ID: 1015773592

View in Genome Browser
Species Human (GRCh38)
Location 6:136792483-136792505
Sequence CTTGAGCTGCACCGCGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015773592_1015773598 -7 Left 1015773592 6:136792483-136792505 CCTGCGCCGCGGTGCAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1015773598 6:136792499-136792521 GCTCAAGGGCGCCGCGCTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1015773592_1015773596 -9 Left 1015773592 6:136792483-136792505 CCTGCGCCGCGGTGCAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1015773596 6:136792497-136792519 CAGCTCAAGGGCGCCGCGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 64
1015773592_1015773597 -8 Left 1015773592 6:136792483-136792505 CCTGCGCCGCGGTGCAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1015773597 6:136792498-136792520 AGCTCAAGGGCGCCGCGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015773592 Original CRISPR CTTGAGCTGCACCGCGGCGC AGG (reversed) Exonic
900643124 1:3696761-3696783 CTTGAGCCCCACCGCTGCTCGGG - Intronic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
910396157 1:86795912-86795934 ATTGAGCTGCATCGCTGCCCAGG - Intergenic
915128058 1:153679401-153679423 CTTGAGGTCCACCGCGGCCAGGG - Exonic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG + Intronic
1070694542 10:78552208-78552230 CCTGAGCTTCACCGGGGAGCTGG + Intergenic
1076466709 10:130687741-130687763 CATGAGCAGCACCGCTGCACTGG - Intergenic
1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG + Intronic
1083724343 11:64620440-64620462 CTTGAGGTGCACGGTGGCACGGG + Intronic
1084643950 11:70443460-70443482 CTGGAGCTGGACGGCGGCGACGG + Intergenic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1104718268 12:131030611-131030633 CTTCAGCTGCACATCGGGGCAGG + Intronic
1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG + Exonic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1113574435 13:111383985-111384007 CCTGAGCTGCTCCGTGGCCCTGG + Intergenic
1117332701 14:54728965-54728987 CTTGAGCTGAACCGCAGGCCAGG - Intronic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1121525934 14:94619330-94619352 CTTCAGCTCCACCACGGTGCAGG - Exonic
1121526062 14:94620376-94620398 CTTCAGCTCCACCACGGTGCAGG + Intronic
1144781217 17:17809594-17809616 CCTGAGCTGGACGGCGGCGGGGG - Intronic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG + Intronic
1152376433 17:79921088-79921110 CTGGAGCTGCTCTCCGGCGCTGG - Intergenic
1152728948 17:81960652-81960674 GTTGAGCTGCTGCGCGGAGCAGG + Exonic
1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG + Intergenic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1166567479 19:43774110-43774132 CTCAACCTGCACCGCGGCACAGG + Intronic
925068852 2:950852-950874 CTCGGGCTCCACCGGGGCGCAGG - Exonic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
948121695 2:235535636-235535658 CTGGAGCTGGAGCGCGACGCGGG - Intronic
948423863 2:237876104-237876126 CTGGAGCTGCCCCGATGCGCCGG - Intronic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1180848045 22:18995112-18995134 CTTGAGCTACAGCGCAGCCCTGG - Intergenic
950428936 3:12939900-12939922 CTTGAGCTCCACTGTGGCACAGG - Intronic
966592113 3:181695351-181695373 CGTGGGCTGCTCCGAGGCGCAGG - Intergenic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
969594685 4:8142360-8142382 CCTGGGCTGCACCTCGGTGCTGG - Intronic
981573197 4:146175811-146175833 GGTGAGCCGCACCGCTGCGCGGG + Exonic
997585137 5:135039470-135039492 CTTGCGCTGTCCCGCGCCGCCGG + Intronic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1002662732 5:180802708-180802730 CTTGGCCTGCTCCGGGGCGCAGG + Intronic
1007432727 6:41786139-41786161 CTGGCGCTGCACCGAGGCGGAGG + Exonic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019337462 7:492115-492137 CTTGGGCTGCACCACTGCCCTGG - Intergenic
1026817150 7:73521970-73521992 CTAGTGCTGCGCCGCGGGGCCGG - Exonic
1038266574 8:26043251-26043273 CGGGAGCTGCCCTGCGGCGCTGG + Intronic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG + Exonic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic