ID: 1015771879

View in Genome Browser
Species Human (GRCh38)
Location 6:136776664-136776686
Sequence CACCGACAAATTCTTTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015771875_1015771879 18 Left 1015771875 6:136776623-136776645 CCGTAATACTCCTGGAAGGTTAC 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1015771879 6:136776664-136776686 CACCGACAAATTCTTTAGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 63
1015771876_1015771879 8 Left 1015771876 6:136776633-136776655 CCTGGAAGGTTACTTAAGCTCAA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1015771879 6:136776664-136776686 CACCGACAAATTCTTTAGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015771879 Original CRISPR CACCGACAAATTCTTTAGCT TGG Intronic
904554061 1:31346302-31346324 CAGCTCCAAATTCTTTACCTTGG - Intronic
906911519 1:49956937-49956959 TATAGACAAATTCTTTAGCCAGG - Intronic
907587398 1:55633377-55633399 CTTCCACAAACTCTTTAGCTTGG + Intergenic
911902541 1:103524548-103524570 AACTGACAAATTCTTTAAGTAGG - Intergenic
912019156 1:105083372-105083394 TACTGACAATTTCTTTATCTTGG + Intergenic
912961719 1:114201949-114201971 CACCCATCAATTCTTTAGTTAGG - Intergenic
914863832 1:151408676-151408698 CACTGGCAAACTCTTTACCTTGG + Exonic
916278493 1:163022906-163022928 CTCCGACAAATTTTTTATTTTGG + Intergenic
1070713472 10:78700477-78700499 CACCTACACTTCCTTTAGCTAGG - Intergenic
1075812921 10:125239774-125239796 AACCTACAAAATCTTTAACTTGG - Intergenic
1083911113 11:65710659-65710681 CTCCAACAAATTCTGTAACTGGG + Intergenic
1084003512 11:66311651-66311673 CCCCGACAAATCCTTTCGCCTGG - Intergenic
1088682202 11:112253117-112253139 CACAGATCAATTCTTTACCTAGG - Intronic
1096834871 12:54343427-54343449 CTCTGACAACTTCATTAGCTTGG - Intronic
1104535986 12:129618759-129618781 CACAGACACATCCTTTATCTTGG - Intronic
1109713302 13:66186696-66186718 AACTGAAAAAATCTTTAGCTTGG - Intergenic
1110641001 13:77823766-77823788 CACCAACAAATTCTCTATTTAGG - Intergenic
1112370511 13:98788974-98788996 CCCCCACAAATTCTGTAACTGGG + Intergenic
1116947851 14:50852900-50852922 CACCAACAAATTCTCAATCTTGG + Intergenic
1126543715 15:49849263-49849285 CACCAAAGTATTCTTTAGCTGGG - Intergenic
1133744675 16:8676986-8677008 CAACAACCAATCCTTTAGCTGGG - Intronic
1137995799 16:53210806-53210828 AACCGCCAAATTATTTAGTTTGG + Intronic
1139142306 16:64281288-64281310 CACCTAAAAATTCTTTAAGTGGG - Intergenic
1144997471 17:19280132-19280154 CACTGACAAAGACTTTGGCTGGG - Intronic
1149744631 17:59084142-59084164 CCTCCACAAATTCTTAAGCTTGG + Intronic
1157193411 18:45600086-45600108 CACCCATAAATCCTGTAGCTGGG - Intronic
1163979295 19:20883641-20883663 CACCCACAAAGTCATTAGATTGG + Intergenic
1166673132 19:44723428-44723450 CCCTGGCAAACTCTTTAGCTTGG + Intergenic
927121715 2:19970593-19970615 CACCATCACATTCTTTAGCATGG + Intronic
942549716 2:177102382-177102404 AACTTCCAAATTCTTTAGCTTGG - Intergenic
942787026 2:179711567-179711589 CACTCCCAGATTCTTTAGCTTGG - Intronic
945541119 2:211087991-211088013 CACCTTCCAATTCCTTAGCTTGG + Intergenic
1173696916 20:45025078-45025100 CACTGAAAAATTCTTCAGATTGG + Exonic
1179265025 21:39795707-39795729 CACCGATTGATTATTTAGCTGGG - Intronic
961963160 3:130873308-130873330 CACTGAGAAATTCTTGAGCAGGG + Intronic
966202345 3:177370032-177370054 CTCCCCCAAATTCTTTAGCTTGG + Intergenic
968315959 3:197725823-197725845 CACCAACAAACTCCTTAGCATGG + Intronic
972654449 4:41051185-41051207 CACCCACAGATTCTTAAGCTGGG + Intronic
974609967 4:64204755-64204777 CACAGGCACATTCTTTACCTTGG + Intergenic
976634606 4:87275363-87275385 CACAGAGAAATTCTATAACTAGG - Intergenic
982946882 4:161635944-161635966 CATCAACAAATTCCTTAACTGGG + Intronic
984201912 4:176733352-176733374 CACCCAAATGTTCTTTAGCTGGG + Intronic
984399088 4:179238636-179238658 CACCGACACATCCTTAACCTTGG - Intergenic
993754630 5:91713197-91713219 CACTTCCAAATTCTTTAGTTGGG - Intergenic
1001730667 5:173953764-173953786 CACCGATTTATTCCTTAGCTTGG + Intronic
1005344271 6:24874020-24874042 CAACAACAAACTATTTAGCTGGG - Intronic
1009822566 6:68822922-68822944 AAATGACACATTCTTTAGCTTGG - Intronic
1015771879 6:136776664-136776686 CACCGACAAATTCTTTAGCTTGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1023230164 7:38019496-38019518 CACCAGAAAATTCTTTAACTGGG + Intronic
1023355341 7:39361831-39361853 CACCTACAAATGTTTGAGCTCGG + Intronic
1027817800 7:83000070-83000092 CACCAACAAAATCATTAACTAGG + Intronic
1028570793 7:92284760-92284782 CACGTACAAATTATTAAGCTGGG - Intronic
1031161766 7:118177532-118177554 CACCAAGTAATTCTTTAGGTAGG - Intergenic
1031791436 7:126109979-126110001 CAGCCACAAATTATTTAACTGGG + Intergenic
1031839964 7:126726037-126726059 CACAGAGAAATACTGTAGCTTGG - Intronic
1035488289 7:159248547-159248569 CACAGGCTAATTCTTTATCTTGG - Intergenic
1037514281 8:19614926-19614948 CACTGCAAAACTCTTTAGCTGGG - Intronic
1038641186 8:29330190-29330212 CACAGACACATTCTTAACCTTGG - Intergenic
1052164851 9:25312826-25312848 AACCAACAAATTCATGAGCTTGG - Intergenic
1055916153 9:81402388-81402410 GGCCGACAAGTTCTTTAGGTAGG - Intergenic
1061656338 9:132093546-132093568 AACCAACAAATTCCTGAGCTGGG - Intergenic
1188783780 X:34318844-34318866 CACGCACAAGTTCTTTAGCAGGG - Intergenic
1189514961 X:41704288-41704310 CATCTGCAAGTTCTTTAGCTTGG - Intronic
1194479799 X:94406940-94406962 CACCTTCAAATTCTTTAGGGTGG - Intergenic
1197631071 X:128858717-128858739 CTCCAACAAATTCTTGAACTAGG - Intergenic