ID: 1015786124

View in Genome Browser
Species Human (GRCh38)
Location 6:136922658-136922680
Sequence GAGCACCGCGACCCCCGCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015786124_1015786129 18 Left 1015786124 6:136922658-136922680 CCTTCGCGGGGGTCGCGGTGCTC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1015786129 6:136922699-136922721 CTCACGCTCTGGTCCCTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 100
1015786124_1015786126 7 Left 1015786124 6:136922658-136922680 CCTTCGCGGGGGTCGCGGTGCTC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1015786126 6:136922688-136922710 TGCAGTCCAGCCTCACGCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015786124 Original CRISPR GAGCACCGCGACCCCCGCGA AGG (reversed) Exonic
905651708 1:39661172-39661194 GAGCACGGCGTCCCCATCGAAGG + Exonic
916130367 1:161606784-161606806 CAGCACCTTGAGCCCCGCGATGG - Intronic
922753733 1:228082860-228082882 GGGCACGTCGACCCCCGCGGCGG + Intronic
1071087013 10:81875895-81875917 GAACACTGCGGCCCCTGCGACGG + Exonic
1073412149 10:103351046-103351068 CACCACCGCGACCCCCTCCATGG + Exonic
1078023299 11:7672844-7672866 GAGCACAGTGACCCCAGTGACGG + Exonic
1084806801 11:71584684-71584706 GGGCACCTCGCCCCCTGCGATGG - Intronic
1089729694 11:120512201-120512223 GAGGACCGCGAGCCCGGGGAAGG - Intronic
1096191626 12:49623602-49623624 GAGCCCCTCCACCCCCGCGCGGG - Intronic
1104671307 12:130682312-130682334 GAGCACCGCCAGCCCCAAGATGG + Intronic
1106553024 13:30787862-30787884 GAGCTCAGGGACCCCAGCGAAGG + Intergenic
1106735794 13:32586782-32586804 GCGCCCCGCGACCCCCGCCCCGG - Intronic
1112091907 13:96091142-96091164 GAGCCCGGAGACCCCCGGGAGGG + Exonic
1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG + Intergenic
1143625885 17:8109940-8109962 GAGCAGCGTGGCCCTCGCGATGG + Exonic
1144840879 17:18184775-18184797 GAGCACCGCGTCATCCCCGAGGG + Exonic
1148328849 17:46800831-46800853 CAGCACCGCGGCCCCAGCAAAGG - Intronic
1154980395 18:21498696-21498718 GAGCACAGGGACCCCAGCCATGG + Intronic
1160706391 19:532111-532133 GAGCGCGGCGACCCCCGCCCGGG + Intronic
1160780116 19:873772-873794 GAGCACAGCGGCCCCCGGGGGGG - Intronic
1162373371 19:10291657-10291679 GAGCACCGCGCCCCGCGCTCGGG - Exonic
1164109094 19:22137929-22137951 CACCACCGCGACCCCCTCCATGG - Intergenic
1166100354 19:40567974-40567996 GACCCCCGCGACCCCCGCGGCGG + Exonic
1166543318 19:43619744-43619766 AAGCACGGCGCCCCCCGCGCGGG - Exonic
929452884 2:42048343-42048365 GCTCCCCGCGGCCCCCGCGACGG - Exonic
934966841 2:98731048-98731070 GAGCACGGCGACGCCAGCGGCGG - Intronic
1170366151 20:15600208-15600230 GTGCACCGAGACCCCTGGGATGG + Intronic
1174298869 20:49568113-49568135 CAGCCCCGCCAGCCCCGCGATGG - Exonic
1176131008 20:63496867-63496889 GAGCACCCCCAACCCCGCCAGGG + Intronic
1185059903 22:48600948-48600970 GAGCACCGTGACCGCGGAGAGGG - Intronic
963335859 3:143972615-143972637 CAGTACGGCGAGCCCCGCGAGGG + Exonic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
969559727 4:7939466-7939488 GACGACCGGGACCCCCGCGCGGG + Exonic
969714179 4:8860593-8860615 GAGCCCCGCGTCCCCCGCCACGG + Intronic
973982028 4:56315167-56315189 GAGCCCCGTGACGCCCGCAAAGG + Exonic
985446151 4:190022143-190022165 GAGCAGGGTGACCCCCGCCAGGG + Intergenic
991270064 5:64768917-64768939 GAGCACCGCTAACCCTGAGAAGG - Exonic
997505206 5:134411685-134411707 GACTACCGCGACCCGCCCGACGG - Exonic
1002173456 5:177387996-177388018 ATGCACCGTGGCCCCCGCGAAGG - Exonic
1003175833 6:3751752-3751774 GACTACCGCGCCGCCCGCGATGG - Exonic
1013422417 6:109978628-109978650 GAGCCCAGAGACCCCTGCGAAGG - Intronic
1013538866 6:111087930-111087952 GAGCCCCCCGAACCCCCCGAGGG + Exonic
1015786124 6:136922658-136922680 GAGCACCGCGACCCCCGCGAAGG - Exonic
1019910373 7:4096836-4096858 GACCACAGCGACCCCCGTGGGGG - Intronic
1020383088 7:7567111-7567133 GAGCGCCGCGGCCGCAGCGAGGG + Intronic
1033253207 7:139777842-139777864 GAGCCCCGAGCCCCCCGCGCCGG - Intronic
1042367294 8:67952185-67952207 GAGCCCCGCGCCCCCCGCGCCGG + Exonic
1053188239 9:36037048-36037070 CACCTCCGCGACCCCCGCCACGG - Exonic
1057061027 9:92003956-92003978 AAGGACCGCGCCCCCCGCCAGGG - Intergenic
1059800445 9:117745026-117745048 GAGCCCCGCGCAGCCCGCGAAGG - Intergenic
1061500397 9:130998373-130998395 GAGCTCCGCGCCCCCCTCCACGG + Intergenic
1062395568 9:136351303-136351325 GATCACCGGGACCCCCGGGAAGG - Intronic