ID: 1015785980

View in Genome Browser
Species Human (GRCh38)
Location 6:136922057-136922079
Sequence CAGGGAAGACGCTCTGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015785980_1015785986 -5 Left 1015785980 6:136922057-136922079 CCCTCCGCAGAGCGTCTTCCCTG 0: 1
1: 0
2: 2
3: 10
4: 135
Right 1015785986 6:136922075-136922097 CCCTGACGGTGAAACCGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 22
1015785980_1015785984 -6 Left 1015785980 6:136922057-136922079 CCCTCCGCAGAGCGTCTTCCCTG 0: 1
1: 0
2: 2
3: 10
4: 135
Right 1015785984 6:136922074-136922096 TCCCTGACGGTGAAACCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 24
1015785980_1015785989 11 Left 1015785980 6:136922057-136922079 CCCTCCGCAGAGCGTCTTCCCTG 0: 1
1: 0
2: 2
3: 10
4: 135
Right 1015785989 6:136922091-136922113 GCGCGGGACACAACCCACCGCGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015785980 Original CRISPR CAGGGAAGACGCTCTGCGGA GGG (reversed) Intergenic
900480210 1:2894542-2894564 CAGAGGAGACGCCCTCCGGAGGG - Intergenic
900542391 1:3209717-3209739 CAGGGAAGGGGCTCTGTGGGGGG - Intronic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG + Intronic
903621419 1:24700975-24700997 CTGGGAAGAAGCTCTCCCGAAGG + Intergenic
904326482 1:29729834-29729856 CAGGGATGACCATCTGCTGATGG + Intergenic
904775406 1:32902919-32902941 CAGGGAAGCAGCTCTGCTGGGGG - Intergenic
905572119 1:39014343-39014365 CAGGGAAGACACACTGGGGCAGG + Intergenic
911104105 1:94116696-94116718 CAGGGATGCCGCTCTGGGGAGGG - Intronic
915737416 1:158093854-158093876 CAGGGAAGACCGACTGAGGAAGG - Intronic
917136009 1:171788739-171788761 CAGGGAAGATGCACTGGAGACGG - Intronic
919758995 1:201085221-201085243 CAGGGGAGGCGCTATGAGGATGG + Intronic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
924282576 1:242452937-242452959 CAGGTAAAATGCTCAGCGGAAGG + Intronic
1064270990 10:13865888-13865910 CAGGGAAGACACTGTGGGGCGGG + Intronic
1064614913 10:17142821-17142843 CCAGGAAGACACACTGCGGAGGG - Intronic
1066979692 10:42400905-42400927 CAGTGAAGAGGCTCTCCAGAGGG - Intergenic
1066987108 10:42477355-42477377 CTGGGAGGACGCGCAGCGGAAGG - Intergenic
1067337116 10:45374695-45374717 CAGGGAAGACGCCTTGCAGGCGG - Intronic
1069964561 10:72103593-72103615 CAGGGAAGAGGGGCTGTGGAAGG - Intronic
1074160465 10:110832808-110832830 CAGAGAAGCTGCTCTCCGGAGGG - Intronic
1075679746 10:124323568-124323590 GAGGAAAGAGGCTCTGAGGAGGG + Intergenic
1076351424 10:129817239-129817261 CAGGTAGGAAGCTCTGTGGATGG + Intergenic
1078401252 11:11029301-11029323 CAGGGAAGAGGCTCTGAAGAGGG + Intergenic
1085904951 11:80749160-80749182 CAGGGAAGATGGTGTGGGGAAGG + Intergenic
1087006532 11:93477396-93477418 CAGGGCAGATGCTGTGAGGATGG - Intergenic
1088969778 11:114762633-114762655 CAGGGAGAAGCCTCTGCGGAAGG - Intergenic
1091147211 11:133290324-133290346 CAGGCACCACGCTCTGCTGAGGG - Intronic
1091678214 12:2506909-2506931 CTGGGCAGACGCTCTGCTCAGGG - Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1094390873 12:29949251-29949273 CCTGGAAGATGCTCTGCTGAAGG - Intergenic
1098956649 12:76695609-76695631 GAGGGAAGAGGCCCTGAGGATGG + Intergenic
1101655504 12:106716599-106716621 CAGGAAAGAAGCCCTGGGGAAGG - Intronic
1101997465 12:109535288-109535310 CTGGGAAGAGGCGCTGTGGACGG - Exonic
1102469584 12:113152311-113152333 CAGGGAAGAAGCACTGGGCAGGG + Intronic
1103344796 12:120242041-120242063 CAGGGAAGAAGGTCTGCGGCAGG + Intronic
1103613096 12:122135816-122135838 CTGGGAACACGCTCTGTGGGTGG + Intronic
1104464186 12:128977275-128977297 AAAGGAAGAAGCTCTGAGGACGG + Intronic
1104869364 12:131983599-131983621 AAGGGAAGACTCTCTGCAGTGGG - Intronic
1105411745 13:20177109-20177131 CAGGAAAGACGCTGAGCGGGCGG + Intergenic
1106287255 13:28328713-28328735 CATGGAAGCCCCTCTGAGGACGG - Intronic
1112326037 13:98443459-98443481 CAGGGAGGAGGCCCTGGGGATGG - Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1124699852 15:31903499-31903521 CAGCAAGGACCCTCTGCGGAAGG - Intergenic
1128203571 15:65830682-65830704 CATGGAAGATCCTCTGAGGAAGG - Intronic
1128564850 15:68694211-68694233 CAGGGAAGACTTTCTGCAGGAGG + Intronic
1129740889 15:77989073-77989095 CAGGGAAGGCCTTCTGAGGAGGG + Intronic
1129741930 15:77993508-77993530 CAGGGAGGGCTATCTGCGGAGGG + Intronic
1132905690 16:2281544-2281566 CACGGAAGCCGCCCTGCGGCTGG - Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136923039 16:34346903-34346925 CAGGGAAGGGGCTGTGAGGATGG - Intergenic
1136981534 16:35064903-35064925 CAGGGAAGGGGCTGTGAGGATGG + Intergenic
1137468045 16:48729134-48729156 CAGGGAAGACTATCCGGGGAAGG - Intergenic
1139477410 16:67209647-67209669 CAGGGAAGGAGCACTGAGGAAGG - Intronic
1141278246 16:82607160-82607182 CAGGGGAGAGGCTATGGGGAAGG + Intergenic
1144839612 17:18177843-18177865 CAGGGAAGCTGCTCTGAGAAAGG - Intronic
1144888990 17:18483263-18483285 CTGGGAAGAGGCTCTGCTGAAGG + Intronic
1145143218 17:20461033-20461055 CTGGGAAGAGGCTCTGCTGAAGG - Intronic
1145792654 17:27637651-27637673 CTGGGAAGACGCTCTGCTGAAGG + Intronic
1145807527 17:27745519-27745541 CTGGGAAGACACTTTGCTGAAGG + Intergenic
1146437236 17:32861598-32861620 CAGGGACCACACTTTGCGGAAGG - Intronic
1147948285 17:44092751-44092773 CAGGGGGGCCGCTCTGGGGAGGG + Exonic
1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG + Intergenic
1152070993 17:78133569-78133591 CAGGGAAGATTCCCTGGGGAAGG - Intronic
1152365593 17:79854568-79854590 CAGGGAAGGCTCACTGAGGAAGG + Intergenic
1152732012 17:81977227-81977249 CAGGGAAGAGGCTCAGCTGCTGG + Intronic
1155557311 18:27034020-27034042 CAGGGAAGCAGCAGTGCGGATGG - Intronic
1157446669 18:47751457-47751479 CAGGGAAGGCTTTCTGGGGAGGG - Intergenic
1163648525 19:18503787-18503809 CAGGGAAGGCTCCCTGAGGAGGG - Intronic
1163769474 19:19182139-19182161 GAGGGCAGACGCTCTGGGGCTGG - Intronic
1165639665 19:37373679-37373701 CAGGGAAGTCCCTCTGATGAAGG + Intronic
1166737995 19:45097457-45097479 CAGGGGTGAGGCTCTGCTGAAGG - Intronic
1167649040 19:50719611-50719633 AAGGGGGGGCGCTCTGCGGATGG - Intergenic
925079957 2:1056137-1056159 CGGGGAGGACTCCCTGCGGATGG + Intronic
925911093 2:8574113-8574135 CAGGGAAGAGAGTGTGCGGAGGG - Intergenic
927936954 2:27081527-27081549 CAAAGAAGAGGCTCTGTGGACGG - Intronic
930391622 2:50768694-50768716 CAGAGAAGATGCTATGTGGAAGG + Intronic
934683736 2:96305532-96305554 CAGGAAAGACGCACTGGGGAAGG + Intergenic
935408647 2:102736404-102736426 AAGGGAAGACGTTCCGCGAACGG + Intronic
937364206 2:121249075-121249097 CACGGATGATGCTCTGGGGAGGG + Exonic
938732269 2:134155890-134155912 CAGGGAGGCCTCCCTGCGGAAGG - Intronic
944316760 2:198292729-198292751 CAGGCAAGACCCTCTGAGTAGGG - Intronic
948751765 2:240137117-240137139 CATTGAGGACGCTCTGCCGAGGG + Intergenic
1169111554 20:3037343-3037365 CAGGGAGGAGGCTCTTCAGAGGG + Intronic
1169346627 20:4834154-4834176 CAGGGAAGAGGGTCGGGGGAAGG + Intergenic
1172020676 20:31911575-31911597 CAGGGAAGGCGCAGTGAGGAAGG + Intronic
1173435979 20:43032663-43032685 CAGGCCTGACGCTCTGCGGGGGG - Intronic
1177601821 21:23325346-23325368 CAGGCAAGACGGTGTGCGCAGGG - Intergenic
1180800213 22:18628237-18628259 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1180851446 22:19023801-19023823 CAGGGAAGGCGCTCCTGGGAGGG + Intergenic
1181221503 22:21367029-21367051 CAGGGAAGGCGCTCCTGGGAGGG - Intergenic
1184408511 22:44313501-44313523 CAGGGAGGACCCTCTGCTGCTGG - Intergenic
950428811 3:12939166-12939188 GAGGGAAGACGCTCAGCGGAGGG + Intronic
952289640 3:32002988-32003010 CAGGGAAGACTGTCTGCAGGAGG + Intronic
952902759 3:38120842-38120864 CAGGGAAGGCTCCCTGCGGGAGG + Intronic
952927143 3:38328643-38328665 CAGGGAAGACTCCCTGCAGGAGG - Intergenic
955485218 3:59428143-59428165 CAGGGAAGACCCGATGAGGAAGG - Intergenic
955886532 3:63605216-63605238 CAGGAAAGACTATCTGGGGAGGG + Intronic
968979603 4:3839579-3839601 CAGGGAAGAGGATCTGAGAAGGG + Intergenic
969473911 4:7410116-7410138 CTGGTAAGACACTCTGCAGAAGG - Intronic
972414428 4:38824419-38824441 CAGGGAGGCCCCTCTGCCGAGGG + Exonic
973096159 4:46202739-46202761 CAGGCAAGACGGTGTGCGCAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
982387832 4:154831844-154831866 CAGGGCAAAAGCTCTGCAGATGG + Intergenic
984896880 4:184548968-184548990 CAGGGAAGGAGGTCTGCTGAGGG - Intergenic
984947127 4:184978382-184978404 CAGGGAACTCGGTCTGTGGAAGG - Intergenic
986838729 5:11672027-11672049 CAGTGAAGCCGCTCTGAGGCAGG + Intronic
987004434 5:13695339-13695361 CAGGGAGAGCCCTCTGCGGATGG - Intronic
995837210 5:116410759-116410781 CAAGGTAGAGGCTCTGTGGAGGG - Intronic
996314791 5:122149520-122149542 AAGGGAAGAAGCTCTGCTGGAGG + Intronic
1001651381 5:173318519-173318541 AAAGGAAGACCCTCTGGGGATGG + Intronic
1002323532 5:178389958-178389980 CAGGAAAGACGCTCGGCGGCAGG + Intronic
1003148941 6:3532440-3532462 CAGGGAAGAAGCTCTGCCCTGGG + Intergenic
1006109433 6:31735772-31735794 CAGGGAAGACGGTGTGTTGAGGG - Intronic
1015785980 6:136922057-136922079 CAGGGAAGACGCTCTGCGGAGGG - Intergenic
1019062222 6:169264791-169264813 CAGGGCAGGGGCTCTGAGGATGG + Intergenic
1019995232 7:4719813-4719835 CACTGAAGAGGCTCTGCAGATGG - Intronic
1021621322 7:22553323-22553345 CTGGGTAGAGGCTCTGCGGTAGG - Intronic
1022911432 7:34902667-34902689 CAGGGCAGATCCTCTGCGGTAGG + Intergenic
1022926444 7:35059666-35059688 CAGGGAGGCCTCTCTGCGAAGGG - Intergenic
1023241374 7:38151322-38151344 CAGGGCAGAAGCTATGAGGAGGG - Intergenic
1026300001 7:69089524-69089546 CAGGGAAGGTGCTCAGAGGAAGG + Intergenic
1026896510 7:74012960-74012982 CAAGGTAGACGCTCTGGGCAGGG - Intergenic
1028375821 7:90145885-90145907 CAGGGAGGCCTCTCTGCGAAGGG + Intergenic
1030167065 7:106565919-106565941 CAGAGAAGATGCTATGCTGATGG + Intergenic
1034455511 7:151167846-151167868 CTGGGAACGGGCTCTGCGGAGGG - Intronic
1035100194 7:156389860-156389882 AAGGGAAGAAGCTCTGAGGAGGG - Intergenic
1035781618 8:2232595-2232617 CAAGGAGGATGCTGTGCGGAAGG + Intergenic
1035810477 8:2486770-2486792 CAAGGAGGACACTGTGCGGAAGG - Intergenic
1035847771 8:2883441-2883463 CTGGGAAGAGGCTGTGCAGAAGG + Intergenic
1036242546 8:7092254-7092276 CGGGGAGGACGCGCTGCGGCCGG + Intergenic
1036899269 8:12659174-12659196 CGGGGAGGACGCGCTGCGGCCGG - Intergenic
1037820637 8:22133243-22133265 CAGGTAAGGGGCTCTGGGGATGG - Intronic
1049288461 8:141789212-141789234 CAGAGGAGAGGCTCTGCTGACGG + Intergenic
1049401154 8:142427932-142427954 CAGTGAAGACGCTGTGCCGATGG - Intergenic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1056100943 9:83300263-83300285 CAGAGAAGATGCCCTGAGGAAGG + Intronic
1056733191 9:89183231-89183253 CAGGGGATACTCTCTGTGGATGG - Intergenic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1059268098 9:113054894-113054916 CATGGAAGACGGACTGCAGAGGG - Intronic
1059663598 9:116425380-116425402 CAGGAAGGAAGCTCTGAGGATGG - Exonic
1062333698 9:136055764-136055786 CACGGGAAACGTTCTGCGGAGGG + Intronic
1203453585 Un_GL000219v1:144005-144027 CAGGCAAGACCCCCTGCTGAGGG + Intergenic
1185546447 X:949326-949348 CAGAGAAGTTGCTCTGGGGAAGG - Intergenic
1190639029 X:52465179-52465201 CAGGGTAGATGCTCTGTGAAGGG + Intergenic
1196739972 X:119016253-119016275 CAGGGAAGCTGCTTTGGGGAAGG + Intronic
1198832427 X:140764763-140764785 CAGCGAAGACGCTCCGCTCAGGG - Intergenic
1200150460 X:153948934-153948956 CAGGAAAGCCACTCTGGGGAGGG + Exonic