489 ATGCAAAACCATAAAAATCATGG + Intronic
1069474899 10:68723423-68723445 TTAAAAAACTACAAAACTGCCGG - Intronic
1070054047 10:72917273-72917295 ACCCAAAACTATAAAAATCCTGG - Intronic
1071061250 10:81572151-81572173 TATAAAAACTATAAAAATCCTGG + Intergenic
1071236280 10:83653369-83653391 ATTTGAAACTATAAAACTCCTGG - Intergenic
1071584207 10:86803476-86803498 ATGTAAAACTATAAAAGAACTGG - Intronic
1073656232 10:105420034-105420056 ATGAAACAGCATATAACTCCAGG - Intergenic
1073991985 10:109271838-109271860 AGTGAAAACTGTAAAACTCCTGG - Intergenic
1074645848 10:115451148-115451170 ACACAAAACTATAAAAATCCTGG + Intronic
1074706310 10:116135307-116135329 ATGATCAACTATAAAAATCTCGG + Intronic
1074746258 10:116535808-116535830 ATGTAAAACTACAAAAACCCTGG - Intergenic
1076129896 10:128006477-128006499 ATGAAAGACTATAAACCTCCTGG - Intronic
1076142056 10:128087092-128087114 ATGAACAACAGTCAAACTCCTGG + Intergenic
1077670024 11:4148709-4148731 ACCCAAAACTATAAAACTACTGG + Intergenic
1078035548 11:7801117-7801139 ATGCAAAACTATAAAAACCCTGG + Intergenic
1078946689 11:16076139-16076161 ACCTAAAACTATAAAAATCCTGG + Intronic
1079255366 11:18823355-18823377 ACCAAAAACTATAAAAACCCTGG - Intergenic
1079511285 11:21213857-21213879 ATGTAAAAATATAAAACTATTGG + Intronic
1079689034 11:23399882-23399904 ATGGAGAACTATAAAACTGAAGG + Intergenic
1079768333 11:24424039-24424061 ACGAAAAACTAAAAAACACCTGG + Intergenic
1080241501 11:30132285-30132307 AGCTAAAACTATAAAACTTCTGG - Intergenic
1080369326 11:31616453-31616475 ATTCAAAACTATTAAAATCCTGG + Intronic
1080383317 11:31796231-31796253 AAGGGAAACTATTAAACTCCTGG + Intronic
1080845148 11:36020571-36020593 ATGAACAACTTTTAAACTACAGG - Intronic
1081213272 11:40362141-40362163 ATTCAAAACTATAAAAACCCTGG + Intronic
1081378146 11:42384084-42384106 ATAAAAAACTATTCAAATCCAGG + Intergenic
1082057311 11:47829746-47829768 ACGCAAAACTATAAAAACCCTGG + Intronic
1082280949 11:50270749-50270771 ATGTAAAAGTATAAAACTTTTGG + Intergenic
1082582874 11:54895200-54895222 ACGTAAAACTATAAAAACCCTGG + Intergenic
1082868895 11:57925181-57925203 AAGAAAAACTACAAAACACTGGG + Intergenic
1082960131 11:58911931-58911953 ATATAAAACTATAAAACTTCTGG - Intronic
1083530215 11:63414164-63414186 ATGTAAGACCATAAAACTCTTGG + Intergenic
1084142429 11:67241491-67241513 ATGAAAATACATAAAAGTCCTGG + Intronic
1085059886 11:73435632-73435654 ATTAACAGTTATAAAACTCCTGG - Intronic
1085211268 11:74781335-74781357 ATGAAAAACTATAAAGGCCCTGG - Intronic
1085526040 11:77164780-77164802 TTGTAAAACTATAGAACGCCAGG + Intronic
1085852307 11:80136370-80136392 AAGAAAGCCTATGAAACTCCTGG - Intergenic
1085917281 11:80904300-80904322 ATAAAAAACAATAAAACTTCAGG + Intergenic
1086023107 11:82256147-82256169 ATGAAAAAATATAAGACTGGTGG - Intergenic
1086086716 11:82962963-82962985 ACCAAAAACTATAAAAACCCTGG - Intronic
1086090533 11:83000462-83000484 AAGAAAAATAATAAAACTCACGG + Intronic
1086211401 11:84324172-84324194 ACCTAAAACTATAAAACTCCTGG - Intronic
1086280921 11:85187605-85187627 ATGAAAAACTACTCAACTACAGG + Intronic
1086611831 11:88766583-88766605 ATCCAAAACTATAAAAATCCTGG + Intronic
1087373528 11:97315654-97315676 AACCAAAACTATAAAAATCCTGG - Intergenic
1087414025 11:97829688-97829710 ACCCAAAACTATAAAAATCCTGG + Intergenic
1087415107 11:97845095-97845117 ATGAAATACTATTAAACTGAAGG - Intergenic
1087489015 11:98799554-98799576 ATGAAAAACTATAGATCGCATGG + Intergenic
1087601417 11:100320885-100320907 ATGAAACAGAATAAAACACCGGG - Intronic
1087711520 11:101558898-101558920 ATCAAAAACTGTAAAACTACTGG + Intronic
1088032729 11:105271044-105271066 ATGCAAAACTATAAAACTCTTGG - Intergenic
1088163084 11:106897735-106897757 ATGCAAAACTATAAAATTCCTGG + Intronic
1088409365 11:109516510-109516532 ATCCAAAACTATAAAAGCCCTGG + Intergenic
1088461462 11:110087928-110087950 AAGAAAAATTTTAAAACTTCTGG + Intergenic
1088806108 11:113353575-113353597 ATCCAAAACTATAAAAACCCTGG - Intronic
1089686615 11:120153086-120153108 ACTAAAAACTACAAAACTGCTGG - Intronic
1090528961 11:127569322-127569344 CTGTAAAACTACAAAACTCCTGG + Intergenic
1090559743 11:127919087-127919109 TTACAAAACTATAAAACTACAGG - Intergenic
1091454341 12:595219-595241 ACACAAAACTATAAAACTCCTGG + Intronic
1091651647 12:2314651-2314673 ATGAACAACTTTAAAACTACAGG - Intronic
1091892098 12:4065849-4065871 ATTAAAAAGAATAAAACTCTTGG - Intergenic
1091994712 12:4984176-4984198 ATCAAAAACTATCAAGCTCTTGG - Intergenic
1092014549 12:5147527-5147549 ATTTAAAACTATAAAAATTCTGG - Intergenic
1092253001 12:6911710-6911732 ATGAAAATAAATAAAATTCCAGG + Intronic
1093109646 12:15134206-15134228 TGGTAAAACTATGAAACTCCTGG - Intronic
1093239655 12:16654410-16654432 ATATAAAACTATAAAAAGCCAGG - Intergenic
1093380040 12:18480908-18480930 ATAAAAAAATAAAAAACTCAAGG - Intronic
1093422884 12:18995354-18995376 AAGAAAAACTCTAAAACACTGGG - Intergenic
1093491921 12:19714763-19714785 ACCCAAAACTATAAAAATCCTGG - Intronic
1093891178 12:24523771-24523793 ACCTAAAACTACAAAACTCCTGG + Intergenic
1093982900 12:25494385-25494407 ATGAAAAAATGTAAAACTTTTGG - Intronic
1094531645 12:31281022-31281044 ATTAAGAACTATAAAACTACAGG + Exonic
1094764669 12:33578871-33578893 ACCAAAAACTATAAAAACCCTGG + Intergenic
1095128714 12:38512074-38512096 ATGAAAAACTGGCAAAGTCCGGG + Intergenic
1095675309 12:44910439-44910461 ATTAAAAACTCAAAAACACCAGG + Intronic
1095835515 12:46634076-46634098 ATGCAAAACCATAAAACTCCTGG - Intergenic
1096170587 12:49466098-49466120 AGATAAAACTATAAAACTTCTGG - Intronic
1096547308 12:52349099-52349121 AGGTAAAACTATAAAACTAACGG - Intergenic
1096998126 12:55852687-55852709 ATGCAAAATTACAGAACTCCTGG + Intergenic
1097077441 12:56405984-56406006 ATGAAAAATCTTAAAACTACTGG - Intergenic
1097141503 12:56906058-56906080 ATGAAAAGTTATACAACTACCGG + Intergenic
1097258993 12:57703214-57703236 AGCTAAAACTATAAAACTCTTGG - Intronic
1097455171 12:59791374-59791396 ACAAAAACATATAAAACTCCTGG - Intergenic
1098099179 12:66995225-66995247 AGCTAAAACTATAAAACTCATGG + Intergenic
1098325307 12:69296159-69296181 CCTTAAAACTATAAAACTCCTGG + Intergenic
1098327596 12:69318511-69318533 ACCAAAAACTATAAAAGCCCTGG - Intergenic
1098725255 12:73956798-73956820 GTGTATAACTATAAAACTTCTGG - Intergenic
1099627365 12:85091614-85091636 ATCTAAAACTATAAAAATCCAGG - Intronic
1099860599 12:88221155-88221177 ACCTAAAACTATAAAAATCCTGG + Intergenic
1100880779 12:99014401-99014423 ATCAAAAACTACAAAAACCCTGG + Intronic
1102099465 12:110267268-110267290 ATGAATAAAAATAAAAATCCCGG + Intergenic
1102322625 12:111950710-111950732 ACCCAAAACTATAAAAATCCTGG + Intronic
1104258872 12:127164722-127164744 ATCTATAACTATAAAAATCCTGG - Intergenic
1104288952 12:127450796-127450818 ATTAAAAGCTATGATACTCCTGG - Intergenic
1104616573 12:130275119-130275141 ATGCAAAACTGTAAAACACCCGG - Intergenic
1105034761 12:132910556-132910578 ATGCAAAACTATACAACTCCTGG - Intronic
1105222625 13:18347024-18347046 ATGAAAAAAAAAAAAAATCCAGG - Intergenic
1105350393 13:19609962-19609984 ATGGAAAACTCTAAAACTCCTGG - Intergenic
1105654184 13:22417480-22417502 ACACAAAACTATAAAACTTCTGG + Intergenic
1105741857 13:23333910-23333932 ATGAAAAACTTTATCACTCTGGG + Exonic
1105988878 13:25597993-25598015 AGCTAAAACTACAAAACTCCTGG - Intronic
1106024538 13:25944543-25944565 ATGACACACTACAGAACTCCTGG - Intronic
1106180463 13:27365129-27365151 TTGAAAAATTAACAAACTCCAGG - Intergenic
1106637786 13:31548288-31548310 ATGCAAAAGTATAAAACTCCTGG - Intergenic
1106755401 13:32818046-32818068 ACCTAAAACTGTAAAACTCCTGG + Intergenic
1106765806 13:32913216-32913238 ATCAAAAAATATAAAATTCCAGG - Intergenic
1106845472 13:33733746-33733768 CAGAAACACTCTAAAACTCCTGG - Intergenic
1107158736 13:37200037-37200059 ACCTAAAACTATAAAACCCCTGG - Intergenic
1108031983 13:46241351-46241373 ATGCAAAACTATAAAAACCCTGG + Intronic
1108326311 13:49335099-49335121 AACAAAAACTAAAAAACTTCTGG + Intronic
1108368447 13:49742005-49742027 ATGTGAAACTGTAAAACTACTGG - Intronic
1108906538 13:55481845-55481867 ACTCAAAACTATAAAAATCCTGG - Intergenic
1108941228 13:55956520-55956542 CTCTAAAACTATAAAACTCCTGG + Intergenic
1108977953 13:56472924-56472946 ACCTAAAACTATAAAAATCCTGG - Intergenic
1109346012 13:61114955-61114977 ATGAAAAATTTTACAACTACTGG + Intergenic
1109441881 13:62385071-62385093 CTCAAAAACTATCAAACTCTGGG - Intergenic
1109631049 13:65046495-65046517 ATAAACAACTATAGAACTCAAGG + Intergenic
1109729019 13:66385625-66385647 ATGAAAAAATACAAAAGTTCCGG - Intronic
1109986208 13:69989072-69989094 ACATAAAACTATAAAAATCCTGG - Intronic
1109997231 13:70144805-70144827 GTGGAAAACTATTAAACTCCTGG - Intergenic
1110258686 13:73460389-73460411 ATTCAAAACTATAAAAGTTCTGG + Intergenic
1111077327 13:83254274-83254296 ACCAAAAACTATAAAAACCCTGG + Intergenic
1111360632 13:87170793-87170815 ACTAAAAACTATAAAACTTCTGG - Intergenic
1111382902 13:87482455-87482477 CTGAAAAATTCAAAAACTCCAGG - Intergenic
1111781398 13:92730494-92730516 ATGCAAAATTATAAAACTCCTGG - Intronic
1112106759 13:96248957-96248979 ATGAAAGGCTATAAACCTACTGG - Intronic
1112233933 13:97617960-97617982 ACCAAAAACTATAAAAACCCTGG + Intergenic
1112373042 13:98811868-98811890 ATGTAAAACTATAAAGCTTCTGG - Intronic
1112721135 13:102247113-102247135 ATCAAAAACTATAATAACCCTGG + Intronic
1112736211 13:102422131-102422153 ACCCAAAACTATAAAAGTCCTGG + Intergenic
1112769214 13:102777288-102777310 TTGAAACATTATAAAACCCCAGG - Intergenic
1112820091 13:103323175-103323197 AGCTAAAACTATAAAACTCTTGG - Intergenic
1112863036 13:103858005-103858027 ACCCAAAACTATAAAACTACTGG + Intergenic
1114994120 14:28326378-28326400 TTTTAAAACTATAGAACTCCTGG + Intergenic
1115281739 14:31670585-31670607 AGCCAAAACTATAAAAATCCTGG - Intronic
1115286796 14:31723055-31723077 ATCAAAAGCTATAAAAATCCTGG - Intronic
1116052152 14:39817634-39817656 ACCTAAAACTATAAAACTTCTGG - Intergenic
1116093026 14:40332775-40332797 ATGCAAAGCCATAAAATTCCTGG + Intergenic
1116523885 14:45880989-45881011 ATGGAAAACATTAAAAATCCAGG + Intergenic
1116549864 14:46223356-46223378 ATCTCAAACTATAAAAATCCTGG + Intergenic
1116694388 14:48153605-48153627 ATGTAAAACTGTAGAATTCCTGG + Intergenic
1117017966 14:51538117-51538139 ATGCAAAAATATAAAACTCCTGG - Intronic
1117079304 14:52135013-52135035 ACCAAAAACTATAAAAACCCTGG + Intergenic
1117146319 14:52839930-52839952 AGTGAAAACTATAAAACTCTTGG - Intergenic
1117451895 14:55859614-55859636 ATGTAAAACTATAGAAACCCTGG - Intergenic
1117840068 14:59851045-59851067 AACAAAAACAAAAAAACTCCAGG + Intronic
1117857092 14:60046384-60046406 ATCCAAAACTATAAAAACCCTGG - Intronic
1118018624 14:61687627-61687649 ATGGAAAACTATAAAGTTTCTGG - Intergenic
1118131664 14:62971883-62971905 ATGCAAAACTATAAAACTTATGG + Intronic
1118234521 14:63989626-63989648 ATGAAATAAAATAAAACTGCCGG - Intronic
1119277933 14:73377112-73377134 ATGTAAAACTATAAAGCTCCTGG + Intronic
1119457410 14:74768195-74768217 CCGAAAAACTAGAAAACACCTGG - Intronic
1119796426 14:77402052-77402074 ATGCAGAACTATAAAACTCCTGG + Intronic
1120131556 14:80813326-80813348 ATGTAAAACTGTAAAAACCCTGG - Intronic
1120571151 14:86117877-86117899 ATGTAAAACTATAAAAACCCTGG - Intergenic
1120657645 14:87213615-87213637 GACTAAAACTATAAAACTCCTGG - Intergenic
1122191534 14:100048000-100048022 ATCTAAAACTATAAAACTTGTGG + Intronic
1125054359 15:35340200-35340222 ATGGAAAACCAAAAAACTCAGGG - Intronic
1125335789 15:38625046-38625068 AAGAAAAAAGAAAAAACTCCTGG - Intergenic
1125416471 15:39459018-39459040 ACGTAAAAGTATAAAAATCCTGG - Intergenic
1126288676 15:47046132-47046154 ATGAAAAATTCTACAACTACTGG - Intergenic
1126408387 15:48346632-48346654 AGCTAAAACTATAAAACTCTTGG - Intergenic
1126528632 15:49687343-49687365 GTGAAAAAGTCAAAAACTCCTGG + Intergenic
1126537793 15:49785260-49785282 ACACAAAACTAAAAAACTCCTGG - Intergenic
1126611775 15:50537329-50537351 ACAGAAAACTACAAAACTCCTGG + Intronic
1126863356 15:52909258-52909280 ACCTAAAACTATAAAACTTCTGG - Intergenic
1126871911 15:52998511-52998533 ATGCAAAACCATAAAAGTCCTGG + Intergenic
1127798629 15:62458772-62458794 AAGAAAAAATAAAAAACTCAAGG + Intronic
1128172640 15:65526360-65526382 CTGGTGAACTATAAAACTCCAGG - Intergenic
1128531976 15:68459908-68459930 AGGAAAAACTATAAAACTATTGG + Intergenic
1128574520 15:68762902-68762924 ATGTAAAACTATAAAACCTTTGG + Intergenic
1128754789 15:70174325-70174347 ATGAAAGACTTTGAACCTCCAGG + Intergenic
1128848645 15:70927590-70927612 AGGTAAAACTATAAACCTTCTGG - Intronic
1128859998 15:71061467-71061489 ACAAAAAACTATAAATCTACTGG - Intergenic
1128966087 15:72059912-72059934 ATTAAGAACTATAAAACTACAGG - Intronic
1129149509 15:73679126-73679148 ATAAAAAAGGATTAAACTCCTGG + Intergenic
1129309723 15:74698091-74698113 ATGGAACACTATAAAACTCCTGG - Intergenic
1129585175 15:76855304-76855326 ACCCAAAACTATAAAAATCCTGG + Intronic
1130185930 15:81682227-81682249 ACCCAAAACTATAAAACCCCTGG + Intergenic
1130708380 15:86254932-86254954 ATTAAAATCTATAAAACCCAAGG - Intronic
1130786114 15:87098637-87098659 ACCCAAAACTATAAAAATCCTGG - Intergenic
1131358636 15:91768891-91768913 ATGTAAAATTGTCAAACTCCAGG - Intergenic
1131581203 15:93645607-93645629 ATGAAAAATTAATAACCTCCTGG + Intergenic
1131628176 15:94146982-94147004 AGGAAAAACTAGAAAAGTTCAGG - Intergenic
1132893540 16:2216238-2216260 ATGTAAAAATGTAAAACTTCCGG - Intergenic
1135873390 16:26173023-26173045 AGAAAAAACTATTAAACTTCTGG - Intergenic
1136219091 16:28816438-28816460 ATGAAAAACAGTTGAACTCCTGG - Intergenic
1136923314 16:34349900-34349922 ATAGACAACTGTAAAACTCCAGG - Intergenic
1136981259 16:35061906-35061928 ATAGACAACTGTAAAACTCCAGG + Intergenic
1137969454 16:52969712-52969734 ACCTAAAACTATAAAAATCCTGG - Intergenic
1138306930 16:55986191-55986213 GTACAAAACTATAAAATTCCTGG - Intergenic
1138769156 16:59641953-59641975 ATGTAAAACTATAAAACTTTTGG - Intergenic
1138873652 16:60923631-60923653 GTAAAAAAATATAAAACTCATGG - Intergenic
1138905673 16:61328555-61328577 ACCTAAAACTATAGAACTCCTGG - Intergenic
1139035623 16:62942623-62942645 ATGCAAAACTATAAAAACCCTGG - Intergenic
1139117016 16:63966951-63966973 ATTAAAAATTATAAAATTGCTGG + Intergenic
1139184065 16:64783327-64783349 ATACAAAATCATAAAACTCCTGG - Intergenic
1139220195 16:65174104-65174126 ATGTAAACCTATAAAACTTTTGG - Intergenic
1140004202 16:71059258-71059280 ACCTAAAACTATAAAAATCCTGG - Intronic
1140317306 16:73911663-73911685 ATTAAAAACTGTAAAAATCTGGG - Intergenic
1140627406 16:76810765-76810787 ATGGAAAGTTAGAAAACTCCGGG - Intergenic
1141144384 16:81518708-81518730 ATTAAAAAATATAAAAGGCCAGG + Intronic
1142729046 17:1838676-1838698 AGCGAAAACTATAAAACTTCTGG - Intronic
1144079913 17:11754940-11754962 ATCCAAAACTATAAAAGCCCTGG - Intronic
1144377168 17:14655735-14655757 ATGTAAATATATAAAACTCACGG - Intergenic
1144616180 17:16775817-16775839 ACCCAAAACTATAAAAATCCTGG - Intronic
1145096025 17:20027538-20027560 ACCCAAAACTATAAAACTACTGG - Intronic
1145107377 17:20130094-20130116 ATGTAAAACTATAAGACTTTCGG - Intronic
1145286395 17:21509241-21509263 ATGTAAAACTATAAAATTTTAGG - Intergenic
1145391217 17:22457076-22457098 ATGTAAAACTATAAAATTTTAGG + Intergenic
1146104975 17:30026600-30026622 ATGTACAACTAAAAAAGTCCTGG - Intronic
1146514507 17:33478987-33479009 ATAAAATAAAATAAAACTCCTGG - Intronic
1146912026 17:36654657-36654679 ATGTAAAACAATACAACTTCTGG + Intergenic
1149022140 17:51980630-51980652 ATCTAAAACTATAAAAACCCTGG - Intronic
1149106732 17:52976509-52976531 ATGTAAAACTATAAAACCACTGG - Intergenic
1149137401 17:53385117-53385139 ATCTAAAATCATAAAACTCCTGG + Intergenic
1149245823 17:54706537-54706559 ATGAAAAACTATAAAAACTGTGG - Intergenic
1149443551 17:56695940-56695962 ATATAAAATTATAAAACTCCTGG - Intergenic
1149573217 17:57690891-57690913 ATGCGAAACTATAAAACTTGTGG - Intergenic
1150038090 17:61826273-61826295 AACAAAAACTATAAAAACCCTGG + Intronic
1150375177 17:64675332-64675354 ATGAAAAAGTTTAAAACTTTTGG - Intergenic
1150801362 17:68285675-68285697 AACAAAAACAAAAAAACTCCTGG + Intronic
1151020062 17:70604611-70604633 AGGAAATACTATAAAACAGCAGG - Intergenic
1151044891 17:70908334-70908356 ATGCCACACTATAAAACTCCTGG + Intergenic
1151119634 17:71778346-71778368 ATAAATAGCTATAAAACCCCAGG - Intergenic
1151393857 17:73806469-73806491 ATCTAAAACTGTAAAACTTCTGG + Intergenic
1152370291 17:79883662-79883684 TTCAAAAACTACAAAACTTCTGG - Intergenic
1153469051 18:5422557-5422579 ATTAAAAACAACAAATCTCCAGG + Intronic
1153515437 18:5896330-5896352 AAGGAAAACTATAATTCTCCAGG + Intergenic
1153543535 18:6182652-6182674 ATCTAAAACTACAAAAGTCCTGG - Intronic
1154047933 18:10925078-10925100 ATGAAGAACTATAAACCACCAGG - Intronic
1154178914 18:12112592-12112614 ACCAAAAACTATAAAAACCCAGG + Intronic
1154183022 18:12153984-12154006 ACCAAAAACTATAAAAATCCCGG + Intergenic
1154376506 18:13814709-13814731 ATTAAAAATTATGAAACTCAAGG - Intergenic
1155665368 18:28301291-28301313 ATTCAAAACTATAAAACTCCTGG + Intergenic
1155679380 18:28471274-28471296 ATGACATAGTATACAACTCCAGG + Intergenic
1155764800 18:29614970-29614992 ATCAAAAACTATAAAAACCATGG + Intergenic
1156067986 18:33168196-33168218 ACCAAAAACTATAAAAACCCTGG - Intronic
1156238060 18:35223244-35223266 ACCCAAAACTATAAAAATCCTGG - Intergenic
1156618659 18:38821405-38821427 ACCAAAAACTATAAAAACCCTGG + Intergenic
1156853282 18:41753403-41753425 AGGAAAAACTATGAAATACCAGG - Intergenic
1156879519 18:42060215-42060237 AAGAAAAACTATAAAATAACAGG - Intronic
1157343221 18:46799119-46799141 GTTAAAATCTATAAAACTCTTGG + Intergenic
1157756742 18:50225176-50225198 ATGAAATATTTTAAAACTCTAGG - Intergenic
1158030350 18:52956174-52956196 ATGCTAAACTATAAAACTCCTGG - Intronic
1158082869 18:53615150-53615172 ATGAAAAAGTACAAACTTCCAGG + Intergenic
1158083369 18:53620714-53620736 GTGCAAAAGTATACAACTCCTGG + Intergenic
1158095789 18:53769100-53769122 TTTAAAAACTATAAAAATCCCGG + Intergenic
1158522774 18:58185320-58185342 ATGAAACACTTTAAAACTCCCGG + Intronic
1158596073 18:58816980-58817002 ATGAAAAAGTGAAAAACTCATGG - Intergenic
1158730271 18:60015083-60015105 ATTAAGAACTATAAAACTACAGG + Intergenic
1158777067 18:60595567-60595589 ATCCAAAACTTTAAAACTCTTGG - Intergenic
1159663807 18:71131914-71131936 ATGACAAAGTATAAAGCTCAGGG - Intergenic
1159681633 18:71360607-71360629 ATTAAAAACAATTGAACTCCTGG + Intergenic
1160275210 18:77426246-77426268 AACAAAAACTATAAAAATCCTGG - Intergenic
1160393286 18:78553289-78553311 ATGAACAATTATAAAACTTCTGG + Intergenic
1162454962 19:10777997-10778019 ATGAAAAAATAAAATATTCCAGG - Intronic
1163043692 19:14623304-14623326 AAAAAAAAAAATAAAACTCCTGG + Intronic
1164238096 19:23355480-23355502 ATCAGAAACTATAAAAATTCTGG + Intronic
1164396665 19:27870679-27870701 ATGCAAAACTGTAAAACTTCTGG + Intergenic
1164498948 19:28796087-28796109 TTGAAAAAATCTAACACTCCTGG - Intergenic
1164659537 19:29950455-29950477 TTGAAAAATTATAAAAGTACAGG + Intronic
1164765518 19:30763269-30763291 ATGCAAAACTATAAAACTCCTGG - Intergenic
1164793022 19:31003969-31003991 ATCAAAAACTATATAAATGCAGG + Intergenic
1164921900 19:32094545-32094567 AACAAAAACCATAAAACCCCAGG + Intergenic
1165194527 19:34091303-34091325 TTTAAAAACTAAAAAACGCCGGG + Intergenic
1165557941 19:36652189-36652211 ATGTAAAACTATAAAATTTCTGG + Intronic
1165689021 19:37848477-37848499 AAGCAAAAATATAAAAATCCAGG + Intergenic
1165972797 19:39647108-39647130 ATGCAAAACTATAAAAACCTTGG + Intergenic
925017292 2:540459-540481 ATCTAAAACTATAAAAACCCTGG + Intergenic
925471540 2:4167009-4167031 AATGAAAACTATAAAATTCCTGG - Intergenic
926498780 2:13625945-13625967 ATGTAAAACTATAAAATATCTGG + Intergenic
927046533 2:19284656-19284678 ACCAAAAACTATAAAAACCCTGG + Intergenic
927679494 2:25130509-25130531 GGGAACAACTATGAAACTCCCGG - Intronic
928382379 2:30829749-30829771 ATGAAAAACCTTACAACTACTGG + Intergenic
928581769 2:32715185-32715207 ACCAAAAACTATAAAATCCCTGG - Intronic
928776008 2:34764660-34764682 ATGTAAAACCATAAAAACCCTGG - Intergenic
929181216 2:39041627-39041649 ATCTAAAGCTATAAAACTCTTGG - Intronic
929362325 2:41108578-41108600 AGCAAAAACTAAAAAACACCTGG + Intergenic
929421713 2:41797132-41797154 ATGCAAAATTATAAAACTTCTGG - Intergenic
930290694 2:49489976-49489998 ATGAAAATCTATCAAACCCCTGG + Intergenic
930302592 2:49635885-49635907 ACCTAAAACTATAAAAATCCTGG + Intergenic
930737915 2:54798467-54798489 ATTAAAAACTATAAAATGGCCGG - Intronic
930770382 2:55125137-55125159 ATGCAAAACTATAAAAACCCTGG + Intergenic
930854900 2:56004264-56004286 ATGCAAAACTATAAAACTCCTGG - Intergenic
931081754 2:58781420-58781442 ATTAACAAATATAAAACTCTCGG + Intergenic
931496181 2:62809477-62809499 ACAAAAAACAAAAAAACTCCAGG - Intronic
931865538 2:66406766-66406788 AGCTAAAACTATAAAACTCTTGG + Intergenic
931889616 2:66656924-66656946 ACCCAAAACTATAAAAATCCTGG - Intergenic
932382097 2:71293962-71293984 AGTGAAAACTATAAAACTCTTGG - Intronic
932852936 2:75204290-75204312 ATGTAAAACTATAAAAACCCTGG - Intergenic
932867445 2:75359133-75359155 GTGTAAAACTATAAAAACCCTGG - Intergenic
932913228 2:75827362-75827384 CTCTAAAACTATAAAAATCCTGG + Intergenic
932930158 2:76026559-76026581 ATCTAAAACTACAAAAATCCTGG + Intergenic
932967713 2:76497034-76497056 ATGAAGAACTTTAAAGCTACTGG - Intergenic
933321817 2:80785267-80785289 GTTAAAAACTATAAAAAGCCTGG - Intergenic
933595029 2:84274743-84274765 ATGAAAATATATAAAATGCCAGG + Intergenic
933872850 2:86586522-86586544 ATGCAAAACTATAAAACTACTGG + Intronic
935260152 2:101347923-101347945 ATGTAAAACTATAAAACTATAGG - Exonic
935733567 2:106086902-106086924 AAGAAAAAAAAAAAAACTCCAGG - Intergenic
935793559 2:106616965-106616987 ATACAAAACTATAAAATTTCTGG - Intergenic
935802231 2:106709403-106709425 ATCAAACACAATAAAACTCCAGG + Intergenic
935853724 2:107251209-107251231 ACAAAAAACTATGGAACTCCTGG - Intergenic
935923169 2:108036986-108037008 ACTCAAAACTATAAAAATCCTGG - Intergenic
936120438 2:109738192-109738214 ATGCAAAACTACAAAACTACTGG - Intergenic
936795542 2:116198455-116198477 ATGCAAAATGATATAACTCCTGG - Intergenic
937217290 2:120321000-120321022 ATGAAAATCTATATATCTCAAGG - Intergenic
937728233 2:125192952-125192974 ATGAAAAACTATAAAAACTCTGG + Intergenic
938220675 2:129564690-129564712 TTTAAAAAATATAAAATTCCTGG + Intergenic
938704701 2:133912663-133912685 ATGGAAAACTAAAAAAGTCAGGG + Intergenic
938817042 2:134915530-134915552 ATGCAAAACTGTAAAACTTCTGG - Intergenic
939027093 2:137026886-137026908 ATGAAAAACTGAAAACCTCAGGG - Intronic
939138751 2:138328015-138328037 ATGCAAAACTATAAAACTCCAGG + Intergenic
939639561 2:144622896-144622918 ATCCAAAACTATAAAAACCCTGG - Intergenic
940091277 2:149921688-149921710 ACCTTAAACTATAAAACTCCTGG + Intergenic
940119591 2:150249413-150249435 ATTAACAAATATAAACCTCCTGG - Intergenic
940621504 2:156119719-156119741 CAGAGAAACTATAAAACTCTTGG - Intergenic
940869235 2:158846312-158846334 AAGAAGAGCTATAAAACTTCAGG - Intronic
940949510 2:159657099-159657121 CTGCAAAACTGTAAAACTCCTGG - Intergenic
941105034 2:161341969-161341991 TTTAAAAATTATAAAACTTCTGG - Intronic
941117200 2:161485929-161485951 ACCTAAAACTATAAAACTACTGG + Intronic
941484057 2:166056828-166056850 CTGAAAAACTGTGCAACTCCAGG - Intronic
941497044 2:166218597-166218619 ATCTAAAACTATAAAAACCCTGG + Intronic
941536424 2:166727663-166727685 ACCAAAAACTATAAAAACCCTGG + Intergenic
941689637 2:168486436-168486458 TGCAAAAACTATAAAACTCCTGG - Intronic
941747486 2:169102613-169102635 ATGAGAAACTCTAAAGCTCTGGG + Intergenic
942108379 2:172656013-172656035 AGGACAAACTATAAAGATCCAGG - Intergenic
942404974 2:175644561-175644583 ATGTAGAAGTATAAAACTCCTGG - Intergenic
942538030 2:176985835-176985857 AGCAAAGACTATAAAAATCCAGG - Intergenic
942561753 2:177227088-177227110 ATTAAAGACTAGAAAACTTCAGG - Intergenic
942733729 2:179086549-179086571 ATCAAAAACGAGAAAACTACAGG - Intergenic
942819694 2:180097937-180097959 AAAGGAAACTATAAAACTCCTGG - Intergenic
942828360 2:180208246-180208268 ACCTAAAACTATAAAAATCCTGG - Intergenic
942868997 2:180712342-180712364 ACCAAAAACTATAAAAACCCTGG - Intergenic
943028880 2:182662709-182662731 ATGTAAAACTCTAAAAGCCCTGG + Intergenic
943342631 2:186698832-186698854 ATGTAAAACCATTAAACTCACGG - Intronic
943343730 2:186712238-186712260 ATTAAACATTATAAAACTCTAGG - Intronic
943855645 2:192786402-192786424 ATGAAAAACTGTACAACCCAGGG - Intergenic
944358967 2:198828945-198828967 ACCCAAAACTATAAAATTCCTGG + Intergenic
944371026 2:198984190-198984212 ACTCAAAACTATAAAAATCCTGG + Intergenic
944497500 2:200323490-200323512 ATGTAGAAATATATAACTCCTGG + Intronic
944638686 2:201699713-201699735 AAGAAAAACCCTAAATCTCCAGG - Intergenic
944750473 2:202704207-202704229 AAGAAAACATATAAAACTCTCGG + Intronic
944754665 2:202748309-202748331 ACCCAAAACTACAAAACTCCTGG + Intronic
944766196 2:202866645-202866667 ATTTAAAACTGTAAAACTCCCGG + Intronic
945156114 2:206839895-206839917 ATGCAAAACTACAAAAACCCCGG - Intergenic
945334616 2:208578063-208578085 ACCCAAAACTATAAAAATCCTGG - Intronic
945799892 2:214415218-214415240 AAGAAAAACTAAAAAATACCAGG - Intronic
945820410 2:214657753-214657775 ATCCAAAACTATAAAAACCCTGG - Intergenic
946197891 2:218048548-218048570 AAGAAACACTATAAAAACCCTGG - Intronic
947212498 2:227720973-227720995 ATGAAAACCTATACAAGGCCAGG + Intergenic
947438257 2:230091926-230091948 ATGACAAAAAATAAAACTTCAGG + Intergenic
947438355 2:230093304-230093326 ATCCAAAACTATAAAAACCCTGG + Intergenic
947975169 2:234359314-234359336 ATGCAAAACTATAAAAACCCTGG - Intergenic
948364407 2:237445394-237445416 ATGCAACACTTTAAATCTCCAGG - Intergenic
1168858440 20:1027472-1027494 AACACAAACTATAAAAATCCTGG - Intergenic
1168868839 20:1111797-1111819 ACGTAAAAATATAAAACTCTTGG + Intergenic
1169561633 20:6807636-6807658 ATACAAAACTCTAAAACTTCTGG + Intergenic
1169631036 20:7631960-7631982 ACCAAAAACTATAAATCTTCTGG - Intergenic
1170060263 20:12251628-12251650 ATCCAAAACTATAAAAACCCTGG - Intergenic
1170080915 20:12474282-12474304 ATGGAAAACTATACAACTTCTGG - Intergenic
1170246764 20:14229101-14229123 TTGCAAAACTATAAAACTTTAGG + Intronic
1170416963 20:16154662-16154684 ATGTAAAACTATTAAACCCCTGG + Intergenic
1170646905 20:18205143-18205165 AAGAATAAATAAAAAACTCCTGG + Intergenic
1170783002 20:19442806-19442828 ATGCAAAACTGTAAAACCTCTGG - Intronic
1170787017 20:19476388-19476410 ATGCAAAACCATAAAATTCCTGG + Intronic
1170927514 20:20738861-20738883 ATGAAAAACCTTACAACTACTGG + Intergenic
1171286985 20:23948335-23948357 ACCCAAAACTATAAAAATCCTGG - Intergenic
1171442078 20:25173205-25173227 ATGAAAAACCCTACAACTACTGG - Intergenic
1173309255 20:41882355-41882377 ATGAAAAAAAATAAAATTCCAGG - Intergenic
1173770893 20:45656464-45656486 ATGTAAAACCATAAAAACCCTGG + Intronic
1174042090 20:47707283-47707305 ATAAAAAATAATAAAACTGCCGG - Intronic
1174667104 20:52269393-52269415 GTTGAAAACAATAAAACTCCCGG + Intergenic
1174754452 20:53143877-53143899 TTGAATAACAATAAAACTCCGGG - Intronic
1174848669 20:53969410-53969432 ATAAAAAAATATTAAACACCCGG - Intronic
1175011032 20:55736345-55736367 ACCCAAAACTATAAAAGTCCTGG - Intergenic
1175311665 20:58016515-58016537 AAGAAAAACCATAAAAGACCTGG - Intergenic
1175356251 20:58370883-58370905 ATGAAAAGCAGTAATACTCCTGG - Intergenic
1175462896 20:59166622-59166644 ATGACAAATTATAAAACTGGAGG - Intergenic
1175749735 20:61487055-61487077 ATGCAAACCTATAAAACTCCTGG - Intronic
1176046084 20:63093360-63093382 ATGAAAAACTTTAAAAGGACGGG + Intergenic
1176705329 21:10112984-10113006 CTGAAAAAAGATAAAACTCTCGG - Intergenic
1176971044 21:15266172-15266194 AAGAAAAACTATAAAACTTTTGG - Intergenic
1176998809 21:15586999-15587021 ATGCAAAACTTTAAAAGTTCAGG - Intergenic
1177000952 21:15612514-15612536 ACATAAAACTATAAAACTCTTGG + Intergenic
1177043552 21:16142648-16142670 ACCCAAAACTATAAAAATCCTGG - Intergenic
1177283045 21:19009701-19009723 ATGCAAGACTACAAAACTCCTGG + Intergenic
1177618926 21:23561433-23561455 ATGCAAAACTATAAACATCTTGG - Intergenic
1177680136 21:24357036-24357058 AGTCAAAACTATAAAAATCCTGG - Intergenic
1178029868 21:28512000-28512022 TTGAAACAATAGAAAACTCCAGG - Intergenic
1178031474 21:28531413-28531435 ACAAAAAACTATAAAAGTCCAGG - Intergenic
1178225239 21:30709248-30709270 CTGAAATACTACAAAACTGCTGG + Intergenic
1180121944 21:45758216-45758238 TTCAAAACCTATAAATCTCCAGG - Intronic
1180254410 21:46614395-46614417 ATCCAAAACTATAAAAACCCTGG - Intergenic
1181742855 22:24935322-24935344 ATGAACAAATAAAAATCTCCTGG - Exonic
1182215584 22:28714748-28714770 AGGTAAAACTATACAACTCTGGG - Intronic
1182708195 22:32302422-32302444 ATGTAAAACTATAAAACTTTGGG - Intergenic
1182758840 22:32705166-32705188 ACCCAAAACTATAAAAATCCTGG - Intronic
1182942804 22:34294057-34294079 ATGTAAAAATATAAAATTCCTGG - Intergenic
1184307122 22:43612205-43612227 ACTAAAAACTATAAAAACCCTGG + Intronic
1184395895 22:44239883-44239905 ATGTAAAACTATAAAATTTGGGG - Intergenic
1185160348 22:49223589-49223611 ACCTAAAACTATAAAACTCTTGG + Intergenic
1185303386 22:50097069-50097091 AGCAAAAACTATAAAACTCTTGG - Intronic
950275585 3:11657627-11657649 ATGAAGAGATCTAAAACTCCTGG + Intronic
950323262 3:12078416-12078438 ATCCAAAACTATAAAATCCCTGG - Intronic
950336678 3:12200197-12200219 ATGAAAAGTTTTAAAACTACTGG - Intergenic
950823182 3:15785106-15785128 ATGCAAAACTATAAAACTCCTGG + Intronic
950937699 3:16858344-16858366 AAGCAAAACTATAAAACTAATGG - Intronic
951068773 3:18300603-18300625 ACCCAAAACTATAAAACTGCTGG + Intronic
951274196 3:20665147-20665169 ATTTAAAACTATAAAAACCCTGG - Intergenic
951296854 3:20947720-20947742 ATAAAATACTATAAAAACCCTGG - Intergenic
951333239 3:21390628-21390650 ATGAAAAAATATTAAAATACTGG + Intergenic
951361749 3:21733002-21733024 ATGCAAAACTATAAAACTCCTGG - Intronic
951367089 3:21796645-21796667 ATACAAAACTATAAAAATCATGG + Intronic
951965846 3:28383914-28383936 ATGAATAATTATAAAATTACAGG - Intronic
952004844 3:28831600-28831622 ACCCAAAACTATAAAAATCCTGG + Intergenic
952131389 3:30367716-30367738 ATACAAAACTATAAAACTACTGG - Intergenic
952340757 3:32444166-32444188 AACTAAAACTATAAAACTCTTGG - Intronic
952548875 3:34453057-34453079 ATTCAAAACTATAAACCTACTGG - Intergenic
952667698 3:35926976-35926998 ATGAAAAACTATAAAAACCTTGG - Intergenic
953122825 3:40062208-40062230 ATCCAAAACTATAAAAACCCTGG - Intronic
953172540 3:40520578-40520600 ACCTAAAACTATAAAACTTCTGG - Intergenic
953502345 3:43449424-43449446 ACACAAAACTATAAAACTTCTGG - Intronic
953688785 3:45099642-45099664 AAGAGAAAATATAAAACTCAAGG - Intronic
954029156 3:47805904-47805926 ATGAAATACAATTTAACTCCAGG - Intronic
955033031 3:55239230-55239252 TTCTAAAACTATAAAAATCCTGG + Intergenic
955204445 3:56882852-56882874 ATGAGAAACTATTAAGCTCTAGG + Intronic
956861674 3:73330212-73330234 ATGCAAAACTATAAAACTCCTGG + Intergenic
957553976 3:81742349-81742371 ATGAACAACTTTAAAAGTTCAGG + Intronic
957763305 3:84588238-84588260 ATGCAAAACTATAAAATCTCTGG - Intergenic
958013591 3:87912967-87912989 ACCCAAAACTATAAAAGTCCTGG + Intergenic
958086777 3:88819402-88819424 ATACAAAACTATAAAACTTTTGG - Intergenic
958452427 3:94290493-94290515 GTGAAAACTTATAAAACTCAGGG - Intergenic
958602669 3:96317744-96317766 ATCAAAAAAAAAAAAACTCCAGG - Intergenic
958608228 3:96388198-96388220 ATATAAAACTATAAAAACCCTGG - Intergenic
958972448 3:100626845-100626867 ATCAAAAATTATAAAATTCTTGG - Intronic
958988074 3:100806461-100806483 TTGAAAGACTATAAAAATCCAGG + Intronic
959289428 3:104454850-104454872 ATTAATAACTTTAAAAATCCTGG + Intergenic
959575620 3:107929804-107929826 AAAAATAACTATAAAACTCATGG - Intergenic
960003507 3:112757743-112757765 ATGTAAAATTATAAAACTTCAGG - Intronic
960215754 3:115035098-115035120 ATCTAAAACTATAAAACTCTTGG + Intronic
960500461 3:118431480-118431502 ACCTAAAACTATAAAAATCCTGG - Intergenic
960678492 3:120221998-120222020 ATGGAAAACAAAAAAACTTCAGG - Intronic
960819856 3:121717813-121717835 ATGGAAAACTAAAATACTTCTGG - Intronic
960929477 3:122830664-122830686 AGCTAAAACTATAAAACTCTTGG + Intronic
961227740 3:125268584-125268606 AACAAAAACTATAAAAATCCTGG + Intronic
961342047 3:126231900-126231922 ATGAATCAACATAAAACTCCTGG - Intergenic
961948996 3:130727050-130727072 TTGAAAAACTTTCAAATTCCCGG - Intronic
962007029 3:131359999-131360021 ATGAAAATCTATAAAAGCCAAGG - Intergenic
962138996 3:132768149-132768171 ATGCAAAACTTTAAAAACCCTGG - Intergenic
962225987 3:133609453-133609475 ATGAAAGACTATTTAACTCAGGG + Intronic
962507138 3:136059017-136059039 ACGCAAAACTATAAAATCCCTGG + Intronic
962832272 3:139154586-139154608 ACCAAAAACTATAAAAACCCTGG + Intronic
963013023 3:140792524-140792546 ACCCAAAACTATAAAACTACTGG + Intergenic
963057565 3:141199475-141199497 ACCCAAAACTATAAAAATCCTGG + Intergenic
963137148 3:141917294-141917316 ATGAGAAACCATAAACTTCCTGG - Intronic
963275534 3:143326096-143326118 AAGAAAAAGTATAAAAATCTTGG + Intronic
963465523 3:145676376-145676398 GTGAAAAACTCTAAAATGCCAGG + Intergenic
963579845 3:147111623-147111645 ACCCAAAACTATAAAAATCCTGG - Intergenic
964002458 3:151792006-151792028 AAAAAAAACTTTAAAACTTCTGG + Intergenic
964296103 3:155235167-155235189 ATGTAAAACTATAAAAATCCTGG - Intergenic
964501820 3:157356251-157356273 GTGAAAAATTATAAAACACAGGG - Intronic
964610907 3:158614100-158614122 ATAAAAAACTACAAAACACAGGG - Intergenic
964809571 3:160649217-160649239 ATCAGAAAAAATAAAACTCCAGG + Intergenic
964963948 3:162465853-162465875 ATCCAAAACTATAAAAACCCTGG + Intergenic
965128945 3:164669740-164669762 ATCTAAAACCATAAAAATCCTGG + Intergenic
965230532 3:166045993-166046015 ATGCAAAACTATAAAAATCATGG - Intergenic
965396012 3:168161101-168161123 ATGAAAAAAAATAAAAATCCAGG - Intergenic
965424406 3:168503800-168503822 AGTAAAAACTATAAAGCTCTTGG - Intergenic
965655839 3:170983853-170983875 ATCTGAAACTATAAAACTACTGG - Intergenic
965974299 3:174603060-174603082 ATAAAAAAATATAAAACTACAGG - Intronic
966284538 3:178278517-178278539 ATATAAAAATATAAAACTCAGGG + Intergenic
966422026 3:179743361-179743383 ACAAAAAACAAAAAAACTCCAGG - Intronic
966475776 3:180344120-180344142 ACCCAAAACTATAAAACTACTGG - Intergenic
966726116 3:183110357-183110379 ATCTAAAATTATAAAAGTCCTGG - Intronic
966737313 3:183197498-183197520 ATGTAAAACTATAAAACTTCTGG + Intronic
966972515 3:185058255-185058277 ATCCAAAACTATAAAGCTACTGG + Intergenic
967442419 3:189524554-189524576 ATGTCAACCTATAAAAATCCTGG + Intergenic
967476842 3:189931652-189931674 ATGCAAAACTGGAAAACTCCTGG - Intergenic
967609628 3:191488866-191488888 ATTAAAAACAATTGAACTCCTGG + Intergenic
967809040 3:193740235-193740257 ATGCAAAACTATAAAACTCCTGG - Intergenic
968206404 3:196805862-196805884 ATATAAAAAAATAAAACTCCAGG - Intronic
968499328 4:939797-939819 ATCTAAAACTATAAAACTCATGG + Intronic
968499588 4:941960-941982 AGTTAAAACTATAAAACTCTTGG - Intronic
969169905 4:5353281-5353303 ACAATAAACTATAAAACTACTGG + Intronic
969781479 4:9407785-9407807 ACACAAAACTATAAAAATCCTGG + Intergenic
969927551 4:10599248-10599270 ACAAAAAACTAAAGAACTCCAGG + Intronic
970012664 4:11476999-11477021 ACCCAAAACTATAAAAATCCTGG + Intergenic
970180601 4:13388398-13388420 ACCAAAAACTGTAAAACTCCTGG + Intronic
970248207 4:14086138-14086160 ATGCAAAACTATGAAAACCCTGG - Intergenic
970463518 4:16299825-16299847 ATGCAAAACTATAAAATTCCTGG + Intergenic
970875711 4:20867552-20867574 ATCTCAAACTATAAAAATCCTGG + Intronic
971194538 4:24459454-24459476 ATGAAAAAAAAAAAAACTCAAGG + Intergenic
971665169 4:29474345-29474367 AGGAAAAACAATAAAACTCTAGG + Intergenic
971713119 4:30142895-30142917 AAATAAAAATATAAAACTCCAGG + Intergenic
971744662 4:30564436-30564458 ACATAAAACTATAAAACTACTGG + Intergenic
971776000 4:30965788-30965810 TTGAAATACTATAAAACTTCAGG - Intronic
971978143 4:33717755-33717777 AACCAAAACTAGAAAACTCCTGG - Intergenic
972070132 4:35008976-35008998 AGAAAAAACTCTACAACTCCAGG - Intergenic
972522247 4:39870119-39870141 AAGCAAAACAAAAAAACTCCTGG + Intronic
972764298 4:42137394-42137416 ACCAGAAACTATAAAAGTCCTGG + Intronic
972955657 4:44387745-44387767 ACCCAAAACTATAAAAATCCTGG + Intronic
974085778 4:57259616-57259638 ATAAAAAAATAAAAAACTTCAGG - Intergenic
974119890 4:57625651-57625673 ATCTCAAACTATAAAAATCCTGG - Intergenic
974309887 4:60191647-60191669 ACACAAAACTATAAAAATCCTGG + Intergenic
974475043 4:62367744-62367766 ATGTAAAACTATAAAACTCTTGG + Intergenic
974489128 4:62542165-62542187 AAGGCAAAATATAAAACTCCTGG + Intergenic
974528354 4:63075626-63075648 ACTAAAAACTATAAAAACCCTGG - Intergenic
974574151 4:63695855-63695877 ATAAAAATCTATAACACTTCTGG + Intergenic
974581545 4:63809975-63809997 ACTAAAAACTATAAAAACCCTGG - Intergenic
974584538 4:63855196-63855218 GTGTAAAACTATAAAAATCCTGG - Intergenic
974622752 4:64382875-64382897 ACAAAAAAGTATAAAACTCATGG - Intronic
974631487 4:64494997-64495019 GTGAAAAACTATGATACTCTGGG - Intergenic
974650152 4:64744585-64744607 ATCCAAAACTATAAAATCCCTGG - Intergenic
975239871 4:72044312-72044334 ACCTAAAACTATAAAAATCCTGG - Intronic
975360611 4:73466315-73466337 ATTTAAAACTATAAAATACCTGG + Intergenic
975904350 4:79191794-79191816 ACCCAAAACTATAAAAATCCTGG - Intergenic
976172670 4:82320327-82320349 ATGAAATACAATAAAAATCAAGG + Intergenic
976200565 4:82574051-82574073 AGTTAAAACTATAAAACTCTTGG - Intergenic
977186275 4:93941370-93941392 ATCTCAAACTATAAAAATCCTGG - Intergenic
977519332 4:98060946-98060968 ATCCAAAACTATAAAAACCCTGG + Intronic
977827076 4:101545532-101545554 ATGTAAAACCATAAAACTTTTGG - Intronic
978025056 4:103863332-103863354 ATCAAAAACACAAAAACTCCTGG - Intergenic
978135456 4:105252747-105252769 ATGCAGAACTATAAAATTTCTGG - Intronic
978180258 4:105786079-105786101 ATGTAAAACTATAAAACTCTTGG + Intronic
978277029 4:106964295-106964317 ATTAAAAAATATTGAACTCCTGG + Intronic
978293855 4:107179886-107179908 ACCAAAAACTATAAAATTTCTGG + Intronic
978633561 4:110776951-110776973 ATCTAAAAATATGAAACTCCAGG + Intergenic
978665743 4:111178992-111179014 ATGCAAAGCTATAAAACTCCTGG - Intergenic
978770168 4:112447528-112447550 ATGCAAAACTATAATAAGCCAGG - Intergenic
979066497 4:116142534-116142556 ATGTAAAATTATAAAACTTCAGG - Intergenic
979191021 4:117858782-117858804 ACCCAAAACTATAAAAATCCTGG + Intergenic
979565380 4:122148846-122148868 ACCTAAAACTATAAAAATCCTGG + Intergenic
979692992 4:123580415-123580437 ATTACAAACGATAAAACTCAAGG - Intergenic
979712677 4:123798607-123798629 AACAAAAACTATAAAAACCCTGG - Intergenic
979991718 4:127382114-127382136 ATGCAAACCTATAAAACTGCTGG - Intergenic
979996606 4:127439109-127439131 ATCCAAAACTATAAAAACCCTGG + Intergenic
980242646 4:130197338-130197360 ATGTAAAACCATAAAACTCTTGG + Intergenic
980372010 4:131886991-131887013 TTGAAAAAAAAAAAAACTCCTGG - Intergenic
980377592 4:131969668-131969690 CTGAAAAAAGATAAAACTCTCGG - Intergenic
980537253 4:134143056-134143078 ATAAAATACTACAAACCTCCTGG + Intergenic
980574832 4:134671990-134672012 ATAAAAAACTAGAAAATGCCAGG - Intergenic
981198179 4:141944484-141944506 ATCCAAAACTATAAAAACCCAGG - Intergenic
981252011 4:142614421-142614443 ACTTGAAACTATAAAACTCCTGG + Intronic
981439125 4:144762279-144762301 ATCTAAAACTATAAAAATTCTGG + Intergenic
981910295 4:149971948-149971970 ATGCGAAACTATAAAACTCCTGG + Intergenic
982493284 4:156057233-156057255 AAGAAAAACTTTAAAACTTTTGG - Intergenic
983134616 4:164065319-164065341 ACCCAAAACTATAAAAATCCTGG + Intronic
984070814 4:175109895-175109917 TAGAAAAGCTAAAAAACTCCTGG + Intergenic
984073240 4:175143202-175143224 ATGTGTAACCATAAAACTCCTGG - Intergenic
984208027 4:176810226-176810248 ATCTAATACTATAAAACTCTTGG - Intergenic
984831168 4:183975681-183975703 ATCAAAACCTAAAAAACTACAGG + Intronic
985305056 4:188530409-188530431 ATCTAAAACTATAAAAACCCTGG + Intergenic
985324223 4:188749647-188749669 ACCAAAAACTATAAAAACCCTGG - Intergenic
985900887 5:2790510-2790532 ATTATAAACTACAAAACTCCTGG - Intergenic
986117371 5:4790460-4790482 ATGAAGAGTTATACAACTCCTGG + Intergenic
986398584 5:7356065-7356087 ATGTGAAACTATAAAAATCCTGG - Intergenic
986791480 5:11165368-11165390 AGGAAAAACTATAAAACTGATGG + Intronic
987513192 5:18869490-18869512 ATGCAAAAATATATAACTACAGG - Intergenic
987531057 5:19119890-19119912 ACCCAAAACTATAAAAATCCTGG + Intergenic
987972351 5:24964787-24964809 ATATAGAACTATAAAACTTCTGG - Intergenic
988022232 5:25635791-25635813 ACCAAAAACCATAAAAATCCTGG - Intergenic
988323646 5:29733970-29733992 ACCCAAAACTATAAAAATCCTGG + Intergenic
988372237 5:30386166-30386188 ATGCAAAACTATAAAACTTCTGG + Intergenic
989249666 5:39296057-39296079 ACCTAAAACTATAAAACTACTGG + Intronic
989483386 5:41959496-41959518 ACCAAAAACTATAACACTACTGG - Intergenic
989580900 5:43032794-43032816 ATGAAATACCATAAAAGGCCAGG + Intergenic
989770943 5:45144442-45144464 ATCCAAAACTATAAAAACCCTGG - Intergenic
989996745 5:50843033-50843055 ATGAACAAATATAAAAATGCTGG - Exonic
990068203 5:51745153-51745175 ATGAAAAAAAATTAAAGTCCAGG + Intergenic
990089654 5:52026294-52026316 ACCAAAAACTATAAAAACCCTGG + Intronic
990281861 5:54259566-54259588 ATGAAAATCTGTTAAAATCCTGG - Intronic
990379107 5:55204405-55204427 ATGCAAAACTATAAAACTCCTGG + Intergenic
991148091 5:63331078-63331100 AGGCAAAACAATAAAACTACAGG - Intergenic
991292879 5:65049753-65049775 ATGAAAATATATAACATTCCTGG + Intergenic
991454617 5:66789058-66789080 TTGAAATAATATAAAACTCATGG + Intronic
991466076 5:66913749-66913771 ATCTAAAACTACAAAACTTCTGG - Intronic
991651151 5:68855320-68855342 ATCTAAAACTATAAAAACCCTGG - Intergenic
992021315 5:72627193-72627215 ATTCAAAACTATAAAAACCCTGG + Intergenic
993245553 5:85447500-85447522 ATAAACAAAGATAAAACTCCTGG - Intergenic
993256674 5:85600374-85600396 ATGCAGAACTATAAAACTCTTGG + Intergenic
993303130 5:86239449-86239471 CTTAAAAACTATAAAAATCATGG - Intergenic
993311132 5:86333366-86333388 ATGAAAAATTGCAAAACTCTTGG + Intergenic
993944468 5:94100815-94100837 ACCCAAAACTATAAAACCCCTGG + Intronic
994006129 5:94839416-94839438 CTGGAATACTAAAAAACTCCAGG + Intronic
994406843 5:99355656-99355678 ATTTAAAATAATAAAACTCCAGG + Intergenic
994556578 5:101314801-101314823 ATGAGAAAAAAAAAAACTCCAGG - Intergenic
995373350 5:111445588-111445610 ATGAAAAATTTTAAAAAGCCAGG - Intronic
995656250 5:114429713-114429735 ATGCAAAACTATAAAAATCCTGG - Intronic
995745743 5:115401207-115401229 ATGTAAAACTATAAAAATCCTGG - Intergenic
995755623 5:115500771-115500793 ACCCAAAACTATAAAACTCCTGG - Intergenic
995778687 5:115753175-115753197 ATCTAAAACTATAAAAACCCTGG - Intergenic
996161262 5:120168723-120168745 ATGCAAAATTATAAAACTCCTGG - Intergenic
996279975 5:121718009-121718031 AGGAAAATGTATAAAACTCTTGG + Intergenic
996289113 5:121830170-121830192 ATCTCAAACTATAAAAATCCTGG - Intergenic
996322089 5:122230224-122230246 ATGCAAAACTATAAAACTCCTGG + Intergenic
996579963 5:125020670-125020692 ATGCAAAATTATAAAAATCCTGG + Intergenic
996891871 5:128430222-128430244 ATGAAAAATGAAAAAACTACTGG - Intronic
996972469 5:129388482-129388504 ATGTAAAATTATAAGACTCTGGG + Intergenic
996990959 5:129630626-129630648 CTACAAAACTATAAAACTTCAGG + Intronic
997002422 5:129777514-129777536 ATAAAAAAATAGAAAACTCCAGG + Intergenic
997291575 5:132740128-132740150 AGCTAAAACTATAAAACTCTAGG - Intergenic
997322868 5:132993275-132993297 ATGAAAAATCATAGAACTGCTGG - Intergenic
997345461 5:133188186-133188208 AAGAAAAACCAAAAACCTCCAGG - Intergenic
997708447 5:135981398-135981420 ATAAAAAAATACAAAACTCTAGG - Intergenic
998206843 5:140163460-140163482 AAAAAAAACTATAAAACTTCTGG + Intergenic
998809752 5:145954666-145954688 ATCCCAAACTATAAAAATCCTGG - Intronic
999478399 5:151923060-151923082 ATGAAAAAGTACAACAATCCAGG - Intronic
999563438 5:152830508-152830530 GTTAAAAACTGTAAAACTGCTGG - Intergenic
999564740 5:152845480-152845502 ATGCAAAATCATAAAACTCCTGG - Intergenic
999591867 5:153157021-153157043 GTGAAAAAGAAAAAAACTCCAGG + Intergenic
1000566993 5:162860706-162860728 AAGTAACACTATAAAACTCTTGG + Intergenic
1001504903 5:172270652-172270674 CTGAAAAACTCTAAAATTCTAGG - Intronic
1001782455 5:174381984-174382006 ATGCAAAAATATGCAACTCCAGG + Intergenic
1001873358 5:175177864-175177886 AGCAAAAACTATAAAGCTCTTGG - Intergenic
1002114675 5:176949960-176949982 ATGAGAATCACTAAAACTCCGGG + Intronic
1002490794 5:179575769-179575791 AAAAAAAACAACAAAACTCCAGG - Intronic
1002855302 6:1031669-1031691 AGTCAAAACTATAAAACTCATGG - Intergenic
1002965620 6:1963500-1963522 AAACAAAACTATAAAACTCTTGG - Intronic
1003151237 6:3551008-3551030 AATAAAAACAAAAAAACTCCAGG - Intergenic
1003854370 6:10257891-10257913 GTGTAAAACTATAGAACTCATGG + Intergenic
1004588195 6:17023432-17023454 ACACAAAACTATAAAACTCCTGG - Intergenic
1004799093 6:19125852-19125874 ATGCAAAGCAATAAAACTCCTGG + Intergenic
1005162631 6:22881876-22881898 ATCTAAAACTATAAAATTTCTGG + Intergenic
1005192840 6:23245578-23245600 CTGAACAATTATACAACTCCAGG + Intergenic
1005193125 6:23251151-23251173 ATATAAAACTATAAAACTTTAGG - Intergenic
1005283157 6:24296355-24296377 ACGCAAAACTATAAAAGCCCTGG + Intronic
1006235792 6:32630761-32630783 ATGCAAAACTATAAAAACCCTGG - Intronic
1007216171 6:40240568-40240590 ATGCAAAACTATAAAAAACCTGG + Intergenic
1007288652 6:40767346-40767368 ATCTAAAACTATAAAAACCCTGG - Intergenic
1007354569 6:41303653-41303675 AGCTAAAACTATAAAACTCTAGG + Intergenic
1007380334 6:41486128-41486150 ATGAAAAGCTATTGAATTCCAGG + Intergenic
1008443106 6:51555526-51555548 ATGAAAAAAAAGAAAACTGCAGG + Intergenic
1008726156 6:54422923-54422945 ATCTAAAACCATAAGACTCCTGG + Intergenic
1008745306 6:54662560-54662582 ATCAGAAACTGTAAAACTACTGG - Intergenic
1008914136 6:56768572-56768594 ATTCAAAACTATAAAACTTTAGG + Intronic
1008935948 6:56992490-56992512 AAGAAAAACTAACAAACACCCGG + Exonic
1009382705 6:63052813-63052835 ACCAAAAACTATAAAAACCCTGG + Intergenic
1009387784 6:63107369-63107391 ATGAAAAAAAAGAAAACTACAGG - Intergenic
1010322756 6:74531920-74531942 ATGTAAAACTATAAAAACTCTGG + Intergenic
1010613675 6:77986834-77986856 ACAGAAAAGTATAAAACTCCTGG + Intergenic
1010692652 6:78928960-78928982 ATCAAAAACAAGAAAACTGCAGG - Intronic
1011056353 6:83207698-83207720 ATCCAAAACTATGAAAATCCTGG + Intergenic
1011088059 6:83564784-83564806 AGGTAAAACTATAAAACTCCTGG + Intronic
1011094631 6:83646336-83646358 ATGCAAAACTATAAACATCCTGG - Intronic
1011105606 6:83776847-83776869 ATGCAAAACTATAAAGTTCCTGG + Intergenic
1011913929 6:92478203-92478225 ATGCAAAACTATAAAACCCATGG + Intergenic
1012132065 6:95508504-95508526 ATCTGAAACTATAAAACTACTGG + Intergenic
1012316546 6:97787913-97787935 ATATTAAACTATAAAACTCCTGG - Intergenic
1012577080 6:100815799-100815821 ACCTAAAACTATAAAAATCCTGG + Intronic
1012604215 6:101136973-101136995 ACCTAAAACTATAAAACTTCTGG + Intergenic
1012717031 6:102687866-102687888 ATGTTAAACTATAAAACTATAGG - Intergenic
1012722429 6:102762694-102762716 ATGAGGAACAATAAAACTGCAGG + Intergenic
1013727642 6:113119325-113119347 ATTCAAAACTATAAAATTCTAGG + Intergenic
1013783413 6:113753335-113753357 ACCCAAAACTATAAAACTACTGG + Intergenic
1013848776 6:114487937-114487959 ACCAGAAACTATAAAACTACTGG - Intergenic
1014233937 6:118934791-118934813 TTCAAAAACTATTCAACTCCGGG - Intronic
1014419184 6:121219666-121219688 ATGACTAACGATAAAACTACAGG + Intronic
1014497296 6:122141435-122141457 AGGAAAAAATATCAAAATCCAGG - Intergenic
1014596335 6:123345153-123345175 ACATAAAACTATAAAATTCCTGG - Intronic
1015122626 6:129716472-129716494 ATAAAAAAATATAATACTCCAGG - Intergenic
1015277248 6:131396569-131396591 ATGCAAAACTATAAAACCTCTGG + Intergenic
1015470965 6:133605880-133605902 ACCTAAAACTATAAAAATCCTGG - Intergenic
1015768282 6:136742530-136742552 ATGAAAAACTATAAAACTCCTGG + Intronic
1016074944 6:139784854-139784876 ACCTAAAACTATAAAAATCCTGG - Intergenic
1016222671 6:141694223-141694245 ATGTAAAACTATAATACTTCTGG + Intergenic
1016554256 6:145317672-145317694 ATCCAAAACTATAAAAAGCCTGG - Intergenic
1016930746 6:149405683-149405705 ATTCAAAAATATCAAACTCCTGG + Intronic
1017200637 6:151750552-151750574 ATGAAAAATTATAAATGACCAGG + Intronic
1017470879 6:154735807-154735829 ATGAAAAAAAATGAAACACCAGG - Intronic
1017818884 6:158034793-158034815 ACGCAAAACTATAAAAACCCTGG - Intronic
1018183986 6:161249194-161249216 ATCCAAAACTATAAAAACCCTGG + Intronic
1018295788 6:162341901-162341923 ATTAAAAAAAAAAAAACTCCTGG + Intronic
1018356621 6:163024181-163024203 ATCTTAAACTATAAAAATCCTGG - Intronic
1018702185 6:166435999-166436021 CTGTAAAACTAGAAAACACCAGG + Intronic
1019464343 7:1178777-1178799 ATGCAAAGCTATAAAACTTCCGG - Intergenic
1020509250 7:9032476-9032498 ATGAAAAACAAAAAAACTTAGGG - Intergenic
1020582802 7:10026862-10026884 ACCCAAAACTATAAAAATCCTGG - Intergenic
1020998789 7:15300714-15300736 ATGAGAAAGAGTAAAACTCCTGG + Intronic
1021557679 7:21937956-21937978 AGCTAAAACTATAAAACTCATGG + Intronic
1021910956 7:25385686-25385708 ATGAAGAACTATCAGAGTCCCGG + Intergenic
1022431506 7:30327245-30327267 ATCCAAAACTATAAAAACCCTGG - Intronic
1022833689 7:34093693-34093715 GAGAAACACTATAAAATTCCAGG - Intronic
1023536992 7:41224165-41224187 ATGAAAAACTTTAAAAATGATGG + Intergenic
1024135115 7:46398907-46398929 ATGAAAAACCAAAATATTCCTGG + Intergenic
1024902922 7:54342782-54342804 ATGAAAATATATAGAACTTCAGG + Intergenic
1024949849 7:54849033-54849055 ACCAGAAACTATAAAACTACTGG - Intergenic
1025133626 7:56392209-56392231 ACAAAAAACAAAAAAACTCCTGG + Intergenic
1025148930 7:56530739-56530761 ATGAAGAACTACAACACTCCTGG + Intergenic
1025284224 7:57649484-57649506 ATGAAAAATTAAAGAACACCTGG + Intergenic
1025766361 7:64456655-64456677 ATCTAAAATTATAAAACTCACGG - Intergenic
1027422739 7:78033247-78033269 GTGAACAAATACAAAACTCCGGG - Intronic
1027547381 7:79545119-79545141 ATCAAAAGCTATAATATTCCTGG - Intergenic
1027916287 7:84326849-84326871 ATGCAAGACTATAAAAATCCTGG + Intronic
1028487478 7:91375765-91375787 TTTAAAAACTATTAAGCTCCAGG - Intergenic
1028711165 7:93910385-93910407 ATGAATAATTATTAAATTCCTGG - Intronic
1029052886 7:97708140-97708162 ATGCAAAACTATGAAAACCCTGG + Intergenic
1029907763 7:104108811-104108833 ACCAAAAACTATAAAAACCCTGG - Intergenic
1030037511 7:105420587-105420609 AAAAAAAACTATAAAACTGCGGG + Intergenic
1030200506 7:106898491-106898513 ACCCAAAACTATAAAAATCCTGG - Intronic
1030488364 7:110200137-110200159 ATTAAAAAAAAGAAAACTCCAGG - Intergenic
1030662454 7:112235887-112235909 GAGCAAAACTATAAAACTCTTGG - Intronic
1030754954 7:113276044-113276066 ACCTGAAACTATAAAACTCCTGG + Intergenic
1030886568 7:114945508-114945530 CTGAAAAACCATAATACCCCAGG - Intronic
1031092628 7:117378061-117378083 ATGTAAAACTATAAAACTTCTGG + Intronic
1031163500 7:118198045-118198067 AAGAAAAACTATGAAAATTCTGG + Intergenic
1031189096 7:118523611-118523633 ATGCCAAACTGTAAAAGTCCTGG - Intergenic
1031234982 7:119163658-119163680 ACCCAAAACTATAAAACTACTGG - Intergenic
1031703132 7:124949855-124949877 ACTCAAAACTATAAAAATCCTGG + Intergenic
1031725003 7:125227620-125227642 ATAAGAAACTATGAAACTCCTGG - Intergenic
1031775813 7:125907829-125907851 AACTAAAACTATAAAAATCCTGG + Intergenic
1032177261 7:129641022-129641044 ATGAATAACCATAAGCCTCCTGG + Intronic
1032726754 7:134596805-134596827 AGGCAAAACTATAAAAACCCTGG - Intergenic
1033517187 7:142118871-142118893 AGCTAAAACTATAAAACTCTAGG + Intronic
1033562948 7:142550773-142550795 AAGAAAAACTAAAAAACAACTGG - Intergenic
1033723554 7:144087130-144087152 AGGAAAAACTATGTAACACCTGG - Intergenic
1033769935 7:144538642-144538664 ACCTAAAACTATAAAAATCCTGG + Intronic
1034296542 7:149977843-149977865 ATGTAAAACTGTAAAATGCCAGG + Intergenic
1034752294 7:153581800-153581822 ATTAAAAACTATTAAAATCTTGG + Intergenic
1034809489 7:154118982-154119004 ATGTAAAACTGTAAAATGCCAGG - Intronic
1035481110 7:159185872-159185894 ATCCAAAACTATAAAAACCCTGG - Intergenic
1035548997 8:505789-505811 ATGAAAAACTCTCAAACTGCAGG + Intronic
1035591631 8:819746-819768 AGGAAAAACAATGAAACACCTGG + Intergenic
1035937650 8:3859921-3859943 ATGAAAAGCTATTACACTCATGG - Intronic
1036479780 8:9129116-9129138 ATGTAAAACTATAAAACTTTTGG + Intergenic
1038030271 8:23632575-23632597 ATTAAGAACTATAAATCTACAGG + Intergenic
1038156319 8:24994074-24994096 ATGTAAACATATAAAAATCCTGG - Intergenic
1039008437 8:33067035-33067057 ACCAAAAACTATAAAAACCCTGG + Intergenic
1039084454 8:33766056-33766078 ATCTAAAATTATAAAACTCTTGG + Intergenic
1039309440 8:36299775-36299797 ACCAAAAACTATAAAAACCCTGG + Intergenic
1039331385 8:36541342-36541364 ATGCAAAACTATAAAACTTTCGG + Intergenic
1039624194 8:39031171-39031193 ATTCAAAACTCTAAAACTCCTGG - Intronic
1040615733 8:49036508-49036530 ATCTTAAACTATAAAAATCCTGG + Intergenic
1040961712 8:53041001-53041023 ATCCAAAACTATAAAAACCCTGG - Intergenic
1041078324 8:54189217-54189239 ATAAAAAATTTTAAAACCCCTGG + Intergenic
1041278059 8:56183861-56183883 ACCTAAAACTATAAAACTTCTGG + Intronic
1041577761 8:59419423-59419445 ACCCAAAACTATAAAAATCCTGG + Intergenic
1041605045 8:59772204-59772226 ATGAAAAAATTTAGAACTACTGG - Intergenic
1041859258 8:62493159-62493181 ACCAAAAACTATAAAAACCCTGG - Intronic
1041892325 8:62883442-62883464 AAAAAAACCCATAAAACTCCTGG - Intronic
1042377294 8:68066841-68066863 ATGTAACACTATAAAACTACTGG - Intronic
1042643957 8:70965398-70965420 ATCAAAAAATAGAAAACTTCAGG - Intergenic
1042871305 8:73402269-73402291 ACCCAAAACTATAAAACTCCTGG + Intergenic
1043038706 8:75231692-75231714 AAAAAAAACTATAAACATCCAGG - Intergenic
1043066804 8:75582687-75582709 ATGCAAAATTACAAAACTCCTGG + Intergenic
1043067318 8:75591364-75591386 ATGTAAAACTATAAAAGTCCTGG - Intergenic
1043247271 8:78020610-78020632 ATCCAAAACTATAAAAACCCTGG - Intergenic
1043298732 8:78700618-78700640 ACCAAAAACTATAAAAACCCTGG - Intronic
1043336710 8:79185137-79185159 ACCTAAAACTATAAAAATCCTGG - Intergenic
1043481817 8:80660817-80660839 ATCCTAAACTATAAAACTACTGG + Intronic
1043698189 8:83248856-83248878 ATGCAAAACTATAAACCTACGGG + Intergenic
1044006919 8:86948847-86948869 ATGAAACATTGGAAAACTCCAGG - Intronic
1044181116 8:89196111-89196133 ATCTAAAAGTAAAAAACTCCTGG + Intergenic
1044393271 8:91678620-91678642 ATGGGAAACTATAAAGCTCTTGG + Intergenic
1045213027 8:100118594-100118616 AAGCAAAACTATAAAAACCCTGG + Intronic
1045338178 8:101227441-101227463 ATTAAAAACTAGAAAAAGCCTGG - Intergenic
1045578670 8:103453986-103454008 ATGAAAAAATAGAAAAGGCCAGG + Intergenic
1045915796 8:107468994-107469016 AGGAAAAACCATAAAACTACAGG + Intronic
1046245580 8:111556690-111556712 ACTTAAAACTATAAAAATCCTGG - Intergenic
1046434960 8:114175493-114175515 ATGAAATGATATAAGACTCCTGG + Intergenic
1046486004 8:114889583-114889605 ATGCAAAAGTATAAAATTCCTGG - Intergenic
1047128350 8:121988745-121988767 AAGCAAAACTATAAATGTCCTGG + Intergenic
1047544266 8:125800232-125800254 AAGAAACAGTAAAAAACTCCAGG + Intergenic
1047828440 8:128604837-128604859 ATAAAAAAGTAAAAACCTCCAGG + Intergenic
1048055610 8:130860510-130860532 ATGCAAAACTATAAAATTTCTGG - Intronic
1048290736 8:133179719-133179741 ATGCAAAACTTTAAAGGTCCTGG + Intergenic
1048510537 8:135058010-135058032 AAGCAAAACTATAAAACTCCTGG + Intergenic
1048726728 8:137394130-137394152 ATGCAAAACTATAAAACTTCTGG - Intergenic
1048755959 8:137738382-137738404 ATGAAAAAATTTAAAACAACAGG - Intergenic
1049805984 8:144539516-144539538 ACCTAAAACTATAAAACTTCTGG - Intronic
1050617059 9:7412542-7412564 ATCCAAAACTATAAAAACCCTGG + Intergenic
1050702151 9:8352789-8352811 AAGAAAAACCAAAAAACTCCTGG - Intronic
1050888380 9:10793132-10793154 ATCTAAAACTACAAAACTCCTGG - Intergenic
1050912379 9:11088259-11088281 ATGAAGAAATAAAAAACTTCTGG - Intergenic
1051311750 9:15781926-15781948 ATTAATAACTATATGACTCCAGG - Intronic
1051575683 9:18612749-18612771 ACCTAAAACTATAAAAATCCTGG + Intronic
1051656715 9:19388943-19388965 ACCCAAAACTATAAAAATCCTGG + Intergenic
1051716072 9:19985806-19985828 AGCTAAAACTATAAAACTCTTGG + Intergenic
1051852516 9:21526276-21526298 ATCAAAAACTGTAAAAACCCCGG - Intergenic
1051945559 9:22565868-22565890 ACCAAAAACTATAAAAACCCTGG - Intergenic
1052065302 9:24011061-24011083 ATGGAAAACTCTAAAAATTCAGG - Intergenic
1052094204 9:24364679-24364701 ATCCAAAACTATAAAAACCCTGG - Intergenic
1052133164 9:24875899-24875921 ATGCAAAACTATAAAACTTCTGG - Intergenic
1052624787 9:30961567-30961589 ATAAAAAACAATCAAACTTCAGG - Intergenic
1053542572 9:38989837-38989859 ACCTAAAACTATAAAAATCCTGG - Intergenic
1053763544 9:41365411-41365433 CTGAAAAAAGATAAAACTCTCGG + Intergenic
1053769278 9:41450074-41450096 ATTAAAAAAAAAAAAACTCCTGG + Intergenic
1053807028 9:41813354-41813376 ACCTAAAACTATAAAAATCCTGG - Intergenic
1053929370 9:43100240-43100262 ATCCAAAACTATAAAAACCCTGG + Intergenic
1054466313 9:65497319-65497341 ACGTCAAACTATAAAAATCCTGG + Intergenic
1054542153 9:66276550-66276572 CTGAAAAAAGATAAAACTCTCGG + Intergenic
1054623564 9:67374073-67374095 ACCTAAAACTATAAAAATCCTGG + Intergenic
1054932216 9:70647232-70647254 ATGAAAAAAAAGAAAACTTCAGG + Intronic
1055253506 9:74337371-74337393 GTGAAAAACTAGAAAACCTCAGG - Intergenic
1055952828 9:81746503-81746525 ATCTGAAACTATAAAACTACTGG + Intergenic
1056127470 9:83550062-83550084 ACCCAAAACTATAAAAATCCTGG - Intergenic
1057005944 9:91559471-91559493 CGTTAAAACTATAAAACTCCTGG - Intergenic
1058062898 9:100517021-100517043 ACATAAAACTATAAAACTACAGG - Intronic
1058295945 9:103306775-103306797 ATCTAAAACTATAAAAATTCTGG + Intergenic
1058391767 9:104503450-104503472 ATTACAAATTCTAAAACTCCAGG - Intergenic
1058395006 9:104541802-104541824 ATGAAAAAACATAAGAATCCTGG - Intergenic
1058584330 9:106491115-106491137 AACTAAAACTATAAAACTCCTGG + Intergenic
1059868888 9:118548650-118548672 ATCTAAAACTATAAAAACCCTGG + Intergenic
1060535586 9:124384564-124384586 TTGAAAAAGAATAAAACTGCAGG + Intronic
1060752101 9:126177378-126177400 AGCTAAAACTATAAAACTCTTGG - Intergenic
1060960516 9:127677552-127677574 AAGAAAAAAGAAAAAACTCCAGG - Intronic
1061437177 9:130571535-130571557 ACTAAAAACTATAAAACACTGGG + Intergenic
1186008121 X:5096918-5096940 ATGAAAAACTATAGCACTTAAGG + Intergenic
1186653379 X:11586285-11586307 ACTTAAAACTATAAAAGTCCTGG - Intronic
1186695699 X:12029579-12029601 ATGCAAAACTATAAAACCCCTGG - Intergenic
1186963998 X:14767797-14767819 ATCCAAAACTATAAAATTCCTGG - Intergenic
1187131536 X:16507754-16507776 TTGAAACACTTCAAAACTCCTGG - Intergenic
1187451899 X:19404897-19404919 AGTTAAAACTATAAAACTCTTGG + Intronic
1187714440 X:22088907-22088929 ACCTAAAACTATAAAACTTCTGG - Intronic
1187735831 X:22302873-22302895 ATGAAAAACAATTGAACTCATGG + Intergenic
1187770906 X:22694961-22694983 ATCAAAAAGAATAAAACACCTGG + Intergenic
1187909262 X:24095536-24095558 ACATAAAACTATAAAACTTCAGG - Intergenic
1187957962 X:24539049-24539071 ATGAAATACTCTAAAAGTCCTGG + Intronic
1188014364 X:25091741-25091763 ACCCAAAACTATAAAAATCCTGG - Intergenic
1188154957 X:26730534-26730556 ATGACAAACTATAAAACTAGAGG - Intergenic
1188196914 X:27245964-27245986 ACCAAAAACTATAAAAACCCTGG - Intergenic
1188298059 X:28474106-28474128 ATCCAAAACTATAAAAACCCTGG + Intergenic
1188428765 X:30081211-30081233 ATGAAAAACTATAAAACTCCTGG - Intergenic
1188685901 X:33069787-33069809 AAGAAAAACACTAAAATTCCTGG + Intronic
1188710772 X:33394743-33394765 ATCAAAAACTATAAAAACTCTGG + Intergenic
1188716824 X:33468814-33468836 AACTAAAACTATAAAACTCTTGG - Intergenic
1188819146 X:34752347-34752369 ACCAAAAACTATAAAAACCCTGG - Intergenic
1189003975 X:36976379-36976401 ATGAAATAATTTAAAACTGCTGG + Intergenic
1189017990 X:37304120-37304142 ATGCAAAATTATAAAAATCATGG - Intergenic
1189299221 X:39940646-39940668 ATAAAAAACTATAAAAACCTGGG - Intergenic
1189642609 X:43088985-43089007 TTGAAAATCTAGAAAACTCCAGG + Intergenic
1189699706 X:43705494-43705516 AGCTAAAAATATAAAACTCCTGG + Intronic
1189891419 X:45606640-45606662 ATGTAAAACTATAAAAACCCTGG - Intergenic
1190201194 X:48362706-48362728 ATATAAAACTATAAAAGGCCGGG - Intergenic
1190402426 X:50051133-50051155 ATGCAAAACTATAAAACTTCTGG - Intronic
1190810243 X:53876191-53876213 ATCCAAAACTATAAAAACCCTGG - Intergenic
1190958197 X:55218177-55218199 ACCTAAAACTATAAAAATCCTGG - Intronic
1190965194 X:55293162-55293184 ACCCAAAACTATAAAAATCCTGG - Intergenic
1190994154 X:55588657-55588679 ATTGGAAACTATAAAACTCATGG + Intergenic
1191095307 X:56667233-56667255 ATGAAAAAATAAAAAAATTCAGG + Intergenic
1191153010 X:57241229-57241251 ACCAAAAACTATAAAAATCCTGG + Intergenic
1191617335 X:63183071-63183093 ATGGAAAACTTTACAACTACAGG + Intergenic
1191618963 X:63195852-63195874 ATGGAAAACTTTACAACTACAGG - Intergenic
1191679591 X:63827192-63827214 ACCTAAAACTATAAAAATCCTGG - Intergenic
1191989386 X:67017903-67017925 AGGAAAACCTGTAAAACCCCAGG + Intergenic
1192253828 X:69437723-69437745 ATCCAAAACTATAAAAACCCTGG - Intergenic
1192742655 X:73908302-73908324 ATCTAAAATTATAAAAATCCTGG - Intergenic
1192772815 X:74210588-74210610 ACTTAAAACTATAAAATTCCTGG + Intergenic
1192945477 X:75962302-75962324 ATGTAAAACCATAAAAACCCTGG - Intergenic
1192953301 X:76040374-76040396 ACCTAAAACTATAAAAATCCGGG - Intergenic
1193030679 X:76895116-76895138 ATCCAAAGCTATAAAAATCCTGG + Intergenic
1193117822 X:77792453-77792475 ACATAAAACTATAAAACTCCTGG + Intergenic
1193153028 X:78144264-78144286 ATTCGAAACTATAAAAATCCTGG - Intergenic
1193199983 X:78677641-78677663 ACCAAAAACTATAAAAATCCTGG + Intergenic
1193200142 X:78679677-78679699 AAGGAAAACTATTAAAATCCAGG - Intergenic
1193263301 X:79436696-79436718 ACCTAAAACTATAAAAATCCTGG + Intergenic
1193653310 X:84166448-84166470 ATGAAAAATTTTAAAAATACTGG + Intronic
1193718520 X:84959994-84960016 ACACAAAACTATAAAAATCCTGG + Intergenic
1193781543 X:85708612-85708634 ATCAAAAAATATATAACTACAGG + Intergenic
1193859349 X:86644944-86644966 ACCAAAAACTATAAAAACCCTGG + Intronic
1193935876 X:87620616-87620638 ATATAAAACTATAAAACTTAAGG - Intronic
1193940668 X:87677745-87677767 ATCCAAAACTATAAAAACCCTGG + Intergenic
1194322751 X:92472215-92472237 ACCCAAAACTATAAAATTCCTGG - Intronic
1194891061 X:99379536-99379558 ACACAAAACTATAAAACTCCTGG - Intergenic
1194909854 X:99628612-99628634 ACCAAAAACTATAAAATCCCTGG + Intergenic
1195583476 X:106534386-106534408 TCACAAAACTATAAAACTCCTGG - Intergenic
1196339428 X:114580926-114580948 AAGAAAAAAAAAAAAACTCCCGG + Intergenic
1196352539 X:114748762-114748784 ATGCAAAACTACTAAACTTCTGG + Intronic
1196549880 X:117011335-117011357 ATGGTAAACTAGAAAGCTCCAGG + Intergenic
1196801782 X:119550591-119550613 AAGTAAAATTATAAAACTCTTGG + Intronic
1196993200 X:121350782-121350804 ACCCAAAACTATAAAAGTCCTGG + Intergenic
1197136681 X:123068759-123068781 ATAAAAAACTATAAAAACCCTGG + Intergenic
1197242825 X:124137869-124137891 ACCTAAAACTATAAAAATCCTGG - Intronic
1197408299 X:126083179-126083201 ACCAAAAACTATAAAAACCCTGG - Intergenic
1198579102 X:138043979-138044001 ACCCAAAACTATAAAATTCCTGG + Intergenic
1198581390 X:138068690-138068712 ATGAAAAATTTTAAAAGTCGTGG - Intergenic
1199021511 X:142883746-142883768 ACTCAAAACTATAAAAATCCTGG + Intergenic
1199113464 X:143960984-143961006 ACCCAAAACTATAAAAATCCTGG - Intergenic
1199150642 X:144481455-144481477 ATCCAAAACTATAAAAACCCTGG - Intergenic
1199544139 X:148989563-148989585 ATGACAAAGTATGAAACTCCAGG - Intronic
1199701823 X:150384723-150384745 AACTAAAACTATAAAACTCTTGG - Intronic
1199702585 X:150394038-150394060 AGAAAAAATTATAAAACTCCTGG - Intronic
1199775492 X:151007611-151007633 AAGAAAAACTAGAAAACTTGAGG + Intergenic
1200086031 X:153606132-153606154 AGCTAAAACTATAAAACTCTTGG + Intergenic
1200498689 Y:3918068-3918090 ATCCAAAACTATAAAAACCCTGG - Intergenic
1200630906 Y:5585692-5585714 ACCCAAAACTATAAAATTCCTGG - Intronic
1201888201 Y:18910538-18910560 ATCCAAAACTATAAAAGCCCTGG + Intergenic