ID: 1015773596

View in Genome Browser
Species Human (GRCh38)
Location 6:136792497-136792519
Sequence CAGCTCAAGGGCGCCGCGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015773590_1015773596 15 Left 1015773590 6:136792459-136792481 CCGGCTGACAAGTCGGCTCGCAA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1015773596 6:136792497-136792519 CAGCTCAAGGGCGCCGCGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 64
1015773592_1015773596 -9 Left 1015773592 6:136792483-136792505 CCTGCGCCGCGGTGCAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1015773596 6:136792497-136792519 CAGCTCAAGGGCGCCGCGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 64
1015773588_1015773596 26 Left 1015773588 6:136792448-136792470 CCTTTTCTTGGCCGGCTGACAAG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1015773596 6:136792497-136792519 CAGCTCAAGGGCGCCGCGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015773596 Original CRISPR CAGCTCAAGGGCGCCGCGCT CGG Exonic
901053658 1:6438463-6438485 CAGCTCAAAGGCCCCCCTCTGGG + Intronic
902586052 1:17439067-17439089 CAGCTCAGGGGTGCCGACCTCGG + Intronic
905168242 1:36096154-36096176 CAGCTGCAGGGCCTCGCGCTCGG - Exonic
905414475 1:37794711-37794733 CAGCTCAAGGAAGCCGCCATCGG + Exonic
906062547 1:42958221-42958243 CAGCCAATGGGCGCCGCGCTCGG + Intronic
911638827 1:100266129-100266151 CGGCTTAAAGGAGCCGCGCTGGG - Intergenic
912246309 1:107965020-107965042 CGGGTCGCGGGCGCCGCGCTAGG + Exonic
912369668 1:109164406-109164428 CAGCTGAAGGGAGGAGCGCTGGG - Intronic
912472474 1:109915064-109915086 CAGCTCCAGGGCCCTGAGCTTGG + Intronic
912980776 1:114369485-114369507 CAGGCCCAGGGCGCAGCGCTGGG + Intergenic
913104035 1:115595432-115595454 CAGCTCAAGTGTGAGGCGCTGGG + Intergenic
1064354311 10:14604047-14604069 CACCTCCCGGGCGCCGCGCGGGG + Intronic
1068676134 10:59771363-59771385 CAGGTCCAGGGCGTGGCGCTGGG + Intergenic
1095893868 12:47260779-47260801 CAGCACAAGGGGGCCGCGCACGG - Intergenic
1100279086 12:93101063-93101085 CATCTCAAGGGCTCTGTGCTGGG - Intergenic
1104226319 12:126837965-126837987 CAGCTCAAGAGTGCTGAGCTGGG - Intergenic
1104794451 12:131507463-131507485 CAGCTCAAGGCCCCAGGGCTGGG - Intergenic
1117098287 14:52319233-52319255 CAGCTCAAGGGAGCTGAGCCAGG + Intronic
1118288944 14:64503576-64503598 CAGCTGCAGGCCGCCGCCCTGGG + Intronic
1123028310 14:105438952-105438974 CAGCTCAGGGCAGCTGCGCTGGG - Intronic
1130902210 15:88215542-88215564 CAGCTCAGGGGAGCCAGGCTGGG + Intronic
1132403528 15:101528550-101528572 CAGCTCAAGGCCACAGGGCTGGG + Intergenic
1136294642 16:29294791-29294813 CAGCTCATGGGGGCCGGGCTGGG - Intergenic
1136417468 16:30112774-30112796 CAGCTCCATGGCCCAGCGCTCGG - Exonic
1142438959 16:90082115-90082137 CGGCTCAAGCGCGCAGCGCTCGG - Intronic
1147420125 17:40318374-40318396 CAGCACCAGGGCGCCGGGTTAGG + Intronic
1151767915 17:76141488-76141510 CCGCCCGAGGGCCCCGCGCTGGG + Intergenic
1153052093 18:909137-909159 GATCTCAAGGGGGCAGCGCTGGG + Intronic
1153984569 18:10340904-10340926 CAGTTCAAGGGAGCCGCAGTGGG - Intergenic
1154251828 18:12751167-12751189 CAGAGCAAGGGCGCCGTCCTGGG - Intergenic
1161027241 19:2042325-2042347 CAGCTCCAGGCCGCGGAGCTCGG - Intronic
1161144426 19:2669072-2669094 CAGCTCAAGGTCACCACCCTAGG + Intronic
1162295542 19:9811010-9811032 CAGCTCAAGGACTCTGAGCTTGG + Exonic
1167123120 19:47530985-47531007 CAGCTGAGGGGCTCCACGCTTGG - Intronic
1168311814 19:55464498-55464520 CAGCTCCCGGGGGCCGGGCTCGG + Intergenic
1168405125 19:56106686-56106708 CAGCCCAAGGGGGCCTCGCCTGG - Intronic
934932790 2:98441925-98441947 CAGGCCTAGGGCGCGGCGCTGGG + Intergenic
935294276 2:101635150-101635172 CAGTTCAAGGGTGCCGCTTTAGG + Intergenic
946029717 2:216694542-216694564 CAGCCCCTGGGCGCAGCGCTCGG + Exonic
948410144 2:237752965-237752987 CAGCCCTAGGACGCCGTGCTGGG + Intronic
1175846275 20:62060570-62060592 TAGGGCAAGGGCGCCGCTCTGGG - Intronic
1176135617 20:63520892-63520914 CAGGTGAGGGGCGCCGCGCGCGG + Exonic
1176153322 20:63604742-63604764 CAGCTCAAGGAAGCCGTGTTAGG - Exonic
949399054 3:3646635-3646657 CAGGCCCAGGGCGCGGCGCTGGG - Intergenic
953909234 3:46883390-46883412 CAGCGCATGGGCCCCGCGCCGGG + Exonic
968582875 4:1403086-1403108 CCGCCCATGGGCGCCCCGCTCGG - Exonic
969839552 4:9870794-9870816 CAGCTCCAGGGAGCCCTGCTTGG - Intronic
979857916 4:125657398-125657420 CAGCTCAAGGTCGCATCTCTAGG - Intergenic
985983255 5:3489457-3489479 CCGGTCAAGAGCGCCGCGATTGG + Intergenic
985995404 5:3594795-3594817 CATCTCAAGTGCGCCGCGCCTGG + Intergenic
990646177 5:57846979-57847001 CAGCTCCAGGGCTCCGAGCAAGG - Intergenic
992875499 5:81050508-81050530 CAGCTCAGAGGGGCCTCGCTTGG - Intronic
997466374 5:134090640-134090662 CCGCTCAAGGTCGCAGCCCTTGG + Intergenic
997589260 5:135062883-135062905 CAGCTCAAGGGCACCTCCCCAGG - Intronic
999309898 5:150545227-150545249 CAGCACAAGGGCGAGGCACTGGG - Intronic
1007647359 6:43393248-43393270 CAGGCCCAGGGCGCAGCGCTGGG - Intergenic
1015773596 6:136792497-136792519 CAGCTCAAGGGCGCCGCGCTCGG + Exonic
1019632491 7:2057134-2057156 GAGCTCAAGGGCCCCTCTCTAGG - Intronic
1022389275 7:29929230-29929252 CAGCTCCAGGGCTCTGCGCTGGG + Intronic
1032865059 7:135916708-135916730 CAACTCAAGGGCTCCTCACTGGG - Intergenic
1033705665 7:143882939-143882961 GAGCTCCAGGGGGCGGCGCTTGG + Intronic
1034747230 7:153533754-153533776 CAGCTCAAGGGTCCCGGGGTAGG + Intergenic
1034899566 7:154899289-154899311 CAGCTCAAGGGCGACGTCCTGGG + Intergenic
1035209612 7:157318135-157318157 CAGCTCAAGGGAGCCACCCGGGG - Intergenic
1039502857 8:38030800-38030822 AGGCTCAAGGGCGCCGTGATTGG + Intronic
1045231411 8:100310174-100310196 CAGCACGCGGGCGGCGCGCTGGG - Intronic
1049585426 8:143430575-143430597 CAACTCCGGGGCGGCGCGCTAGG + Intergenic
1057470107 9:95349590-95349612 CAGCCCGAGGGCGCTGAGCTCGG - Intergenic
1061208579 9:129177963-129177985 CAGCTTGATGCCGCCGCGCTGGG + Exonic
1062599318 9:137312832-137312854 CAGCTGAAGGGGCCAGCGCTGGG + Intronic
1203654822 Un_KI270752v1:13557-13579 CAGCTGAAGCGCGCTGCCCTTGG + Intergenic
1190244853 X:48684312-48684334 CAGCTCCAGGGGGCAGCGCCAGG - Exonic