ID: 1015773041

View in Genome Browser
Species Human (GRCh38)
Location 6:136788347-136788369
Sequence TTCCCAAGGCTGATGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015773041 Original CRISPR TTCCCAAGGCTGATGCAGAA TGG (reversed) Intronic
902767189 1:18625215-18625237 TTCTCAGGGCTGAGGCAGGATGG - Intergenic
903044912 1:20557354-20557376 CAGCCAAGGATGATGCAGAAGGG + Intergenic
903731128 1:25496253-25496275 TTCAGAAGGCTGACGCAGGAGGG - Intronic
903916041 1:26765088-26765110 CTCACGAGGCTGAGGCAGAATGG + Intronic
903929019 1:26851581-26851603 TTGCCAAGCCTGAGGCAGAAAGG + Intronic
905067399 1:35195010-35195032 GACCCAAGGCTGAGGCAGTAGGG + Intergenic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
908686053 1:66721446-66721468 TTGCCCAGGCTGAAGCACAATGG + Intronic
909375355 1:74935086-74935108 ATCCCATGGCAGAAGCAGAAGGG - Intergenic
910132825 1:83929382-83929404 TGACCTAGGGTGATGCAGAATGG - Intronic
910292984 1:85616660-85616682 TTTCCCTGGCTGATGCAGGAAGG + Intergenic
910755164 1:90682036-90682058 TTCACAAGCCTGCAGCAGAATGG + Intergenic
911521068 1:98931557-98931579 TCCCCAAGGCTGAGGGAGAAAGG - Intronic
911630254 1:100175294-100175316 TTCTGAAGGCTGAGGCAGAGGGG - Intronic
911733814 1:101315849-101315871 TTCCCAAGGGTGAGGCTGAACGG - Intergenic
912566916 1:110594056-110594078 TTCGTAAGGATGATGCCGAAAGG - Intronic
913652328 1:120929339-120929361 TTCCCATGGTTAATGCAGCAGGG + Intergenic
914168782 1:145199732-145199754 TTCCCATGGTTAATGCAGCAGGG - Intergenic
914523903 1:148443691-148443713 TTCCCATGGTTAATGCAGCAGGG - Intergenic
914599772 1:149192178-149192200 TTCCCATGGTTAATGCAGCAGGG + Intergenic
914642502 1:149623449-149623471 TTCCCATGGTTAATGCAGCAGGG + Intergenic
914849339 1:151302519-151302541 CTACCAAGGCTGATTCAGAATGG + Intronic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
916770445 1:167902603-167902625 GTGCCAAGTCAGATGCAGAAAGG + Intronic
917887552 1:179401216-179401238 TTGCCCAGGCTGAAGCACAATGG - Intronic
918478508 1:184951913-184951935 TTACCAAGGATGATGAAGCAGGG - Intronic
919119546 1:193321929-193321951 TTGCCCAGGCTGATGCACAGTGG - Intergenic
920270235 1:204757254-204757276 TTGCCCAGGCAGATGCAGGATGG + Intergenic
920540438 1:206774023-206774045 GTCCCATTGCTGATGCAGAAAGG - Intergenic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
1064087956 10:12359585-12359607 TTGCCCAGGCTGATGGAGAGAGG - Intronic
1066036554 10:31493661-31493683 AGTCCACGGCTGATGCAGAAAGG + Intronic
1068220951 10:54044711-54044733 TTCCCAAAGCAAATACAGAAAGG + Intronic
1071186346 10:83050509-83050531 CTCAGAAGGCTGAGGCAGAAGGG - Intergenic
1071241103 10:83706104-83706126 TCCCCAAAGCTGAAGCAGAAGGG + Intergenic
1071878321 10:89866539-89866561 TTCCCAATGAAGATGAAGAAGGG - Intergenic
1072008675 10:91284844-91284866 TCTTCAAGGCTGCTGCAGAATGG + Intergenic
1073201502 10:101739369-101739391 TTCCCAAAGCAGAGGGAGAATGG + Intergenic
1073421615 10:103428263-103428285 TTGCCCAGGCTGAAGCACAATGG - Intronic
1074059859 10:109955108-109955130 TTGCCCAGGCTGGTGCAGAGGGG + Intergenic
1075627184 10:123972149-123972171 TTGTCAACGGTGATGCAGAAGGG + Intergenic
1077179115 11:1204326-1204348 TCCCCCAGGCTGATGGAGAAGGG + Intergenic
1084572574 11:69968379-69968401 TTCCAAAGGCAGAGGCAGACAGG + Intergenic
1085167346 11:74414740-74414762 TGCACAATGGTGATGCAGAATGG - Intergenic
1088233946 11:107702533-107702555 TGCCCTAGAGTGATGCAGAAGGG + Intergenic
1088235728 11:107720852-107720874 TTCCGAAGGCTGAGGCAGGAGGG + Intergenic
1088812919 11:113403572-113403594 CTCCCAGTGCTGATCCAGAATGG - Intergenic
1090076653 11:123584131-123584153 TTCTCAAGGCAGTTCCAGAAAGG - Intronic
1090535285 11:127634470-127634492 TTCCCAAGACTGAGGTAAAAAGG - Intergenic
1091498900 12:996191-996213 CTCCGGAGGCTGAGGCAGAATGG - Intronic
1092298312 12:7220372-7220394 TCCCCAAGGGTGATCCTGAAAGG + Intergenic
1092393176 12:8099770-8099792 TTCGGAAGGCTGAGGCAGAATGG + Intergenic
1093214727 12:16349232-16349254 TTCACAATATTGATGCAGAAAGG + Intronic
1094270999 12:28614458-28614480 ATCACAAGGATGATGAAGAATGG + Intergenic
1094317003 12:29145994-29146016 TTCTGAAGGCAGATGCAGCACGG - Intergenic
1094539225 12:31349178-31349200 TTGCCCAGGCTGAAGCACAATGG + Intergenic
1096198448 12:49664138-49664160 TTCGGAAGGCAGAGGCAGAATGG + Intronic
1096426756 12:51510317-51510339 TTCAGGAGGCTGAGGCAGAATGG + Exonic
1096835964 12:54351575-54351597 TTCCCCAGGAAGATGGAGAATGG + Intronic
1096910899 12:54982928-54982950 CACCCAGGCCTGATGCAGAATGG - Intronic
1099131575 12:78840032-78840054 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
1099462426 12:82940123-82940145 CTCCGGAGGCTGAGGCAGAATGG - Intronic
1100259992 12:92924001-92924023 TTCCTGAGGCTGAGGCAGGAGGG + Intronic
1100643796 12:96508236-96508258 TTTGGAAGGCTGATGCAGAATGG - Intronic
1101213315 12:102556463-102556485 TTCCAAATGCTGACGCAGGAAGG - Intergenic
1102288356 12:111678142-111678164 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1103199170 12:119072469-119072491 TTCCCCAGGCTGTTGGGGAAGGG + Intronic
1104409693 12:128547784-128547806 TTCCCCAGGCAGGTCCAGAAAGG + Intronic
1104576190 12:129967977-129967999 GTGCCATTGCTGATGCAGAATGG - Intergenic
1105399046 13:20071703-20071725 TTCCTAAAGCTGAACCAGAAAGG - Intronic
1105525200 13:21171033-21171055 TTCAGGAGGCTGAGGCAGAAGGG - Intronic
1105681600 13:22733850-22733872 CTCGGAAGGCTGAGGCAGAATGG + Intergenic
1106410987 13:29511402-29511424 TTCCCCAGGCTGTCTCAGAAAGG - Exonic
1110503221 13:76253465-76253487 TACCAAAGGCCGATGGAGAAAGG - Intergenic
1110609182 13:77470191-77470213 TTCCCAAATCTGTTGCAAAATGG + Intergenic
1111580081 13:90211356-90211378 CTACCCAGACTGATGCAGAAGGG - Intergenic
1112217085 13:97443493-97443515 TTCAGATGGCTGAGGCAGAAGGG - Intronic
1112807375 13:103177945-103177967 TTTAGAAGGCTGATGCAGAAAGG + Intergenic
1113233016 13:108236795-108236817 CTCGGAAGGCTGAGGCAGAATGG - Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1115562518 14:34596110-34596132 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1115615827 14:35093757-35093779 CTCCAGAGGCTGAGGCAGAATGG - Intronic
1115860946 14:37685767-37685789 TCCCCAAAGCTGCTGCTGAAAGG - Intronic
1116992659 14:51292319-51292341 ATCCCAAGGCTGCTGTAGGAAGG - Intergenic
1118216847 14:63816987-63817009 TTCAGAAGGCTGAGGCAGGAGGG - Intergenic
1118940605 14:70332748-70332770 TTCCCACAGCAGATCCAGAAGGG + Intronic
1119481220 14:74959507-74959529 TTCCCCATGCTGGAGCAGAATGG + Intergenic
1120764569 14:88316699-88316721 CTCCCTTGGCTGATGCAGAAAGG - Intronic
1121322929 14:93003103-93003125 CTCCCAAGGCAGCTGCTGAATGG + Intronic
1121446551 14:93982543-93982565 TTCCCAAGGGTGATTCAGACAGG - Intergenic
1122182532 14:99966753-99966775 TCCCCAAAGCTGATGGTGAACGG + Intergenic
1123671301 15:22661285-22661307 TTCCCAAGGTCAGTGCAGAAAGG + Intergenic
1124323340 15:28734514-28734536 TTCCCAAGGTCAGTGCAGAAAGG + Intronic
1124430991 15:29608450-29608472 TTCCCAAGACTGATCAGGAAGGG - Intergenic
1124527226 15:30467673-30467695 TTCCCAAGGTCAGTGCAGAAAGG + Intergenic
1124771427 15:32540010-32540032 TTCCCAAGGTCAGTGCAGAAAGG - Intergenic
1125905765 15:43391135-43391157 TTTGGAAGGCTGAGGCAGAAGGG - Intronic
1126431517 15:48590050-48590072 TTCCAAAGGCACATGGAGAATGG + Intronic
1126665227 15:51069858-51069880 TTTCGAAGGCAGATGCAGGAAGG - Intronic
1126768992 15:52036457-52036479 TACCATGGGCTGATGCAGAAAGG - Intronic
1127981342 15:64037509-64037531 CTCCCCAGGCTGGTGGAGAAAGG - Intronic
1128224192 15:65990306-65990328 TTTGAAAGGCTGAGGCAGAAGGG + Intronic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1129269565 15:74412192-74412214 CTTCCAAGGCTGATCCAGAGAGG + Intronic
1129769061 15:78192181-78192203 TTGCCAAGGCTGCTGGAAAAGGG - Intronic
1131627239 15:94134411-94134433 TTCCCCAGGCTGATGAAGACTGG + Intergenic
1132203057 15:99968356-99968378 GTCCCGAGCCTGATGCTGAAAGG + Intergenic
1135482016 16:22828508-22828530 TTCCCAAAGCTGCTGAAGCATGG + Intronic
1136242814 16:28954870-28954892 CTCCCAAGGGTGATCCTGAAGGG - Intronic
1137738258 16:50741317-50741339 TTCCCAAGGATGGTGAAGAAGGG - Intergenic
1141196882 16:81866890-81866912 CTCCCAGGGCTGAGGCAGAAAGG + Intronic
1141386288 16:83624930-83624952 CTCCCAAAGCTGGTGCAGACTGG - Intronic
1142558206 17:793892-793914 TCCCAAAGGCTGGTGCAGAGAGG + Intergenic
1144235907 17:13260322-13260344 TTTCGGAGGCTGAGGCAGAAAGG - Intergenic
1144825177 17:18101776-18101798 TTCCCAACCCTGAGGCAGCAAGG + Intronic
1146188826 17:30747263-30747285 CTCAGAAGGCTGAGGCAGAATGG - Intergenic
1146333714 17:31951585-31951607 CTCAGAAGGCTGAGGCAGAATGG - Intronic
1147395346 17:40138600-40138622 TTCGGGAGGCTGAGGCAGAATGG - Intergenic
1147818823 17:43229604-43229626 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147832106 17:43304306-43304328 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1151777433 17:76215365-76215387 CTCAGAAGGCTGACGCAGAAGGG + Intronic
1152732251 17:81977970-81977992 TTCCCAGGGGTGAGGTAGAACGG + Intronic
1155547872 18:26933460-26933482 TTCTCACGGTTGCTGCAGAAAGG - Intronic
1158395268 18:57074649-57074671 TTACCAGGGCCTATGCAGAAAGG + Intergenic
1159178913 18:64875503-64875525 TTCAGAAGGCAAATGCAGAAGGG + Intergenic
1160308334 18:77762809-77762831 TTCCCAATGCTTGTGTAGAATGG + Intergenic
1160907363 19:1457770-1457792 TTCCCAAGGCTGAGTGAGAGAGG + Intronic
1161568458 19:5016669-5016691 TCCCCAGGGCCGATGCAGACAGG - Intronic
1162876598 19:13625259-13625281 TTCCCAAGGCTGAGCCAAAATGG + Intergenic
1163266297 19:16224533-16224555 TTCCCAGGGCGGGTGCTGAAGGG - Intronic
1164188239 19:22891649-22891671 CTCAGAAGGCTGAGGCAGAATGG + Intergenic
1164860564 19:31559063-31559085 TTTCCCAGGCTGCTGCAGAGTGG + Intergenic
1165621846 19:37254686-37254708 TTCCCAGGGCAGATGCTGAGTGG + Intergenic
1165875794 19:39005833-39005855 ATCCAAAGGTTGATGAAGAATGG + Intronic
1166420714 19:42633915-42633937 TCCCCAAGGCTGATGCAGCAGGG + Intronic
1166496293 19:43305419-43305441 TCCCCACGGCTGGTGCAAAAGGG + Intergenic
1166533838 19:43559373-43559395 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1166795733 19:45424361-45424383 TTCCCAGTGCTGACCCAGAATGG + Intronic
1167315250 19:48759014-48759036 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
925196262 2:1928612-1928634 TTCCGAATGGTGAGGCAGAAGGG - Intronic
925481137 2:4275919-4275941 TGACCAAGGCTGAGGCAGAGAGG + Intergenic
925551323 2:5078666-5078688 TTCCCAAGGAGGATGAAAAATGG - Intergenic
926504799 2:13700156-13700178 TTCCCAAGGTGGAAGGAGAAAGG - Intergenic
926522396 2:13931384-13931406 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
926893614 2:17660238-17660260 TTCCCAAGGCTGGGCCAGAAAGG - Intergenic
932340014 2:70957674-70957696 TTCCCACGGCTGCTGCAGGGAGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
932616900 2:73237818-73237840 TTCAGAAGGCTGAGGCAGGAGGG + Intronic
933331111 2:80894387-80894409 TTCCCAAGGCAGATCCTAAATGG - Intergenic
933672434 2:85021854-85021876 TTCCCCAGGCTGAAGTACAATGG + Intronic
933979687 2:87539635-87539657 TTCCCAAGGCTTGTGAAGCAGGG - Intergenic
936022358 2:109004532-109004554 TTCCCAAAGATGATGCCCAATGG - Intergenic
936755033 2:115697875-115697897 CTCTGAAGGCTGAGGCAGAATGG + Intronic
937550688 2:123086591-123086613 TGCCCAAATCTGATGCTGAAAGG + Intergenic
940138483 2:150465686-150465708 TTCAGAAGGCTGAGGCAGGAGGG + Intergenic
941008024 2:160267316-160267338 TTCCCAAGCCTGTTTCAGATAGG - Intronic
941248642 2:163133721-163133743 TTCCCAAAGCCAATGCAGAATGG + Intergenic
941721661 2:168819256-168819278 TTCCCAAGGCAGAGGCAGCAAGG - Intronic
943768695 2:191691814-191691836 TTTCCAATGCTGATGGAGAAAGG - Intronic
944061106 2:195569513-195569535 TTCCCAATGGTGGTGCTGAATGG - Intergenic
945047683 2:205796359-205796381 CTCTCAAGGCTGAAGCAGCATGG - Exonic
946858121 2:223973412-223973434 TTCGGGAGGCTGAGGCAGAAGGG + Intergenic
947182493 2:227423886-227423908 TTTCCCAGGCAGATGCAGGAGGG + Intergenic
947522110 2:230854916-230854938 TTGCCCAGGCTGAAGCACAATGG + Intergenic
948114905 2:235487689-235487711 CTCAGAAGGCTGAGGCAGAAGGG + Intergenic
948450906 2:238070869-238070891 TTGCCCAGGCTGATGCATAGTGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169344404 20:4819000-4819022 TTGCCAAGGCTGGAGCACAATGG + Intronic
1169566325 20:6857218-6857240 TTTGCAAGGCTGAGGCAGGAAGG - Intergenic
1170033295 20:11965002-11965024 CTCCTAAGGCAGATGAAGAAAGG - Intergenic
1170110260 20:12797290-12797312 TTCCCAAGGCTGGTGAAAGAAGG - Intergenic
1170142431 20:13138259-13138281 TGGCCAAAGCTGATGCTGAATGG - Intronic
1170575055 20:17656107-17656129 TTCCCATGGTTGATGTACAAAGG - Intronic
1170810142 20:19667868-19667890 TGCCCGAGGCTGCAGCAGAAGGG + Intronic
1170824366 20:19781102-19781124 TTTACAAGGCTATTGCAGAAAGG + Intergenic
1172254178 20:33502509-33502531 CTCGGAAGGCTGAGGCAGAATGG - Intronic
1172406803 20:34695811-34695833 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
1172488438 20:35314655-35314677 TTGCCAAGGCTTAGGCAGGACGG - Intronic
1172680574 20:36711172-36711194 CTCACGAGGCTGAGGCAGAATGG + Intronic
1173279017 20:41610651-41610673 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1173353411 20:42265209-42265231 TTCCCAATGCTGGCTCAGAATGG + Intronic
1174601404 20:51727889-51727911 TTGCCCAGGCTGGTGCACAATGG - Intronic
1174663942 20:52239630-52239652 CTCAGAAGGCTGAGGCAGAAAGG - Intergenic
1175840116 20:62021327-62021349 CTCTCAAGGATGAAGCAGAAGGG + Intronic
1176952883 21:15065828-15065850 TTCCCGGGGATGATGCAGATTGG - Intergenic
1177456840 21:21351007-21351029 CTCCGGAGGCTGAAGCAGAATGG + Intronic
1177652775 21:23979612-23979634 CTCCGGAGGCTGAGGCAGAAAGG - Intergenic
1177792156 21:25733420-25733442 CTCCGGAGGCTGAGGCAGAAGGG + Intronic
1177809435 21:25909622-25909644 CTCCTAAGGCTGATGCAACAAGG + Intronic
1178231583 21:30791081-30791103 TAGCCTGGGCTGATGCAGAAGGG + Intergenic
1178305320 21:31486240-31486262 TTCCCCAGGATGATCCAGAGTGG - Intronic
1179521605 21:41949115-41949137 CTCCCAAGGCTGATGCTGTCTGG - Intronic
1180029510 21:45195897-45195919 TTCCTAAGGCTGATATAAAAAGG - Intronic
1180745716 22:18087648-18087670 TTTCCAAGGCTGCTTCAGAAGGG + Intronic
1182347822 22:29679178-29679200 ATCCCACAGCTGATGCAGAGGGG + Intronic
1183258295 22:36777206-36777228 TTCTGATGGCTGATGCTGAAGGG + Intergenic
1183388904 22:37532371-37532393 TTCCAGAGGCTGAGGCAGGAGGG - Intergenic
1184957881 22:47904045-47904067 TTGCCCAGGCTGAAGCACAATGG - Intergenic
949283902 3:2378794-2378816 TTCCTATGGCTGATTCACAAGGG - Intronic
949986750 3:9547229-9547251 TTTCGAAGGCTGAGGCAGAAGGG - Intronic
950544790 3:13631913-13631935 TTCCCAACCCTGGTGCAGAAGGG + Intronic
953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG + Exonic
954449145 3:50562380-50562402 TCCCCAGGGCTGAAGAAGAAAGG + Intronic
954571338 3:51643524-51643546 CTCACAAGGCTGAGGCAGAGAGG + Intronic
955993814 3:64657374-64657396 TCTCCAAGGCTGATGCACAGTGG + Intronic
956249986 3:67225818-67225840 CTCCCAAGGCAGATGCTGAGAGG + Intergenic
956953552 3:74310877-74310899 TGCCCAAGGCGGAGGCAGTATGG - Intronic
958958552 3:100487805-100487827 TTCCAGAGGCTGAGGCAGAAGGG - Intergenic
959771111 3:110097636-110097658 TTGCCAAGGCTGATGTTGAAAGG + Intergenic
961671312 3:128533521-128533543 CTCTCAAGGCTGATTCTGAAAGG - Intergenic
962526193 3:136239778-136239800 CTCAGAAGGCTGAGGCAGAATGG - Intergenic
965775001 3:172219629-172219651 TGCCAAAGGCTGAGGCAGGAGGG - Intronic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
970442957 4:16099895-16099917 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
971028343 4:22610187-22610209 TTCTCAGGGTTGCTGCAGAAAGG - Intergenic
971461968 4:26909037-26909059 TTGCCAAGGCTGAAGCACAGTGG - Intronic
973173157 4:47170076-47170098 TTCCAAAATCTGAAGCAGAATGG - Intronic
974522455 4:63000754-63000776 TACCCAAGACTGAGGGAGAAGGG + Intergenic
975153787 4:71048497-71048519 CTCCCAAGACTGAACCAGAAAGG + Intergenic
975511744 4:75201318-75201340 TTCCCAGGGGTGATGCCGAATGG + Intergenic
976609269 4:87013146-87013168 CTCCGGAGGCTGAGGCAGAATGG - Intronic
977594684 4:98865745-98865767 TTCAGGAGGCTGAGGCAGAAAGG + Intergenic
979095511 4:116544914-116544936 TTCCAAAGAGTGATTCAGAAGGG - Intergenic
979338538 4:119492086-119492108 CTCCGGAGGCTGAGGCAGAAGGG - Intergenic
980298940 4:130963125-130963147 TTCCCAAAGCTATTGAAGAATGG - Intergenic
981231287 4:142358795-142358817 TTCCCAAGCCAGCTGCTGAAGGG - Intronic
981414547 4:144476412-144476434 TTACAAAGGGTGATGAAGAATGG - Intergenic
982218179 4:153100600-153100622 TTCCCAAGACTGAACCAGGAAGG + Intergenic
983254504 4:165382410-165382432 TTCCTAAAGCTGAATCAGAAAGG - Intronic
984271512 4:177553444-177553466 TTCCCAAGGGGGTTGCAGAACGG + Intergenic
984761470 4:183366455-183366477 TGCCAAAGGCTGAATCAGAATGG + Intergenic
985825372 5:2187157-2187179 TTCCCAGGGTTTATGCTGAAAGG - Intergenic
985964007 5:3325745-3325767 TTCCGAGGGCTGGGGCAGAAAGG + Intergenic
989796912 5:45485544-45485566 TTCCCAACACTTACGCAGAAGGG + Intronic
989984595 5:50683114-50683136 TTCCCATGGTTAATGCAGCAGGG + Intronic
990339753 5:54810452-54810474 TTCACAATGCTGATGGAGATGGG + Intergenic
992475590 5:77098767-77098789 ATCCCATGGCAGAGGCAGAAGGG + Intergenic
992895320 5:81240275-81240297 TTCCATAGGCTGATGCCGAGGGG - Intronic
994281849 5:97914026-97914048 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
994991551 5:107003356-107003378 TTCCCAAGTATCAGGCAGAAAGG + Intergenic
996665891 5:126059667-126059689 TTCAGGAGGCTGAGGCAGAATGG - Intergenic
996872321 5:128205000-128205022 TCCCCAAGGAAGATACAGAATGG - Intergenic
998387370 5:141765268-141765290 TTCCCAGTGCTGATGCACAGGGG - Intergenic
998541243 5:142983312-142983334 CTCACAAGGCTGAGGCAGGAGGG - Intronic
998977862 5:147668191-147668213 TTCTCAGGGCAGAGGCAGAAGGG - Intronic
999187312 5:149721346-149721368 GTCCCAAGTCTGCTGCAGATGGG - Intergenic
1000000455 5:157133866-157133888 TTCCAGAGGCTGAAGTAGAAGGG - Intronic
1000917369 5:167098817-167098839 TGCACGAGGCTGATACAGAATGG - Intergenic
1001940671 5:175737372-175737394 AGCCCAAGGCTGCTGCTGAAGGG + Intergenic
1002718077 5:181241082-181241104 TTCCCCAGGCTGAAGTACAATGG - Intronic
1003143203 6:3488735-3488757 TTGCCCAGGCTGTTGTAGAATGG + Intergenic
1006547713 6:34792900-34792922 TTTCCAAGGGTGATGCAACAGGG - Intronic
1008586709 6:52957399-52957421 TTCCAAAGCTTGAAGCAGAAAGG + Intergenic
1009475357 6:64084358-64084380 TTCCCAAGGCTATTGCAATAAGG + Intronic
1011015634 6:82751599-82751621 TTTCTAAGGATGGTGCAGAAAGG - Intergenic
1011061596 6:83275875-83275897 CTCCTGAGGCTGAGGCAGAATGG - Intronic
1011247132 6:85331401-85331423 CTCCGGAGGCTGAGGCAGAATGG - Intergenic
1011255912 6:85420744-85420766 GTGCCAAGACTTATGCAGAAAGG + Intergenic
1014650722 6:124033681-124033703 TTCCCAACAGTGTTGCAGAATGG - Intronic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1017443159 6:154483336-154483358 TTCTCCAGCCTGATTCAGAATGG - Intronic
1017682679 6:156879999-156880021 TTCCAAAGGCTGTTCCAGTAGGG + Intronic
1017990064 6:159479452-159479474 TTCCCAAGATTGATGCAACAAGG + Intergenic
1020120711 7:5501682-5501704 TTCTCTAGGCTGGTGCAGCAGGG + Exonic
1020783517 7:12545232-12545254 TTCCCCAGGTTGATGTTGAAAGG + Intergenic
1023313846 7:38915161-38915183 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1023963033 7:44943644-44943666 TTTCCAAGGCTGAGGCTGGAAGG + Intergenic
1023997649 7:45171832-45171854 TTTCCATAGCTGTTGCAGAAGGG - Intronic
1026597266 7:71744109-71744131 TTCCCAAGGCTGACGTGAAATGG + Intergenic
1027057039 7:75056916-75056938 CTCAGAAGGCTGAGGCAGAAAGG - Intronic
1027749494 7:82124330-82124352 TTCCCAGGGCAGAGGCAAAATGG + Intronic
1031118652 7:117695574-117695596 GTCCCAAAGCAGATGCAGAGGGG + Intronic
1031213141 7:118857394-118857416 CTCGCGAGGCTGAGGCAGAATGG + Intergenic
1031451427 7:121925556-121925578 TACTCAAGGCTGTTGCAGTAGGG + Intronic
1032567621 7:132963522-132963544 CTCGCGAGGCTGAGGCAGAATGG + Intronic
1033068157 7:138175967-138175989 TTCCCCAGGCTGGAGCACAATGG - Intergenic
1033522878 7:142180065-142180087 CTCCCAAGACTGAACCAGAAAGG - Intronic
1034159918 7:148985874-148985896 TTCCCCAGGCTGGAGCACAATGG - Intergenic
1035200641 7:157262871-157262893 TTCCAAAGGTTCCTGCAGAATGG + Intronic
1035961580 8:4144145-4144167 TTCCCAAAGCTGTATCAGAAGGG - Intronic
1036774755 8:11603318-11603340 TTTGGAAGGCTGAGGCAGAAGGG + Intergenic
1037264201 8:17039945-17039967 TTGCCCAGGCTGAAGTAGAATGG + Intronic
1037925609 8:22841912-22841934 TTTCCAGTGCTGCTGCAGAAAGG + Intronic
1038041019 8:23724306-23724328 TTTGCAAGGCTGAAGCAGGAGGG - Intergenic
1038868905 8:31471469-31471491 TTCCATAGGCTGAGGCAGGAGGG - Intergenic
1040057883 8:43076417-43076439 TTCAGGAGGCTGAGGCAGAAAGG - Intronic
1042782946 8:72511577-72511599 CTCAGAAGGCTGAGGCAGAAGGG + Intergenic
1043050857 8:75383809-75383831 TTCCCAACCCTGATGCAAACAGG - Intergenic
1044236341 8:89835162-89835184 TTCCCAAAGCTGAGGGAGAAAGG - Intergenic
1047304620 8:123642806-123642828 TTCCCAGGGGTGTTGCAGACAGG + Intergenic
1047415154 8:124658644-124658666 TTCACATGGCTGAAGCAGGAGGG + Intronic
1047916545 8:129590211-129590233 TACCAAATGCTGATGGAGAAAGG - Intergenic
1048364867 8:133729916-133729938 TTCCAATGGCTCATGCAGACTGG - Intergenic
1049438029 8:142596669-142596691 TTCCCAGGTGGGATGCAGAAGGG + Intergenic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1050302419 9:4273350-4273372 TTCGGAAGGCTGAGGCAGGAGGG + Intronic
1050655289 9:7821702-7821724 TTGCCAAGGCTGGAGCACAATGG + Intronic
1051445558 9:17135492-17135514 GTCCCAAGGCAGAGGGAGAAAGG - Intronic
1051974245 9:22929870-22929892 TTTGGAAGGCTGAAGCAGAAGGG - Intergenic
1055002293 9:71465619-71465641 TCCCCAGGGCTGATGGGGAATGG + Intergenic
1055159886 9:73113601-73113623 TTGCCCAGGCTGAAGCACAATGG + Intergenic
1055295611 9:74830089-74830111 TTGCCAAGGCTGAAGTACAATGG - Intronic
1055952357 9:81742125-81742147 TTGCCCAGGCTGAAGCACAATGG + Intergenic
1056303276 9:85263940-85263962 TTCACAAGGCTGTTTCAGACAGG + Intergenic
1056481091 9:87007122-87007144 TTCCCAAGGCTGCTTGAGGATGG + Intergenic
1057945617 9:99325578-99325600 CTCCTGAGGCTGATGCAGACTGG - Intergenic
1059933594 9:119285285-119285307 CTCAGAAGGCTGGTGCAGAATGG + Intronic
1060148758 9:121273108-121273130 TTCCCAAGAGTGATCCAGAAAGG + Intronic
1060567601 9:124607195-124607217 CTCACGAGGCTGAGGCAGAAAGG + Intronic
1061216310 9:129224004-129224026 TTTGAAAGGCTGAAGCAGAAGGG - Intergenic
1186103587 X:6182290-6182312 TTCCCAAGGGAGATGGAGCAAGG + Intronic
1187772961 X:22722606-22722628 TTGCCAAAGCTGATGTTGAACGG + Intergenic
1190861011 X:54344333-54344355 CTCCGGAGGCTGAGGCAGAATGG + Intronic
1190866982 X:54392899-54392921 CTCCGGAGGCTGAGGCAGAATGG + Intergenic
1191208697 X:57861722-57861744 TTGCCAAGGCTGATGTTGAGAGG - Intergenic
1194313770 X:92348136-92348158 TTCCTAAAGCTGAAGCAAAACGG + Intronic
1194359629 X:92933687-92933709 TTCCCCAGGCTGGTCCAGAATGG - Intergenic
1195877400 X:109556282-109556304 TTTCCTAGGCTGCTGCTGAAGGG - Intergenic
1196259354 X:113559820-113559842 TTGCCCAGGCTGGTGCACAATGG - Intergenic
1197888279 X:131240490-131240512 TCCTAAAGGCTGATGGAGAATGG + Intergenic
1198131763 X:133703038-133703060 TTCCCAAGTGTGAAGCTGAAAGG - Intronic
1200622039 Y:5462251-5462273 TTCCTAAAGCTGAAGCAAAACGG + Intronic
1200667823 Y:6049510-6049532 TTCCCAAGGCTGGTCCAGAATGG - Intergenic
1201607107 Y:15799205-15799227 TTCCAATGGCTGTTGCAAAAAGG + Intergenic
1201861941 Y:18608096-18608118 TTCAGAAGGCTGAGGCAGGAGGG + Intergenic
1201871382 Y:18712284-18712306 TTCAGAAGGCTGAGGCAGGAGGG - Intergenic