ID: 1015773597

View in Genome Browser
Species Human (GRCh38)
Location 6:136792498-136792520
Sequence AGCTCAAGGGCGCCGCGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015773592_1015773597 -8 Left 1015773592 6:136792483-136792505 CCTGCGCCGCGGTGCAGCTCAAG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1015773597 6:136792498-136792520 AGCTCAAGGGCGCCGCGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 41
1015773588_1015773597 27 Left 1015773588 6:136792448-136792470 CCTTTTCTTGGCCGGCTGACAAG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1015773597 6:136792498-136792520 AGCTCAAGGGCGCCGCGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 41
1015773590_1015773597 16 Left 1015773590 6:136792459-136792481 CCGGCTGACAAGTCGGCTCGCAA 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1015773597 6:136792498-136792520 AGCTCAAGGGCGCCGCGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015773597 Original CRISPR AGCTCAAGGGCGCCGCGCTC GGG Exonic
901923721 1:12553102-12553124 AGCGCCAGGGCTCCGGGCTCGGG - Intergenic
902586053 1:17439068-17439090 AGCTCAGGGGTGCCGACCTCGGG + Intronic
906062548 1:42958222-42958244 AGCCAATGGGCGCCGCGCTCGGG + Intronic
921060455 1:211579694-211579716 TACTCGAGGGCCCCGCGCTCAGG - Intergenic
923065257 1:230511734-230511756 AGCTAAAGGGCACAGCGCTTTGG - Intergenic
1063452905 10:6163546-6163568 AGCTCCCGGGAGCCCCGCTCTGG + Intronic
1065993136 10:31031972-31031994 AGCTCGAGGGCGTGGAGCTCGGG - Intergenic
1069819971 10:71221349-71221371 AGCTCAAGTGCGCCCTGCTGAGG + Intronic
1072263272 10:93702634-93702656 AGCACAAGGTCGGCGCACTCGGG - Intergenic
1073535668 10:104274864-104274886 AGCTCACGGTCGCCGCCCTGTGG - Exonic
1077532541 11:3103936-3103958 AGCTCGAGGGTGCAGGGCTCAGG + Intronic
1084327027 11:68406404-68406426 AGCTCAGGGGTGCCGAGCTCAGG - Intronic
1125429535 15:39581197-39581219 CGCTCCCGGCCGCCGCGCTCCGG + Exonic
1140406056 16:74712292-74712314 AGCTCCAGGGCCTCGCACTCAGG - Intergenic
1142438958 16:90082114-90082136 GGCTCAAGCGCGCAGCGCTCGGG - Intronic
1161027240 19:2042324-2042346 AGCTCCAGGCCGCGGAGCTCGGG - Intronic
925469400 2:4142782-4142804 AGCTCAAGGGTGCCCTTCTCTGG + Intergenic
932773615 2:74514718-74514740 AGCCCAGCGGCGGCGCGCTCCGG - Exonic
936713638 2:115161511-115161533 AGCAGCCGGGCGCCGCGCTCCGG - Intronic
936954994 2:118014175-118014197 GGCGCAGTGGCGCCGCGCTCCGG - Intergenic
937197718 2:120174503-120174525 AGCTCAAGGGCAACACACTCAGG - Intronic
939281762 2:140073975-140073997 AGCCCACCGGCGCTGCGCTCCGG + Intergenic
946178306 2:217935328-217935350 AGCTCAAGGGCCAGGCCCTCTGG + Intronic
1176135618 20:63520893-63520915 AGGTGAGGGGCGCCGCGCGCGGG + Exonic
1176922000 21:14698953-14698975 ATCTCTAGGGCTCCGCGATCTGG + Intergenic
1179644929 21:42770064-42770086 AGCTCGAGGGCACAGAGCTCAGG - Intronic
1181162765 22:20967651-20967673 ACCTCCAGGGCCCCACGCTCTGG + Intronic
1182242077 22:28924014-28924036 AGATCAAAGGCGCCGCGCACCGG + Intronic
1185258509 22:49849308-49849330 CCCTCAAGGGCGCCGCGCCCCGG + Intergenic
955055249 3:55448785-55448807 AGCTCAAGGGCCCAGCACCCTGG + Intergenic
962804207 3:138915580-138915602 GGCTCCAGTGCGGCGCGCTCGGG - Intergenic
982261500 4:153498221-153498243 AGATCAAGGGCACCATGCTCAGG - Intronic
994631878 5:102296660-102296682 GGCTCAAGGGAGGCGCGCTGCGG - Intergenic
996238220 5:121160262-121160284 AGGTCAAGGGCTCAGGGCTCAGG - Intergenic
999244882 5:150148805-150148827 AGCTCAAGGCCACCTCCCTCAGG - Intronic
1007120467 6:39376502-39376524 AGCTGAGGGGCTCTGCGCTCAGG - Intronic
1015773597 6:136792498-136792520 AGCTCAAGGGCGCCGCGCTCGGG + Exonic
1022923276 7:35037230-35037252 GGCGCAAGGGCGCCGCGGGCAGG - Intronic
1026914014 7:74108996-74109018 ACATCAAGGGCGGCACGCTCCGG + Exonic
1034899567 7:154899290-154899312 AGCTCAAGGGCGACGTCCTGGGG + Intergenic
1035941776 8:3909404-3909426 AGCTCAAGGGTGCCGAGGGCAGG + Intronic
1037688530 8:21163835-21163857 AGATCAAGGGAGCAGAGCTCAGG - Intergenic
1061734693 9:132645959-132645981 AGCTCAGGGGCGCCGGCATCAGG - Exonic
1062078190 9:134603597-134603619 AGCGCAAGGGCACCACACTCTGG + Intergenic
1062406722 9:136400195-136400217 AGAACAAGAGCGCCGCGCGCCGG + Intergenic
1062435763 9:136546002-136546024 AGCGCAAGGGCGCGGGGCGCGGG - Intergenic
1193152475 X:78139656-78139678 AGCTCGCGGGCTCCTCGCTCAGG + Exonic