ID: 1015795152

View in Genome Browser
Species Human (GRCh38)
Location 6:137003955-137003977
Sequence AGCAGGCGCTGGGAATTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015795152_1015795159 26 Left 1015795152 6:137003955-137003977 CCCCAGAATTCCCAGCGCCTGCT 0: 1
1: 0
2: 2
3: 25
4: 211
Right 1015795159 6:137004004-137004026 TGAAATTCTAGTCCTCGACTAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015795152 Original CRISPR AGCAGGCGCTGGGAATTCTG GGG (reversed) Intronic
900151297 1:1180370-1180392 AGCAGGCGGTGGGTATTCAGTGG - Intronic
900327382 1:2115315-2115337 AGAAGGCGCTCGGATGTCTGTGG - Intronic
900812763 1:4820481-4820503 ACCAGGAGCTTGGAGTTCTGGGG - Intergenic
901120863 1:6892325-6892347 AGCAGGCTCTGGGATAACTGCGG + Intronic
901146690 1:7069664-7069686 AGCAGGCTCTGGGGGTGCTGTGG + Intronic
901533536 1:9868092-9868114 AGGAGGTTCTGAGAATTCTGTGG - Intronic
902211833 1:14910137-14910159 AGAAGGCTCTGGGATATCTGTGG + Intronic
902574599 1:17369565-17369587 TGCAGGTGCTGGGGATTCAGTGG + Intergenic
903349477 1:22709692-22709714 ATCAGGAGCTCGGAACTCTGTGG - Intergenic
903822477 1:26112587-26112609 AGCCGGCGCAGAGGATTCTGTGG + Exonic
906553266 1:46684661-46684683 AACAGGCTCTGGGAATACAGTGG - Intronic
912518438 1:110229998-110230020 GGCAGAGGCTGGGAAATCTGAGG + Intronic
914921251 1:151848837-151848859 AGCAGGCGCTCTGCTTTCTGTGG - Intronic
918739954 1:188117064-188117086 AGAAGGTGATGGGAAATCTGGGG - Intergenic
920255533 1:204651873-204651895 GGCAGGGGCTGGTAATTCTTAGG - Intronic
921060886 1:211583570-211583592 TGCAGGAGCTGGAACTTCTGTGG + Intergenic
921101771 1:211934608-211934630 AGCAGGTGCTGGGAATACAGTGG - Intergenic
923461504 1:234213401-234213423 ACAAGGCCCTGGGAGTTCTGGGG + Intronic
924016457 1:239730428-239730450 AGCAGGCTATGGGAATACAGAGG + Intronic
1064012217 10:11743640-11743662 AGCAGGGGCAGGGAATTCCAGGG + Intronic
1073403296 10:103276420-103276442 AGGAGGCGCTGGGAATTGCTGGG - Intergenic
1075044337 10:119134163-119134185 AGCAGGCACTGGGATTACAGGGG + Intronic
1075732642 10:124645477-124645499 AGCAGAGGCTGGGAAGGCTGTGG - Intronic
1076244712 10:128937723-128937745 AGCTGGCCCTGGGATTTCTGAGG + Intergenic
1076628093 10:131834159-131834181 AGCAGGGCCTGGGACTGCTGTGG - Intergenic
1076745126 10:132509134-132509156 GTCAGGCTCTGGGACTTCTGGGG - Intergenic
1076825410 10:132964820-132964842 AGCAGCCGCTGGGCGTCCTGGGG - Intergenic
1079016505 11:16873464-16873486 ACCAGGAGCAGGGAATTCAGAGG - Intronic
1079101807 11:17546760-17546782 AGCTGGTGCTGGGCATTCAGAGG + Intergenic
1080014088 11:27486762-27486784 GTTAGGGGCTGGGAATTCTGTGG - Intergenic
1080853457 11:36091200-36091222 AGAAGCCGATGGGAATTGTGGGG + Intronic
1081763332 11:45592274-45592296 AGCAGGCTCTAGGAAATTTGTGG - Intergenic
1082009081 11:47438255-47438277 AGCAGGGGCTGGGAGTTGAGAGG + Intronic
1082627513 11:55502622-55502644 AGCAGGGGCTGAGAATTTTGAGG + Intergenic
1083118031 11:60483086-60483108 AGCAGGGACTGGGGATGCTGAGG - Intergenic
1084545028 11:69810942-69810964 AGCAGGAGCTGGGAGTTGTCTGG - Intronic
1084937380 11:72594352-72594374 GGCAGCAGCTGGGAAGTCTGGGG + Intronic
1086959590 11:92969078-92969100 AGCACTCGCTGGGTATTGTGGGG - Intergenic
1090629447 11:128633457-128633479 AGCAGGCTCTGGCAAGTCTCTGG + Intergenic
1091385459 12:91907-91929 AGCTGGCTCTGGGAATTCCAAGG - Intronic
1091482841 12:852073-852095 AGCAAGTGCTGGCAATTCTTAGG + Intronic
1091597170 12:1885925-1885947 AGCAGGGGCTTGGAAGTCTCAGG + Intronic
1092020827 12:5200961-5200983 AACAAGCACTGGGGATTCTGAGG - Intergenic
1094239213 12:28201910-28201932 AGCAGGCACTGGGCAGGCTGAGG + Intronic
1094701808 12:32877759-32877781 AGCATGAGCTGGCACTTCTGGGG - Intronic
1095463845 12:42469967-42469989 TGCAGGGGCTGGGAAATCTCAGG + Intronic
1095939374 12:47716188-47716210 AGGAGGCGGTGGGGACTCTGTGG - Intronic
1096611610 12:52805702-52805724 AGCAGGAGCTGGGAAATCTTTGG + Intergenic
1100390083 12:94140348-94140370 AGCAGACGCTGGGCATGCTCTGG + Intergenic
1100794551 12:98166911-98166933 AGCTGGTGCTGAGAATTGTGGGG + Intergenic
1101180702 12:102213796-102213818 ACTAGGCACTGGGAATTCAGGGG + Intergenic
1102072680 12:110034872-110034894 GCCAGGTGCTGGGAATTCTCTGG + Intronic
1103179729 12:118899599-118899621 AGAATGGGCTGTGAATTCTGGGG - Intergenic
1107450306 13:40502545-40502567 AGCAGGCGATTGGAAGTTTGCGG - Intergenic
1111501793 13:89130889-89130911 AACAGATGCTGGGAATGCTGTGG + Intergenic
1113231142 13:108215343-108215365 AGCAGGCGGCGAGAAGTCTGTGG - Intronic
1113450747 13:110407699-110407721 AGGAGGTGCTGGGAATGCAGAGG + Intronic
1113922227 13:113919562-113919584 AGCAGCGGCTGGGAATTCGGAGG - Intergenic
1114400997 14:22410448-22410470 ACAAGGCGCTGGGATATCTGAGG - Intergenic
1115770141 14:36658884-36658906 AGCAGGGGCCGGGGACTCTGGGG - Intronic
1116041391 14:39690453-39690475 ACCAGGCACAGGGAATTCGGGGG + Intergenic
1116171985 14:41414808-41414830 AGCAGTCGTTGGAGATTCTGTGG + Intergenic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117721474 14:58632895-58632917 ACCAGGCACTGGGAATACAGTGG - Intergenic
1118657234 14:67965701-67965723 AGCAAGCTCAGGGAATTATGAGG - Intronic
1119671789 14:76525602-76525624 ATCAGGGGCTGGGAAAGCTGGGG + Intergenic
1121511217 14:94514717-94514739 TGCAGGGCCAGGGAATTCTGAGG + Intronic
1123108429 14:105854053-105854075 AGCAGCTGCAGGGAATTCAGGGG + Intergenic
1124851689 15:33345692-33345714 ATGAGGTGCTGGGAATTCAGTGG - Intronic
1126766724 15:52017872-52017894 TGCAGAAGCTGGAAATTCTGCGG + Intronic
1127707416 15:61561032-61561054 AGCAGGGGCTGGGAAAACTTTGG + Intergenic
1128110173 15:65071344-65071366 AGCAGGGCCTGGGAACTCTGTGG + Intronic
1128643163 15:69354970-69354992 AGAAGGCCCTGAGAACTCTGCGG - Intronic
1130969219 15:88718964-88718986 GCCAGGCGCTGGGATTTCTTTGG - Intergenic
1132065513 15:98727753-98727775 AGCACCCGCTGGGATTCCTGTGG + Intronic
1132459374 16:43050-43072 AGCGGGGGCTGAGAATTTTGAGG + Intergenic
1134049755 16:11129092-11129114 AGCAGGGGCTGGCAAGGCTGGGG - Intronic
1135354500 16:21757978-21758000 AGTAGGGGCTGGGAATACAGAGG + Intronic
1135422698 16:22315576-22315598 AGGTGGTGCTGGGAACTCTGGGG - Intronic
1135452989 16:22574118-22574140 AGTAGGGGCTGGGAATACAGAGG + Intergenic
1136540677 16:30926183-30926205 AGCAGGGGCTGGGCATTCTGCGG - Intronic
1136989000 16:35140609-35140631 AGCAGGCGCTGCCATTTTTGAGG + Intergenic
1137777525 16:51068804-51068826 AGGAGCTGCTGGGAACTCTGAGG - Intergenic
1138330485 16:56211396-56211418 AGGAGGCCCAGGGAGTTCTGGGG - Intronic
1138605319 16:58084932-58084954 AGCAGGCTCTGGGAAGGCGGTGG + Intergenic
1139674455 16:68513687-68513709 AGCAGGTGTTGAGAAGTCTGAGG - Intergenic
1139700526 16:68705315-68705337 AGAAGTGGCTGGGAATGCTGTGG - Intronic
1141441191 16:84030720-84030742 ACCTGGCCCTGTGAATTCTGTGG - Intronic
1141682075 16:85550677-85550699 AGCACGTGCTGGGAAAACTGAGG - Intergenic
1141919787 16:87128029-87128051 AGCAGAGGCTGGGAGTGCTGTGG - Intronic
1143249910 17:5515425-5515447 AGGAGGCGGTGGCAGTTCTGGGG - Intronic
1143394275 17:6579753-6579775 AGCAGCCTCTAAGAATTCTGAGG + Exonic
1144068243 17:11642937-11642959 TGCAGGCGCTAGGGCTTCTGTGG + Intronic
1149302470 17:55317993-55318015 ATCAGGGGCTGGGAATACCGAGG + Intronic
1151275618 17:73031876-73031898 AGTAAGCTCCGGGAATTCTGGGG - Intronic
1151719516 17:75847397-75847419 AGCAGTCTCTGGCCATTCTGAGG + Intronic
1151931888 17:77237662-77237684 AGCCAGCGCTGGGAACTCAGTGG - Intergenic
1161505277 19:4640331-4640353 AGAAGGTGCTGGGAAATGTGAGG - Intronic
1161563077 19:4984486-4984508 AGCAGGCGTGGGGGTTTCTGGGG + Intronic
1162453178 19:10766857-10766879 ATCAGGCCCTGGGGACTCTGAGG - Intronic
1162904753 19:13817099-13817121 AGCAGGTGGTGGGCATTATGGGG + Intronic
1163367497 19:16883875-16883897 AGGAAGCGCTGGGAATCCAGGGG + Intergenic
1163655445 19:18542944-18542966 TGCGGGCGCGGGGAATTATGGGG - Intronic
1164569725 19:29364508-29364530 AGCAGGGGCTTGGAATGCTCAGG - Intergenic
1165230241 19:34382183-34382205 TGCAGGCACTGTGAATGCTGTGG + Intronic
1165553151 19:36605462-36605484 AGCCGGGCCTGGAAATTCTGAGG + Intronic
1165961065 19:39534642-39534664 AGCACACGCTGGGAAGACTGAGG - Intergenic
1165966703 19:39587370-39587392 AGTAGGCTCTGGGGATTCTGTGG - Intergenic
1165972325 19:39642317-39642339 AGCAGGCTCTGGGGATCCTATGG - Intergenic
1166107934 19:40606572-40606594 AGGATGCTCTGGGACTTCTGAGG - Intronic
1166390612 19:42407050-42407072 AGCAGGAGCTGGGAGGTGTGGGG + Intronic
1166517918 19:43461209-43461231 AGCAGAAGCTGGGGATACTGGGG + Exonic
1166748062 19:45151384-45151406 GGCAGGGGCTGGCATTTCTGAGG - Exonic
1167460780 19:49623839-49623861 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167460800 19:49623905-49623927 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167460811 19:49623938-49623960 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167460943 19:49624471-49624493 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167460970 19:49624570-49624592 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167460980 19:49624603-49624625 GGATGGGGCTGGGAATTCTGGGG + Intronic
1167669135 19:50839450-50839472 AGGAGGGGCTGGGGAGTCTGAGG + Intergenic
1168180683 19:54661019-54661041 AGCAGGTGCTTGGAAACCTGAGG + Intronic
927747081 2:25633277-25633299 GGCAGGCGCTGGGCAGGCTGAGG - Intronic
927755496 2:25705198-25705220 GGCAGGCGCTGGGCAGGCTGAGG - Intergenic
931177295 2:59867038-59867060 AGCAGGCGATAGGAATTTTTCGG + Intergenic
933149548 2:78897378-78897400 AGCAAGCGCTGGGATAGCTGAGG + Intergenic
934912272 2:98270088-98270110 AGCAGGCGGTGGGACTCCAGGGG - Intronic
937231495 2:120400659-120400681 AGCGGGAGCTGGGTATTCTGAGG - Intergenic
937521580 2:122719221-122719243 AGCAAGTGCTGGGAATTACGGGG + Intergenic
938121619 2:128638138-128638160 AGCATTCACTGGGAATACTGGGG + Intergenic
940077275 2:149756608-149756630 ATCAGGGGATGGGAATCCTGTGG - Intergenic
941769837 2:169333325-169333347 AACAGGCCCTGGGAATACAGAGG - Intronic
946226415 2:218266286-218266308 AGGAGGCGCTGTGAACTTTGGGG + Intronic
948102573 2:235386585-235386607 AGCATGCCCTTGGAATTCCGTGG - Intergenic
1170762199 20:19261020-19261042 AGGAGGGGCTGGGGCTTCTGAGG - Intronic
1171145425 20:22777270-22777292 AGCAGGGGCTGGGGTTCCTGAGG + Intergenic
1171213273 20:23333603-23333625 AGGAGGCACTGGGAATGCTGAGG - Intergenic
1172881181 20:38200946-38200968 AGCTGGGGTTGGGAAGTCTGTGG - Intergenic
1173671410 20:44801611-44801633 AGACAGCTCTGGGAATTCTGAGG - Intronic
1173766217 20:45611999-45612021 ACCAGGCTCTGGGGATTATGTGG - Intronic
1173784657 20:45783957-45783979 AGCAGGCTCTGGGACATCTGCGG + Intronic
1176004086 20:62850375-62850397 AGCAGGATCTCGGCATTCTGGGG - Intronic
1176055025 20:63140842-63140864 AGCAGCCGGTGGGAACTCAGGGG - Intergenic
1179106063 21:38401802-38401824 AGCAGAGGCTGGGTTTTCTGTGG - Intronic
1179534180 21:42040621-42040643 AGCAGGGGCTAGGGATTCTGTGG + Intergenic
1182399687 22:30066211-30066233 AGCAGGCACTGGGCAGGCTGAGG - Intergenic
1182458624 22:30468907-30468929 AGCAGGCCCTTGGACTTCTTAGG + Intronic
1183624135 22:38991567-38991589 AGGAGGCGCTGCAAATGCTGCGG + Exonic
950515405 3:13461737-13461759 CACCGGCGCTGGGAAGTCTGGGG - Intergenic
950677143 3:14561169-14561191 AGCAGCCCCAGGGAATTGTGAGG + Intergenic
950742248 3:15061329-15061351 CGCAGGCGCTGGGCAGGCTGAGG - Intronic
954387063 3:50249597-50249619 TGCAGGCCCTGGGAAGGCTGGGG - Intronic
955416500 3:58696765-58696787 AGCAGGAGCTGGGAAAAATGAGG + Intergenic
955665364 3:61344215-61344237 GGCAGGGGCTGGGACTTCAGTGG - Intergenic
956528200 3:70187783-70187805 AGCATAGGCTGGGAATTGTGTGG - Intergenic
957071138 3:75568758-75568780 AGCAGGCGCTGGGGGTACTGGGG + Intergenic
959887087 3:111515542-111515564 AGGAGGCAGTGGGAATTCTTTGG - Intronic
961204713 3:125072753-125072775 AGCTGGTGCTGAGAATTCAGGGG + Intergenic
961626851 3:128269961-128269983 AGCAGGGGCTGGGAGTGCAGAGG + Intronic
962659946 3:137591625-137591647 ATCTGGGGATGGGAATTCTGGGG - Intergenic
964402676 3:156315286-156315308 AGCAGGGGTTGGGAGTACTGGGG + Intronic
964571296 3:158110019-158110041 GCCAGGCGCTGGGAATGCCGAGG - Intronic
966698267 3:182815715-182815737 AGAAGGCGCTGTGAACTCTAAGG + Intronic
967423395 3:189298638-189298660 AGCAAGGGTTGGGTATTCTGTGG - Intronic
967954498 3:194867952-194867974 AGCAGGGGCTGGGAAAACTGGGG - Intergenic
968904883 4:3446535-3446557 CGCAGGCGCTGGGTCCTCTGTGG - Intronic
969232473 4:5841279-5841301 AGCCGGCCCTGGGCCTTCTGGGG - Intronic
969457781 4:7309966-7309988 AGCAGGCGCTGGGAAATGGGGGG + Intronic
969535892 4:7755823-7755845 AGGAGGCGCCGGGAAGTCAGCGG - Intergenic
969612408 4:8234762-8234784 AGCAGGTGCTGGGCACTGTGAGG - Intronic
970161439 4:13193293-13193315 ACCAGGAGCTGTGAAGTCTGAGG - Intergenic
971105970 4:23524583-23524605 TCCAGGTGCTGGGAAATCTGAGG + Intergenic
971253965 4:24996927-24996949 AGCAGGTGCTGGAGATTCTGGGG + Intergenic
972678816 4:41286164-41286186 ACCAGGGGCTGGGAATCTTGGGG - Intergenic
980591382 4:134893920-134893942 AGCACAGGCTGAGAATTCTGGGG - Intergenic
983001479 4:162419642-162419664 ACCAGGGGCTCTGAATTCTGAGG - Intergenic
985848965 5:2374655-2374677 AGCAGGCACGGGGCATCCTGAGG + Intergenic
986450388 5:7857666-7857688 AGCAGGCGATGGGAGTGGTGAGG - Intronic
986499879 5:8387644-8387666 AGCAGGATCTGGCCATTCTGAGG + Intergenic
990451284 5:55933633-55933655 AGCGGGCCCGGGGAAGTCTGTGG + Intergenic
992027465 5:72684704-72684726 AGCAGCCACTGGGAATGCTATGG + Intergenic
997891769 5:137683286-137683308 TGCTGGCCCTGGGAATTATGGGG - Intronic
998138501 5:139687133-139687155 GGCAGGCGCTGGGCAGGCTGGGG - Intergenic
998459122 5:142296319-142296341 AGCAGGCAGTGGGGACTCTGGGG + Intergenic
1001193215 5:169649504-169649526 GCCAGGCGCTAGGAATTCAGTGG + Intronic
1001286429 5:170427263-170427285 AGGAGGGGCTGGGAATGCAGGGG - Intronic
1001383147 5:171316923-171316945 AGCAGGCGCTTGGAACTGGGGGG - Intergenic
1002460489 5:179370889-179370911 AGCAGGCACTGGGAAGTCCGGGG - Intergenic
1002469628 5:179427715-179427737 AGCCGGAGCTGGGAGCTCTGGGG - Intergenic
1004150927 6:13119562-13119584 TGCAGGGGCTGGGAGCTCTGGGG - Intronic
1004270565 6:14191706-14191728 AAGAGGCCCTAGGAATTCTGTGG + Intergenic
1006797292 6:36739877-36739899 AGGAGGGGCTGGGTAATCTGTGG - Intergenic
1007726759 6:43921457-43921479 AGCAGGTGATGGGACTTCTGGGG + Intergenic
1007891774 6:45301103-45301125 GGCAGGTCCTGGCAATTCTGTGG + Intronic
1008473951 6:51915976-51915998 AGCAGGCTCAGGGAAGCCTGGGG + Intronic
1008502598 6:52198889-52198911 AGCAGGAGCTGAGAATACAGGGG + Intergenic
1015795152 6:137003955-137003977 AGCAGGCGCTGGGAATTCTGGGG - Intronic
1017558132 6:155595455-155595477 AGCAGGGGGTGGGATCTCTGAGG + Intergenic
1018033950 6:159866320-159866342 AGCAGGCTCTGGTGATACTGTGG - Intergenic
1018387894 6:163321683-163321705 AGCAGGCGCTGGGGAAGTTGAGG - Intergenic
1022307144 7:29157330-29157352 AGCAGGGGCTGGGCATTGAGTGG - Intronic
1024213437 7:47227072-47227094 AGGAGGTGCTGGCTATTCTGTGG - Intergenic
1032279910 7:130491998-130492020 AGCAGGCGGTAGGGGTTCTGCGG + Intronic
1032977543 7:137242712-137242734 AGCAGGGGCTGGGGCTTGTGTGG - Intronic
1033825021 7:145178857-145178879 AGCAGGCCTTGAGAATGCTGGGG - Intergenic
1034860699 7:154592438-154592460 CGCAGGCACAGGGAATACTGTGG + Intronic
1035446545 7:158947056-158947078 AGCAGGCACCTGGAATTCAGCGG - Intronic
1035464363 7:159064984-159065006 AGCAGGCGGTGGGAACTCCGTGG + Intronic
1036784388 8:11676287-11676309 AGCAGGAGCTTGGAATTCTGAGG + Intergenic
1037606624 8:20443270-20443292 CGCAGAGGCTGGGAATTGTGTGG + Intergenic
1037795334 8:21988740-21988762 CCCAGGCCCTTGGAATTCTGGGG - Intronic
1037963101 8:23114600-23114622 GTCAGCCTCTGGGAATTCTGTGG + Intronic
1037968010 8:23148586-23148608 GTCAGCCTCTGGGAATTCTGTGG - Intronic
1038047103 8:23774775-23774797 AGCAGGAGCTGAGAATGCTGAGG - Intergenic
1038962733 8:32539291-32539313 AGCAGGAGCTGGGATGGCTGGGG + Intronic
1040318482 8:46277228-46277250 AGCAGGTGCTGGGTATTCTTAGG - Intergenic
1040404594 8:47087428-47087450 ATCAGGCACTGGAAAATCTGAGG - Intergenic
1040676699 8:49758357-49758379 AACAGGCGTTGGGACTTCTGCGG - Intergenic
1044912272 8:97072882-97072904 TGTAGGCACTGAGAATTCTGAGG - Intronic
1049053549 8:140217622-140217644 GGCAGGCCCCGGGAATTTTGGGG - Intronic
1049936139 9:503884-503906 GGCAGGCGTTGGGTCTTCTGTGG + Intronic
1053346582 9:37382834-37382856 AGGAGGCCCTGGGAAATCTGGGG - Intergenic
1054812150 9:69443418-69443440 AGCAGGCGCTGGCAAGGGTGGGG + Intronic
1056845855 9:90037587-90037609 AGCATGCTCTGAGCATTCTGAGG - Intergenic
1059282063 9:113143478-113143500 AGCAGGCCCTGGAAATTCAGTGG + Intergenic
1060698324 9:125729260-125729282 AGCAGGTCCTGTGGATTCTGGGG - Intergenic
1060964498 9:127705201-127705223 TGCAGGAGCTGGGTCTTCTGAGG - Intronic
1061218314 9:129234827-129234849 AGCAGCAGCTGGGACTTTTGTGG - Intergenic
1061284362 9:129613712-129613734 AGAAGGCGCTGGGGAGCCTGGGG - Intronic
1061291849 9:129654938-129654960 AGAAGGCTCTGGGAAGTCTCAGG + Intergenic
1061719635 9:132543599-132543621 ATCCTGCGCTGGGAATTTTGGGG + Intronic
1061763544 9:132867529-132867551 AGCCTGGGTTGGGAATTCTGTGG - Intronic
1187490595 X:19747895-19747917 AGCAGGTGCTGGGGCTGCTGAGG - Intronic
1188694514 X:33174059-33174081 TGCAGGGTCTGGGGATTCTGGGG - Intronic
1192175280 X:68881208-68881230 AGCAGGAGATGGGAAGGCTGGGG + Intergenic
1196668251 X:118338685-118338707 ACCAGGGGCTGGGAATCCTGGGG + Intergenic
1198047140 X:132913989-132914011 AGCAGGCAGTGGGAAGCCTGAGG - Intronic
1198052136 X:132959935-132959957 AGCCAGGGCTGGGAATTCTAGGG - Intronic
1200073397 X:153539744-153539766 AGCCGGGGCTGAGAATCCTGGGG + Intronic
1200906125 Y:8484695-8484717 AGCAAGCCCAGGGAAGTCTGAGG - Intergenic