ID: 1015798817

View in Genome Browser
Species Human (GRCh38)
Location 6:137040404-137040426
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 944
Summary {0: 2, 1: 18, 2: 102, 3: 271, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015798817_1015798824 28 Left 1015798817 6:137040404-137040426 CCAGATTTTGGTTTCTAAACACC 0: 2
1: 18
2: 102
3: 271
4: 551
Right 1015798824 6:137040455-137040477 CTGAGGAAGTCATTAATTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 167
1015798817_1015798818 -7 Left 1015798817 6:137040404-137040426 CCAGATTTTGGTTTCTAAACACC 0: 2
1: 18
2: 102
3: 271
4: 551
Right 1015798818 6:137040420-137040442 AAACACCTTTCTCCAATAGAAGG No data
1015798817_1015798821 11 Left 1015798817 6:137040404-137040426 CCAGATTTTGGTTTCTAAACACC 0: 2
1: 18
2: 102
3: 271
4: 551
Right 1015798821 6:137040438-137040460 GAAGGAACCAGAGCTTCCTGAGG 0: 1
1: 0
2: 6
3: 35
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015798817 Original CRISPR GGTGTTTAGAAACCAAAATC TGG (reversed) Intronic
900924584 1:5696126-5696148 GGTATTTGGAAACCAAGGTCCGG - Intergenic
901214353 1:7547258-7547280 GGTGTTTAGAAGCCAAGATCTGG + Intronic
901244984 1:7723113-7723135 GGTATTTAGAAATGAACATCTGG - Intronic
901286773 1:8086329-8086351 GATGTTTAGAAACCAAGATCTGG + Intergenic
901291067 1:8124949-8124971 GGTGTTTAGAAACCAAGATCTGG + Intergenic
901346548 1:8549161-8549183 AGTGTTTAGAAACCAAGATCTGG - Intronic
903689338 1:25160268-25160290 TGTATTTAGAAACCAAGATCTGG - Intergenic
904867833 1:33595827-33595849 GTTATTTAGGAACCAATATCTGG + Intronic
904984192 1:34531166-34531188 GTTGTTTAGAGACCAAGATTGGG + Intergenic
905499088 1:38421855-38421877 GATACTTAGAAACCAAGATCTGG - Intergenic
905932088 1:41795966-41795988 GGTCTTTAGAGACTAAGATCTGG + Intronic
905995733 1:42379894-42379916 GTTATTTAGAAAGGAAAATCTGG + Intergenic
906032113 1:42729858-42729880 GGTATTTAGAAACCAAGATATGG + Intergenic
906514832 1:46432786-46432808 GGGGTTTGGAACCCAAATTCTGG - Intergenic
906758655 1:48348629-48348651 GTCTTTTAGAAACCAAGATCTGG + Intronic
907031574 1:51177459-51177481 AGTTTTTAGACACCAAGATCTGG - Intergenic
907071279 1:51537431-51537453 GGTATTTAGAAACCAAGATTTGG + Intergenic
907157578 1:52348575-52348597 TGGTATTAGAAACCAAAATCTGG + Intronic
907361584 1:53920572-53920594 GGTATTTAGAGATCACAATCTGG + Intronic
908005455 1:59723124-59723146 GGTGGTTAGACACCAAGATTTGG + Intronic
908049595 1:60214284-60214306 GATGTTTACAAACCCAAATGAGG + Intergenic
908303730 1:62789510-62789532 GATTCTTAGAAACCAAGATCTGG + Intronic
908373895 1:63513526-63513548 GGTATTTAGACACCAAAATCTGG + Intronic
908399570 1:63758315-63758337 CATGTTTGGAAACCAAATTCTGG - Intergenic
908979756 1:69941502-69941524 GGTGGTAAGAAACCAATTTCTGG + Intronic
909434391 1:75623945-75623967 GGTATTTAGAAACCAAGATGTGG - Intergenic
909722435 1:78791293-78791315 GTTGAGTTGAAACCAAAATCTGG + Intergenic
909906075 1:81196710-81196732 GGTGTTTTGAAACAAAGATTAGG + Intergenic
909953660 1:81750946-81750968 GTTATTGAGAAACCAAGATCTGG - Intronic
910282328 1:85514924-85514946 GATGAGTAGAAACCAAGATCTGG + Intronic
910400353 1:86831943-86831965 GGGGTTTGCAAACCAACATCTGG - Intergenic
910507795 1:87969857-87969879 GGAGTTTACAAATAAAAATCAGG + Intergenic
910909721 1:92220207-92220229 GCTATTTAGAAACCAAAATCTGG + Intronic
911791530 1:102021634-102021656 GGAGCTTAGAAACCAAAATGAGG + Intergenic
912147702 1:106814354-106814376 GGTATGTAGAAATCAAGATCTGG - Intergenic
912418061 1:109524248-109524270 AGCATTTAGAAGCCAAAATCTGG - Intergenic
912941272 1:114047339-114047361 GGTATTTAGAAGCCACAATCTGG + Intergenic
913208797 1:116566487-116566509 GGTATTTAGAAATCAAGTTCTGG - Intronic
913476257 1:119241292-119241314 GTTGCTTAGAAATCAAGATCTGG - Intergenic
913714983 1:121524395-121524417 GGTATTTAGAATCCAAGATCTGG - Intergenic
913969163 1:143401371-143401393 GGTATTTATAAACCACAATCTGG + Intergenic
914063540 1:144226970-144226992 GGTATTTATAAACCACAATCTGG + Intergenic
914115610 1:144739384-144739406 GGTATTTATAAACCACAATCTGG - Intergenic
914207760 1:145548968-145548990 GATGAGTAGAAACCAAGATCTGG - Intergenic
915155167 1:153869661-153869683 GGTGTTGCGAAACCAAGATCTGG + Intronic
915190414 1:154145902-154145924 TATATTTAGAAACCAAGATCTGG - Intronic
915844995 1:159253450-159253472 TCTGTTAAGAAACCAAAATTTGG + Intergenic
916149792 1:161775788-161775810 GGTATTTAGTATCCAAGATCTGG + Intronic
916253620 1:162763672-162763694 GGTATTTAGAAAACACAAACTGG + Intronic
916257044 1:162799460-162799482 GGTTATTAGAAACCAAGATCTGG + Intronic
916511820 1:165478934-165478956 AATAATTAGAAACCAAAATCTGG + Intergenic
916527400 1:165624210-165624232 AGTATTTAGAAACCAAGATCTGG + Intergenic
916738048 1:167625681-167625703 AGTAGTTAGAAACCAAGATCTGG + Intergenic
916901011 1:169223704-169223726 GGTATTTAGAAGTCAAGATCTGG + Intronic
918000043 1:180485199-180485221 AGTATTTAGAAACCAAGGTCTGG - Intronic
919717485 1:200794447-200794469 GTTATTTAGAAACCATGATCTGG + Intronic
920783456 1:209017261-209017283 GGTGTTTAGAAACCAAAATCTGG + Intergenic
920861853 1:209715380-209715402 GATATTTAGAAAACAAGATCTGG - Intronic
921215318 1:212931833-212931855 GGTATTTAAAAACCAAAGTATGG + Intergenic
921667634 1:217891727-217891749 GGTATTTAGAAATCAAGATCTGG - Intergenic
921860969 1:220041865-220041887 GGTGTTTATAAACCAGTATCTGG - Intronic
921940763 1:220836870-220836892 GGTATTTAGAAACCAGGATCTGG - Intergenic
922231803 1:223693678-223693700 AGTATTTAGAAACCAAGATCTGG - Intergenic
923007322 1:230061057-230061079 GGTATTTAGAAACCAAGATCTGG + Intronic
923588483 1:235296943-235296965 GGTTTTTAGAGATCACAATCAGG - Intronic
924151368 1:241133721-241133743 GGTATTTAGAAACCAGGATCAGG - Intronic
924406797 1:243756275-243756297 GATATTTAGAACCCTAAATCTGG - Intronic
924790683 1:247244914-247244936 GGTATTTAGAAATCAAAATCTGG - Intergenic
1063104144 10:2977966-2977988 GGTGTTTAAGGACCAAAACCAGG + Intergenic
1063350710 10:5352245-5352267 GGTCTTTGGAAACCAAAGCCAGG - Intergenic
1064169014 10:13013205-13013227 GATATTTAGAAACCAAAATCTGG - Intronic
1064376772 10:14803519-14803541 GGTGTTTAGAAACCAATATTAGG - Intergenic
1064555529 10:16543496-16543518 GGTGTGAAGAAAACAAAAGCAGG + Intergenic
1065774102 10:29103256-29103278 GGTTTATAGAAACCAGAAGCCGG - Intergenic
1066013251 10:31213588-31213610 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1066698828 10:38104675-38104697 GGAATTTAAAAACCAAGATCTGG + Intronic
1066723503 10:38365152-38365174 GGTTATTAGAAACCAAGATCTGG + Intergenic
1066993823 10:42543552-42543574 GGAATTTAAAAACCAAGATCTGG - Intergenic
1067360980 10:45578159-45578181 GGTATTTGGAAATCAAGATCTGG - Intronic
1067510287 10:46889080-46889102 TGTGTTCAGAAAACAAAAGCTGG - Intergenic
1067534310 10:47097430-47097452 GGTATTTGGAAACCAAGATTTGG - Intergenic
1067651968 10:48162777-48162799 TGTGTTCAGAAAACAAAAGCTGG + Intronic
1067784430 10:49233691-49233713 GGTTTTTAGAAACGAAGATCTGG - Intergenic
1068089529 10:52415799-52415821 GGTATTTAGAAATCAAGATCTGG + Intergenic
1068095076 10:52481187-52481209 GGTATTTGGAAACCAAGATCTGG + Intergenic
1068653268 10:59547406-59547428 GATATTTAGAAACCAAGATCTGG - Intergenic
1068850232 10:61730137-61730159 GGTATTTAGAAACCAAGAGCTGG - Intronic
1068896399 10:62208298-62208320 AGTATTTAGAGACCATAATCTGG - Intronic
1069132501 10:64724124-64724146 GATGTTTAGAAACCAACATTTGG + Intergenic
1069392459 10:67950872-67950894 GGTATTTAGAAATCAAGCTCTGG - Intronic
1069677995 10:70262860-70262882 AGTATTTAGAAGCCAAGATCTGG - Intronic
1070651684 10:78241895-78241917 GGTATTTAGAAGACAAGATCTGG + Intergenic
1070703725 10:78622174-78622196 TATGTCTAGAAACCAAAATTAGG - Intergenic
1070869273 10:79735266-79735288 GGTATTTAGAAACCAAGATCTGG + Intergenic
1070911316 10:80120991-80121013 GGTATTTAGAAACTAAGATCTGG - Intergenic
1071315801 10:84395886-84395908 GAGATTTAGAAACCAAGATCTGG + Intronic
1071439739 10:85679774-85679796 AGTATTTAAAAACCAACATCAGG + Intronic
1071453096 10:85818481-85818503 GGTATTTAGAAACTAAAATATGG - Intronic
1071636192 10:87257453-87257475 GGTATTTAGAAACCAAGATCTGG + Intergenic
1071659049 10:87480490-87480512 GGTATTTAGAAACCAAGATCTGG - Intergenic
1071753208 10:88505088-88505110 GTTATTTAGAAGCCAATATCTGG - Intronic
1072288097 10:93936253-93936275 GAAATTTAGAAACCAAGATCTGG - Intronic
1072793279 10:98334955-98334977 GGTGTTTAGAAACCAAACACTGG + Intergenic
1072863771 10:99035899-99035921 GGTGTTTAGAGACCACTATCTGG - Intronic
1073523589 10:104157849-104157871 GGTATTTAGAGACCAAGATCTGG - Intronic
1073716182 10:106110005-106110027 GGCTTTTAGAAACCAAAGCCAGG + Intergenic
1073847970 10:107580788-107580810 GATATTTAGAAATCAAGATCTGG + Intergenic
1074117197 10:110465342-110465364 GCTGTTTTGAAACCAACATCAGG + Intergenic
1074198831 10:111213563-111213585 GGTAATTAGAAACCAAGTTCTGG + Intergenic
1074203782 10:111262900-111262922 AGTACTTAGAATCCAAAATCTGG + Intergenic
1074261583 10:111859005-111859027 TGGTATTAGAAACCAAAATCTGG + Intergenic
1074326183 10:112453800-112453822 GGGTATTAGAAACCAAGATCTGG + Intronic
1074485201 10:113870030-113870052 GGTATTGAGAAACCAAGGTCTGG + Intronic
1074694903 10:116041591-116041613 GGTATTTCAAAACCAAAGTCTGG + Intergenic
1074775452 10:116765210-116765232 GGTATTTAGAAACCAAAACCTGG - Intergenic
1074802641 10:117016975-117016997 GGTATTCAGAAACCAAGATCTGG - Intronic
1074879100 10:117638435-117638457 GCTATTTAGAAACCATGATCTGG + Intergenic
1074961795 10:118453073-118453095 AGTATTTAGAGACCACAATCTGG - Intergenic
1075308144 10:121386267-121386289 GATGTTTAGAAACCAATATCTGG - Intergenic
1075883436 10:125875266-125875288 TGTGTTTTGAAACCAAGATCTGG - Intronic
1075932012 10:126306581-126306603 GATATTTAAAAACCAAAAGCAGG - Intronic
1075977192 10:126706261-126706283 TGGGTTTAGAAACCAGAACCTGG + Intergenic
1076045291 10:127288374-127288396 GGTATTTAGAAATCATAATCTGG + Intronic
1076073889 10:127516767-127516789 GGTATTTAGAAACCAAGGTCTGG - Intergenic
1076155227 10:128199446-128199468 GGTAATTAGAAATCAAGATCTGG + Intergenic
1076201485 10:128562315-128562337 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1076286466 10:129302480-129302502 GATATTTAGAAACCAAGATCTGG - Intergenic
1076310018 10:129498798-129498820 GATGTTTAGCAGCCAAGATCTGG + Intronic
1077149281 11:1062033-1062055 GGTATTTAGAAACCAAGATCTGG + Intergenic
1077677684 11:4211281-4211303 GGGGCATAAAAACCAAAATCAGG + Intergenic
1078189801 11:9084029-9084051 GGTCTATAGAAACCAAGATCTGG - Intronic
1078285377 11:9948593-9948615 CATATTTAGAAACCAAGATCTGG + Intronic
1078435273 11:11319924-11319946 AGCGTTTAGAGAACAAAATCTGG - Intronic
1078632765 11:13018542-13018564 GATATTTAGAAGCCACAATCTGG + Intergenic
1079754873 11:24244720-24244742 GGTATTTAGAAATTAACATCTGG + Intergenic
1080320038 11:30997849-30997871 GCTATTTAGAAACCAAGGTCTGG - Intronic
1080435251 11:32234650-32234672 GGTATTTAAAAATTAAAATCTGG - Intergenic
1080467993 11:32516237-32516259 GGTGTTTAGAAGCTGAGATCCGG - Intergenic
1080851703 11:36076062-36076084 GGTATTTAGAAACCAAGATCTGG + Intronic
1081051515 11:38347977-38347999 GGTGGTGAGAAACAAAAATTTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081926673 11:46835342-46835364 GGTATTTAGAAACCGAGATCTGG - Intronic
1082912996 11:58397764-58397786 GGTGTTTACAAGCCAACATCTGG - Intergenic
1082947126 11:58772404-58772426 GGTGTATATTAACCAAGATCAGG + Intergenic
1083241926 11:61394963-61394985 AATGTTTAAAAAACAAAATCTGG - Intronic
1083985668 11:66213478-66213500 GGTGTTCAGAAACCAAGATCTGG + Intronic
1084575279 11:69985068-69985090 GGGGTTTAGAAACCAAGGTCTGG - Intergenic
1084845959 11:71900029-71900051 GGTGGAGAGAAACCTAAATCTGG + Intronic
1085116170 11:73934120-73934142 GGTATTCAGAAACCAAGATCCGG + Intergenic
1085161371 11:74349606-74349628 GGTATTTAGAAACCACAGTCTGG + Intronic
1085352493 11:75808532-75808554 GGTATCTACAAACCAAGATCTGG + Intergenic
1085424900 11:76395639-76395661 GGTGTTTAGAAAGCAAGATATGG + Intronic
1085433399 11:76476808-76476830 GGTGTTTAGATACCACAATCTGG + Intronic
1085495057 11:76961483-76961505 GATTTTTAGAAAACAAGATCTGG - Intronic
1085556686 11:77429024-77429046 GGCATTTAGAATCCAAAATCTGG - Intronic
1085585145 11:77695710-77695732 GGTACTTAGAAACCAAGATCTGG + Intronic
1085676488 11:78524759-78524781 GGTATTTAGAAGCCAAAATTGGG - Intronic
1086237669 11:84651589-84651611 GGTTGTTGGAATCCAAAATCAGG + Intronic
1086525263 11:87717799-87717821 GATATTTAGAAATCAAAATCTGG - Intergenic
1086549300 11:88036305-88036327 GATGTTTAGAAGCCAAGATCTGG + Intergenic
1086978388 11:93164097-93164119 GGTATTTGGAAATCAAGATCTGG + Intronic
1087112320 11:94483990-94484012 GGTATTTGGAAACCAAGATCTGG - Intronic
1087421653 11:97934528-97934550 AATATTTAGAAACCAAGATCAGG - Intergenic
1087750645 11:102003258-102003280 GGTATTTAGAAACCAAGATCTGG - Intergenic
1087938954 11:104070207-104070229 GGTATTTAGAACCCACAACCTGG + Intronic
1088124387 11:106405758-106405780 AATATTTAGAAACCACAATCTGG + Intergenic
1088596186 11:111442119-111442141 TGTTATTAGAAACCAAAGTCTGG - Intronic
1088786137 11:113183270-113183292 GGACGTTAGAAACCAGAATCCGG + Intronic
1089481440 11:118808418-118808440 GGTATTTAGAGACCAAGATTTGG - Intergenic
1090478218 11:127043957-127043979 GGTATTTAGGAACTAAGATCTGG - Intergenic
1090730525 11:129569819-129569841 GGTATTTAGTCACCAAGATCTGG - Intergenic
1090795469 11:130131941-130131963 GGTGTTTAGATAACAGAATAGGG - Intronic
1090805919 11:130202050-130202072 GGTATTTAGAGACCAAGGTCCGG + Intronic
1091365736 11:135018817-135018839 GGTATTCAGAAACCAAGATCTGG - Intergenic
1092775363 12:11940724-11940746 GATGTTTAGAAACCAACATCTGG - Intergenic
1092945130 12:13446765-13446787 GGTATTTAGAAATTATAATCTGG + Intergenic
1093060738 12:14600312-14600334 GGTATTTAGAAACCGCAATCTGG + Intergenic
1093181865 12:15975912-15975934 TGTATTTAGAAACCAAGATCTGG + Intronic
1093466006 12:19450093-19450115 GCAGTTTTGAAAGCAAAATCAGG + Intronic
1093650596 12:21640686-21640708 GGTAGTTAGAAACCAGGATCAGG - Intronic
1093741643 12:22695215-22695237 GGTATTTAGAAACCAAGACTGGG + Intergenic
1093800749 12:23369386-23369408 GCTATTTAGAAGCCAAGATCTGG - Intergenic
1094191139 12:27699701-27699723 GGTTTTTAGATAGGAAAATCAGG - Intergenic
1094194221 12:27729307-27729329 GGTGTTTACAGACCATGATCTGG + Intronic
1095391598 12:41713583-41713605 GGTATTTAGAAACCGAAATGTGG + Intergenic
1095395241 12:41755794-41755816 TGTGTTTAGAAACCAATATCTGG + Intergenic
1095701802 12:45198258-45198280 GGTATTTAGGAACCAAGATCTGG + Intergenic
1095773178 12:45985102-45985124 GGTATTTAGAAAACAAGATTTGG + Intronic
1096150936 12:49312154-49312176 GTTATTTAGAAACCAAAATCTGG - Intergenic
1096735998 12:53655057-53655079 GGTATTTGGAAACCAATACCAGG + Intronic
1097215200 12:57405796-57405818 GATGTTTAGAGATCACAATCTGG - Intronic
1097481783 12:60136095-60136117 AGTGCTTAGAAACCCAAATGTGG + Intergenic
1097704212 12:62851113-62851135 AGTATTTGGAAACCAAAGTCTGG - Intronic
1097707871 12:62886894-62886916 GGCATTTAGAAAGCAAAACCCGG + Intronic
1097895684 12:64822945-64822967 GGTTTTTAGAGACCATAACCTGG + Intronic
1098399915 12:70064012-70064034 GGTATTTAGAAATCAATATCTGG + Intergenic
1098700940 12:73625019-73625041 GGTGTTAAGAAACCAAGATGGGG - Intergenic
1098761683 12:74433314-74433336 TATGTTTAGAACTCAAAATCCGG + Intergenic
1099028006 12:77490369-77490391 GATGTTTAGAAAAAAAAATTAGG + Intergenic
1099851608 12:88105062-88105084 GGCATTTAGATACCAAAAACTGG - Intronic
1099971933 12:89509475-89509497 GGTATTTAGAAACCAATATCTGG + Intronic
1100273868 12:93052818-93052840 GCTGTTTAGAAACCAAGATTTGG + Intergenic
1100323268 12:93517271-93517293 GGTATCTAGAAACCAAGATCTGG + Intergenic
1100512515 12:95290669-95290691 GGCATTTAGAAACCAAGATTAGG + Intronic
1101687661 12:107041852-107041874 GATATTTAAAAACCAAAATCTGG - Intronic
1102208853 12:111109621-111109643 GGTATTTAGAGACCACAGTCTGG + Intronic
1102384321 12:112494650-112494672 AGTATTTTGAAACCAAGATCTGG + Intronic
1102580643 12:113884618-113884640 GGTACTTAGAAGCCAAGATCTGG - Intronic
1102944586 12:116974794-116974816 AACATTTAGAAACCAAAATCTGG - Intronic
1103291685 12:119851399-119851421 GGTGTTTAGAGGCCAAGATCTGG - Intronic
1104393531 12:128411661-128411683 GGTATTTAGAAACCAATATCTGG + Intronic
1104595245 12:130116066-130116088 TCTGTTTAGAAAACAAAATATGG + Intergenic
1104668459 12:130664565-130664587 GATATTTAGAAATCAAGATCTGG - Intronic
1105537597 13:21283099-21283121 GGTATTTAGAAACCAAATTCTGG + Intergenic
1105759414 13:23499805-23499827 GGTATGTAGAAACCAAGATCTGG - Intergenic
1106151459 13:27107636-27107658 GGTGTTTAGAGAACACAATCTGG - Intronic
1106506856 13:30378062-30378084 AGGGTTTTGAAACCAAAATCTGG + Intergenic
1106969063 13:35114093-35114115 GGTTTTTAGAAACCAAGATGTGG + Intronic
1107206962 13:37803286-37803308 GGTGTTTAGGAATCAATATCTGG + Intronic
1107697006 13:43010216-43010238 GGTATTTAGAAACCAAGATTTGG + Intergenic
1107866427 13:44707713-44707735 GGTATTTAGAAACCAAGATCTGG + Intergenic
1107915446 13:45145420-45145442 GATATTTAGAAACTAAGATCTGG + Intronic
1108032614 13:46251545-46251567 AGTGTTTAAAAGCCAAGATCTGG + Intronic
1108250931 13:48567160-48567182 GATATTTAGAAACCAAAATCTGG + Intergenic
1108615862 13:52131443-52131465 CTGGTTTAGAAACCAAGATCTGG - Intergenic
1109207932 13:59502067-59502089 AGTGTTTAGAAACCAAGATCTGG + Intergenic
1109462479 13:62679758-62679780 AGTGGTTACAAAACAAAATCTGG - Intergenic
1109646009 13:65257594-65257616 GCTGTTTACATACTAAAATCAGG - Intergenic
1110120956 13:71881170-71881192 GTTGTTTAGAACCCAAACTGAGG - Intergenic
1110366031 13:74686741-74686763 TGGTATTAGAAACCAAAATCTGG - Intergenic
1110432022 13:75435665-75435687 GGTATTTAGAAACCCACACCAGG - Intronic
1111894796 13:94127902-94127924 GGTGTCTAGAAAGCCAAATTAGG + Intronic
1111930341 13:94506242-94506264 GGTATTTAGAAACGAAGAGCTGG - Intergenic
1111938588 13:94584619-94584641 GGTGTTTAGAGGCCACAGTCTGG - Intronic
1112567977 13:100567547-100567569 GGTATTTAGATGCCAAGATCTGG + Intronic
1112777818 13:102864708-102864730 GGGGTTTAGACACCACAAGCTGG + Intronic
1113219397 13:108082310-108082332 GATATTTAGAAACCAAGAACTGG - Intergenic
1113583574 13:111447561-111447583 GTGGTTTAGAGACTAAAATCAGG - Intergenic
1113601294 13:111570186-111570208 GGTAGTTAGAAATCATAATCGGG + Intergenic
1114041946 14:18686984-18687006 TGTATTTAGAAACTAAGATCTGG - Intergenic
1114169282 14:20255508-20255530 GGTATTTTAAAACCAAGATCTGG - Intergenic
1114440529 14:22743035-22743057 GGTATTTAGAAACCAAGATCTGG - Intergenic
1114504524 14:23199059-23199081 AGTATTTTGAAACCAAAATCTGG - Intronic
1114667102 14:24384980-24385002 ATTATTTAGAAACCAAGATCTGG - Intergenic
1114928188 14:27431857-27431879 GCTATTTAGAAATCAAGATCTGG - Intergenic
1115199409 14:30836734-30836756 GATGTTTAGAAACCATAACCTGG - Intergenic
1115485317 14:33905061-33905083 GGTATTCAGAAACTGAAATCTGG - Intergenic
1115503743 14:34073867-34073889 GGTATTTAGAAACCAAGATTAGG - Intronic
1115512278 14:34149583-34149605 GGTATTTAGAAACCAAGCTCTGG - Intronic
1115844902 14:37518711-37518733 GGTACTTAGAAACTAAAATCTGG - Intronic
1116224913 14:42137886-42137908 TGGTATTAGAAACCAAAATCTGG + Intergenic
1116313842 14:43360792-43360814 AATATTTAGAAACCAAGATCTGG + Intergenic
1116909225 14:50440829-50440851 AATATTTAGAAACCAAGATCTGG - Intronic
1116919465 14:50557793-50557815 GGTGTTTAGAAACCAAGACGTGG - Intronic
1116936946 14:50750244-50750266 GGTGCTTAGTAACCAAGATCTGG + Intronic
1117373475 14:55099929-55099951 GATATTTAGAAACCAAGACCTGG - Intergenic
1117839907 14:59849386-59849408 AGTGTTTAGATAGCAATATCAGG - Intronic
1118168854 14:63365143-63365165 GGTATTTAGAAACCAAGATCTGG - Intergenic
1119065691 14:71524004-71524026 GGTGTTTAGAAACCACCGTCTGG + Intronic
1119754845 14:77109064-77109086 GGCATTTAGAAACCAAGATCTGG + Intronic
1119794612 14:77384717-77384739 GGTATTTAGAAACCAAGACGTGG + Intronic
1119815659 14:77564558-77564580 GATATTTAGAAACCAAGGTCTGG - Intronic
1120322006 14:82975511-82975533 AGCATTTAGAAAACAAAATCTGG - Intergenic
1120699524 14:87683507-87683529 GGTATTTAGAGACCATAATCTGG - Intergenic
1121344924 14:93128677-93128699 GTTCTTTAGAAACCAGATTCAGG - Intergenic
1121351025 14:93173172-93173194 GTTGCTTAGAAACCAGAAGCTGG + Intergenic
1121391503 14:93579789-93579811 GGTATTTAGAAACCAAGATCTGG + Intronic
1122256724 14:100483558-100483580 GGAGTCTAAAAACCAAAAACAGG - Intronic
1123462367 15:20485019-20485041 GGTTCTAAGAGACCAAAATCTGG - Intergenic
1123483896 15:20666310-20666332 GGTTTTTAGAAACCAAGATCTGG - Intergenic
1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG + Intergenic
1123979972 15:25592679-25592701 GGCATTTAGAGACCACAATCTGG + Intergenic
1124104795 15:26727620-26727642 GGATATTAGAAACCAAGATCAGG + Intronic
1124227966 15:27912283-27912305 GGTGTTTAGAAATCAAAATCTGG - Intronic
1124273056 15:28301001-28301023 GGTTCTGAGAGACCAAAATCTGG - Intronic
1124309602 15:28610579-28610601 GGTTCTGAGAGACCAAAATCTGG + Intergenic
1124342157 15:28896593-28896615 GATGTAGAGAAACCAAACTCTGG + Intronic
1124350421 15:28951446-28951468 GGTATCTAGAAACCAAGGTCTGG + Intronic
1125114340 15:36071798-36071820 GATACTTAGAAACCAAAATCTGG - Intergenic
1125225707 15:37393364-37393386 AATGTTTAGAAACCAAGATCTGG + Intergenic
1125246043 15:37641413-37641435 GGTATGTAGAAACCAAGATTTGG - Intergenic
1125820044 15:42621825-42621847 GATATTTAGAAACCAAGTTCTGG + Intronic
1126028019 15:44467177-44467199 AGTATTTAGAAACCAAGATCTGG - Intronic
1126613320 15:50551474-50551496 GGTATTTAGAAACCAAGATCTGG + Intergenic
1126763878 15:51994258-51994280 GGTATTTAGAAACCAAGAGCTGG - Intronic
1127031669 15:54871395-54871417 GGTATTTATAACCCAAGATCTGG - Intergenic
1127265514 15:57357970-57357992 TTTATTTAGAAACAAAAATCTGG - Intergenic
1127322496 15:57860899-57860921 GGTATTTAGAAACCAAGATCTGG + Intergenic
1127561507 15:60141687-60141709 GATATTTAGAAACCACAATTCGG + Intergenic
1127590225 15:60415248-60415270 GGGATATAGAAACCAAGATCTGG + Intergenic
1127693839 15:61424437-61424459 GGCATTCAGAAACCAAGATCCGG + Intergenic
1127993868 15:64140892-64140914 GTTATTTAGAAACCAAGATCTGG + Intronic
1128394168 15:67206879-67206901 GGTATTTAGAAAGCAAGATCTGG + Intronic
1128585520 15:68846284-68846306 GCTGTTTAGAAGCCAAGATCTGG - Intronic
1128626647 15:69214145-69214167 AGTATTTAGAAACCAGCATCTGG + Intronic
1128733710 15:70037940-70037962 GGTATTTGGAGACCATAATCTGG - Intergenic
1128892888 15:71346649-71346671 AGTATTTACAAGCCAAAATCTGG + Intronic
1129793387 15:78357637-78357659 GGCATTTAGAAACCACAATCTGG + Intergenic
1129809089 15:78492258-78492280 AGTATTTAGAAATCATAATCTGG - Intronic
1130365251 15:83232188-83232210 GGTATATAGAGACCACAATCTGG + Intergenic
1130732610 15:86514027-86514049 GGTATTTAGAAACTGATATCTGG + Intronic
1130971174 15:88734151-88734173 AGTGTTTAGAAACCACCATTTGG + Intergenic
1132009274 15:98260785-98260807 GGTATTTAGAGACCATAATCTGG - Intergenic
1132158715 15:99516398-99516420 GGTGTTTAGAGAGCAGAGTCAGG + Intergenic
1132329978 15:101005582-101005604 GGTATTTAGAAACCAAGATCTGG - Intronic
1132632163 16:923429-923451 GGTGTTTAGAGACCAAGACGTGG - Intronic
1132781906 16:1631484-1631506 GGTATTTAGAAACCAAGACCTGG + Intronic
1133133937 16:3696186-3696208 GGTATTCACAAACCAAGATCTGG - Intronic
1133501496 16:6371666-6371688 GGTGTTTAGAAACAAAGTTCTGG + Intronic
1133504807 16:6401041-6401063 GATATTTAGAAACCAAGATCTGG - Intronic
1133863915 16:9623818-9623840 GATATTTAGAAATCAATATCTGG - Intergenic
1134445551 16:14328544-14328566 GGCGTTTAGACACCATAACCTGG - Intergenic
1134454537 16:14384966-14384988 GGTGTTTAGAATCCCAGACCTGG - Intergenic
1134478402 16:14596131-14596153 GATGTTTAGAAACCAAGATCTGG - Intronic
1134845659 16:17437758-17437780 AGTGTTTAGGAACACAAATCTGG + Intronic
1134881779 16:17751084-17751106 GGCATTTTTAAACCAAAATCTGG + Intergenic
1135545322 16:23362041-23362063 GGTATTTAGAAACCAAGATCTGG + Intronic
1135885610 16:26303641-26303663 GGTATTTAGAAACCAAGGTCTGG + Intergenic
1136066772 16:27764551-27764573 GGTATTTAGAGACCATAATCTGG + Intronic
1137897619 16:52231159-52231181 GGTATTTAGAAACCAAGGTCTGG - Intergenic
1138620904 16:58210379-58210401 AGTGTTTAGAAGCCAACATCAGG + Intergenic
1138653689 16:58477277-58477299 GACGTTTAGAAATCAAGATCTGG - Intronic
1139075061 16:63435727-63435749 GGTATTTAGAAGCCATGATCTGG + Intergenic
1139406172 16:66719756-66719778 GGTTTTTGGAAACCAAGATCTGG - Intergenic
1139675902 16:68523394-68523416 TGTGTTTAGAAACAAAAAAGTGG - Intergenic
1140023001 16:71256946-71256968 AGTATTTAGAAACCAAGATCAGG - Intergenic
1140247037 16:73260619-73260641 AGTATTTAGAAACCAAGATCCGG + Intergenic
1141039358 16:80658752-80658774 GTTATTTAGAAACCAACATGTGG - Intronic
1141074355 16:80989606-80989628 GGTATTTAAAAAACAAAATCTGG + Intronic
1141694970 16:85614812-85614834 GGGGTTTGGAAACAAAAAGCGGG + Intronic
1141890115 16:86920603-86920625 GGTATTTAGAAGGAAAAATCTGG + Intergenic
1142216510 16:88832562-88832584 ATGGTTCAGAAACCAAAATCCGG - Intronic
1142569188 17:861502-861524 GGTCCTTAGAAACCAACATCTGG - Intronic
1143245101 17:5477924-5477946 GGTATTTAGAAGCCAAGATCTGG - Intronic
1143394548 17:6581969-6581991 GGTATTTAGAAACCAAGATGTGG + Intronic
1143630264 17:8135318-8135340 GGCATTTAGTAACCAAGATCTGG + Intergenic
1143737002 17:8918200-8918222 GGTATTTAGAAACCAAGATCTGG - Intronic
1143743470 17:8972164-8972186 GATATTTAGAAACCAAGATCTGG - Intergenic
1143797988 17:9353371-9353393 AGTATTTAGAAACCAAGAACTGG + Intronic
1144227703 17:13166718-13166740 GCTATTTAGAAAGCAAATTCTGG + Intergenic
1144593755 17:16547663-16547685 GCTATTTAGAAACCAAGATCTGG - Intergenic
1144594751 17:16559667-16559689 GGTACTTAGAAACCAAGATCTGG - Intronic
1144616994 17:16785577-16785599 AGTAATTAGAAACCAATATCTGG + Intronic
1144895697 17:18530097-18530119 AGTAATTAGAAACCAATATCTGG - Intergenic
1145136520 17:20414135-20414157 AGTAATTAGAAACCAATATCTGG + Intergenic
1145290286 17:21539205-21539227 GGTATTTAGAAACCAGGATCTGG - Intronic
1146295429 17:31646155-31646177 GGTATGTAGAAGCCAAAATCTGG - Intergenic
1146747899 17:35348030-35348052 GGGTATTAGAAACCAAGATCTGG + Intergenic
1147771435 17:42870755-42870777 GGTATTTAGAAACCAATATCTGG + Intergenic
1147915870 17:43885446-43885468 AGTATTTAGAAACCAAGATGTGG + Intronic
1149052287 17:52320439-52320461 GGTGTTTAGAAACTAACATCTGG - Intergenic
1149106337 17:52971907-52971929 GGTGTTTAGAAAACAAAATTTGG + Intergenic
1149190845 17:54059617-54059639 GATATTTAGAAAACAATATCTGG - Intergenic
1149406759 17:56359954-56359976 GCTGTTTTGGAACAAAAATCAGG - Intronic
1149643925 17:58225468-58225490 GGTCTTTAGAAACCAAGGTCTGG - Intronic
1149811541 17:59678698-59678720 GGGCATTAGAAACCAAGATCTGG + Intronic
1150382462 17:64731673-64731695 GGTATTTAGAAGTCAAGATCTGG - Intergenic
1150550167 17:66202923-66202945 GGTGTTTAGAAATGAAGGTCTGG - Intergenic
1150773766 17:68062867-68062889 GGTATTTAGAAGTCAAGATCTGG + Intergenic
1151006608 17:70445017-70445039 GGTGTTTAGGGACCAAAATCTGG - Intergenic
1151229210 17:72670886-72670908 GGTGTTTAGGAACAAAGGTCCGG + Intronic
1151792730 17:76319347-76319369 GGTATTTAGAAACCAAGATTTGG - Intronic
1151924512 17:77184705-77184727 GGTATTTGGAAATCAAGATCTGG + Intronic
1152502704 17:80723620-80723642 GGGATTTAGAAACCAAGATGTGG + Intronic
1153198227 18:2624157-2624179 AATGTTTAGAAACCAAACTCTGG + Intergenic
1153510403 18:5845763-5845785 GGGATTTAGAAACCAAGATCTGG + Intergenic
1153732429 18:8028300-8028322 GGTGTTTAGAAAGCAACAGTGGG - Intronic
1154038107 18:10826160-10826182 GGTATTTAGAAACCAAGATGTGG + Intronic
1154936391 18:21062140-21062162 GATATTTAGAAACCAAGATCTGG - Intronic
1154977120 18:21469555-21469577 GGTATTTAGAAATGAAAATGTGG + Intronic
1155005256 18:21723386-21723408 GATATTTAGAAACCAAGATGTGG + Intronic
1155205931 18:23557805-23557827 GGTATGTAGAAACGAAGATCTGG - Intronic
1155265396 18:24087897-24087919 GGTTTTTGGAAATCGAAATCTGG + Intronic
1155389465 18:25318897-25318919 GGTATTTAGAAACCAAGATATGG - Intronic
1155402018 18:25449219-25449241 ATTATTTAGAAACCAAGATCTGG - Intergenic
1155438260 18:25834983-25835005 GGTATTTAAAAACCAATATCTGG - Intergenic
1155765307 18:29623420-29623442 GGTGTTTTTAAACCACTATCCGG + Intergenic
1156152685 18:34261417-34261439 GATATTTAGAACCCAAGATCTGG + Intergenic
1156153460 18:34271457-34271479 AGTATTTAGAAACCACAATCTGG + Intergenic
1156307972 18:35896823-35896845 GACATTTAGAAACCAAGATCTGG + Intergenic
1156602277 18:38623352-38623374 GGAATTTAGAAACCCAAATCTGG - Intergenic
1157030189 18:43896598-43896620 GGTATTTAGAAATCAAGATCTGG + Intergenic
1157155734 18:45263917-45263939 GGCATTTAGAAACCAAGATCTGG + Intronic
1157340847 18:46777058-46777080 TGGCTTTAGAAACCAAGATCTGG + Intergenic
1157567068 18:48686480-48686502 GGTTCTTAGAAGCCAAGATCGGG + Intronic
1158164834 18:54528632-54528654 GGTATTTAAAAACCAAGATTTGG + Intergenic
1159659990 18:71083283-71083305 GGAGTGTAAAAACCAAGATCTGG + Intergenic
1159980524 18:74773895-74773917 GGTGTTTATAAAGCAAGACCTGG - Intronic
1161773929 19:6247272-6247294 GGTATTTAAAAGCCAAGATCTGG - Intronic
1164773550 19:30832238-30832260 GGCATTTAGAAACCACAATCTGG + Intergenic
1164777793 19:30867091-30867113 GGTATTTAGAGACCACAATCTGG - Intergenic
1164787743 19:30947605-30947627 GGTATTTAGGAGCCAAGATCTGG + Intergenic
1165174524 19:33917887-33917909 GATATTTAGAAAACAAGATCTGG - Intergenic
1165185939 19:34021349-34021371 GGTATTTTAAAACTAAAATCTGG + Intergenic
1165499329 19:36175374-36175396 GGCATTTGGAAACCACAATCAGG - Intergenic
1165887815 19:39091481-39091503 AGTATTTAGAAACTAAGATCTGG + Intronic
1166322243 19:42025641-42025663 GGTGTTTAGGGGTCAAAATCAGG - Intronic
1166353515 19:42212998-42213020 GGTATTTAGAGACCAAAACCTGG - Intronic
1166618961 19:44278025-44278047 GATACTTAGAAACCAAGATCTGG - Intronic
1167226542 19:48246397-48246419 AGTATTTAGAAACCAAGATCTGG + Intronic
924967103 2:88103-88125 GATATTTAGAAACCAAGAGCTGG + Intergenic
925833683 2:7921871-7921893 GGTATTTGGAAACCAAGATCTGG - Intergenic
926555140 2:14348765-14348787 GGTGTTAAAAAGCCAAAATGTGG + Intergenic
926770738 2:16372453-16372475 GGTATTTAGAAACCAAGATGTGG + Intergenic
927358864 2:22208313-22208335 TGTGTTCAGAAACCAAAAGATGG + Intergenic
927539693 2:23897838-23897860 AGTATTTAGAAACCAAAAGCTGG + Intronic
927659143 2:24977498-24977520 GGTATTTAGAAACCAAGATCTGG + Intergenic
927715580 2:25350032-25350054 GGTATTTAGAAACCAAGTTCTGG - Intergenic
927821250 2:26267205-26267227 GCTATTTAGAAACCAAGATCTGG - Intronic
928026161 2:27740950-27740972 GGTAGTTAGAAATCACAATCTGG - Intergenic
928545407 2:32324794-32324816 GGGATTTAGAAGCCAAGATCTGG - Intergenic
928996023 2:37292147-37292169 GGGGTTTAGAAAAGAGAATCAGG - Intronic
931242198 2:60463113-60463135 GGTGTTGTGGAACCAAAATTGGG - Intronic
931297207 2:60938941-60938963 GGTATTTAGAAACCAAGATCTGG - Intergenic
931325645 2:61219367-61219389 GGTGTTCTGAATCCAACATCTGG + Intronic
931601097 2:64003890-64003912 GGTATTTAGAAACAGAAGTCTGG - Intronic
932537091 2:72610388-72610410 GGTATTTAGAAACCAAGATCTGG - Intronic
932589045 2:73052226-73052248 AGTATTTAGAAACCAAGATCTGG + Intronic
933289742 2:80424738-80424760 GGTGTTAAAAAACAAAAATTGGG - Intronic
933563662 2:83921799-83921821 GGTATTTAGAAGCCAAAATCTGG - Intergenic
934020549 2:87947242-87947264 GGTGATTATAAACAAATATCAGG - Intergenic
934173857 2:89562275-89562297 GGTATTTATAAACCACAATCTGG + Intergenic
934284171 2:91636624-91636646 GGTATTTATAAACCACAATCTGG + Intergenic
934844502 2:97654013-97654035 GGTATTTAGAAACCAAGATCTGG + Intergenic
934905507 2:98197886-98197908 GGTATTTAGAAACCAAGATCTGG + Intronic
934928540 2:98400076-98400098 GATATTTGGAAACCAAGATCTGG - Intergenic
935015368 2:99176875-99176897 GGCATTGAGAAACCAAATTCTGG + Intronic
935092882 2:99913608-99913630 GGTATTTAGAAACCAAGATCCGG - Intronic
935415436 2:102811897-102811919 GGTGTTTAGGCATCAAGATCTGG + Intronic
935727199 2:106034054-106034076 TGGCATTAGAAACCAAAATCAGG - Intergenic
936266038 2:111007692-111007714 GGTATTTAAAAACCAGCATCTGG + Intronic
936668951 2:114633048-114633070 CATATTTAGAAAACAAAATCTGG + Intronic
936988925 2:118341534-118341556 GGTATTTAAAAACCACAATCTGG + Intergenic
937270645 2:120649322-120649344 GTTATTTAGAAGCCAAAATCTGG + Intergenic
937274797 2:120677145-120677167 GGTGTTTAGAAATCAAGATCTGG - Intergenic
937551844 2:123103436-123103458 TGTGTTTAGAAACAAATATCTGG + Intergenic
937774464 2:125759476-125759498 AGTATTTAGAAACCAACATGTGG + Intergenic
937952510 2:127399298-127399320 GACATTTAGAAACCAAGATCTGG - Intergenic
938391059 2:130906233-130906255 GGTATTTAGAAACCAAGATTTGG + Intronic
938416109 2:131105085-131105107 GGTATTTAGAAACCAAGATTAGG + Exonic
938814721 2:134889329-134889351 GGTAACTAGAAACCAAGATCTGG - Intronic
938973669 2:136455601-136455623 GATATTTAGAAATCAAGATCTGG + Intergenic
939176446 2:138753476-138753498 TGGTATTAGAAACCAAAATCTGG + Intronic
939282438 2:140081602-140081624 GTTATTTAGAAACCAAGATCTGG - Intergenic
939444798 2:142294989-142295011 GGTATTTAGAAATCAATATCTGG + Intergenic
939746254 2:145972853-145972875 GGTGTTTATAGATCAAAATATGG - Intergenic
939837111 2:147143750-147143772 AGTGTTTAGAAACCACGATCTGG - Intergenic
940333122 2:152496984-152497006 GGTATATAGAAACCAAAATTTGG + Intronic
941033500 2:160540057-160540079 GGTACTTAGAAACCAAGATGGGG - Intergenic
941599666 2:167526095-167526117 GGTATTTATAAATGAAAATCTGG + Intergenic
941833515 2:169990041-169990063 GGTATTTAGAGACAAAAGTCTGG + Intronic
941836738 2:170030326-170030348 GGTATTTAGAGACCACAGTCTGG + Intronic
941869620 2:170370578-170370600 GGTGTATAGGAACCAAAACAAGG - Intronic
941928710 2:170920366-170920388 GGTATTTAGAAACCAAGATTTGG - Intergenic
942233942 2:173886027-173886049 GGTATTTAGAACCCAAGATCTGG - Intergenic
942470961 2:176259032-176259054 GATATTTAGAAACCAAGATCTGG - Intergenic
942746046 2:179234359-179234381 GTTATTTAGAAATCAAGATCTGG - Intronic
942797074 2:179834234-179834256 GGTATTTAGAAACCAAAATCTGG - Intronic
943584758 2:189725370-189725392 GATATTTAGAAACCAAGATTTGG - Intronic
943994339 2:194739937-194739959 TGATATTAGAAACCAAAATCTGG - Intergenic
944719662 2:202410285-202410307 GTTATTTAGAAACCAAGATCTGG - Intronic
944828229 2:203506351-203506373 AGTATTTTGAAACCAAAAACTGG - Intronic
945169590 2:206981799-206981821 TGTCTTTAGAATCCAAGATCTGG - Intergenic
945558199 2:211305283-211305305 CGGTATTAGAAACCAAAATCTGG - Intergenic
946097170 2:217284970-217284992 AGTATTTAAAAACCAAGATCGGG + Intronic
946314486 2:218901020-218901042 GATGTGTAGAAGCCAAGATCTGG + Intergenic
946318928 2:218937075-218937097 GGTGTTTAGAAACTAAGATCTGG - Intergenic
947198419 2:227592759-227592781 GATATTTAGAATCCAAGATCTGG + Intergenic
947332152 2:229041137-229041159 GATATTTAGAAACCAAGATCTGG - Intronic
947790628 2:232865996-232866018 GGTATCTAAAAACCAAAACCTGG + Intronic
947803347 2:232946620-232946642 GCTGTTTAGAAACCAAGATCTGG - Intronic
1169167763 20:3439145-3439167 TTGGTTTAGAAACCAAGATCTGG - Intergenic
1169501908 20:6168790-6168812 TGTTTTTAGAAGCCAAAAACTGG - Intergenic
1170177388 20:13487397-13487419 GGTGTGTAGAATACACAATCAGG - Intronic
1170514396 20:17113388-17113410 TGATATTAGAAACCAAAATCTGG + Intergenic
1172260169 20:33557390-33557412 GTAGTTTAGAAATCAAGATCTGG + Intronic
1172458969 20:35100873-35100895 AGGGTTTAGAAACCAGAAACTGG + Intergenic
1172496434 20:35388738-35388760 AGTATTTAGAAATCAAGATCTGG - Intronic
1172522111 20:35574278-35574300 GGTTTTTAGAAACCAAAATCTGG + Intergenic
1172909508 20:38396277-38396299 GGTATTTGGAAACCAAGATTTGG + Intergenic
1172985211 20:38981638-38981660 GATGTTTAGAAATCATGATCTGG + Intronic
1173264290 20:41464742-41464764 AGCATTTAGAAACCAAACTCTGG - Intronic
1174512390 20:51063696-51063718 AGTATTTAGAAACCCAGATCTGG + Intergenic
1174945291 20:54978493-54978515 GGTATTTAGAAACCAAGAACTGG + Intergenic
1175047211 20:56118429-56118451 GGTTTTTGGATGCCAAAATCTGG - Intergenic
1175096910 20:56548463-56548485 GGTGTTTAGAAGCCAGGACCTGG + Intergenic
1175369480 20:58478279-58478301 GGTGTTTAGAAACCAAGATCTGG + Intronic
1175455671 20:59111622-59111644 GATATTTAGAGACCATAATCTGG - Intergenic
1175528435 20:59653898-59653920 GGTATTTAGTACACAAAATCTGG - Intronic
1177083288 21:16669273-16669295 GGTATGTAGAAACCAAGATCTGG - Intergenic
1177284331 21:19029212-19029234 AATGTTTACAAATCAAAATCTGG - Intergenic
1177952438 21:27555238-27555260 AATATTTAGAAACCAAAAACTGG + Intergenic
1178387614 21:32166356-32166378 GGTATTTAGAAGCCAATATCTGG - Intergenic
1178524689 21:33317607-33317629 GGTATTTAGAAACCAATATATGG - Intergenic
1178585828 21:33869737-33869759 GGTGTTTAGAAACTCAGATGTGG + Intronic
1178951202 21:36987214-36987236 GGTATTTAGAAAACAAGATATGG + Intronic
1179931100 21:44571531-44571553 GGCATTTAGAAACCAAAATCTGG - Intronic
1180753952 22:18147309-18147331 GGGAATTAGAAACCAAGATCTGG + Intergenic
1181373016 22:22432664-22432686 GGTGTCCAGAAAACAAAAGCAGG + Intergenic
1181722697 22:24787920-24787942 TGGTGTTAGAAACCAAAATCTGG - Intergenic
1182738749 22:32550734-32550756 GGGTTTTAGAGACCACAATCTGG - Intronic
1183144612 22:35978469-35978491 AGTAATTAGAAACCAACATCTGG - Intronic
1184241829 22:43215092-43215114 GATGGGTAGAAACCAAAATCTGG - Intronic
1184377236 22:44121634-44121656 GGTAATTAGATAGCAAAATCTGG + Intronic
1184491671 22:44813132-44813154 GCTATTTAGAGACCAAGATCTGG + Intronic
949517049 3:4817240-4817262 GGTATTTAGAAGCCAAGATCTGG + Intronic
949723821 3:7021046-7021068 TGTGTATAGAAAACATAATCTGG - Intronic
950117628 3:10461753-10461775 GGACTTTAGAACCCAAAACCAGG - Intronic
950169894 3:10831184-10831206 GTTGTTTAGAAAAAAAAATGGGG - Intronic
950403190 3:12786951-12786973 GGCACTTAGAAACCAAGATCTGG - Intergenic
950409046 3:12822730-12822752 GGTATTTTGAATCCAAAATCTGG + Intronic
950608574 3:14108339-14108361 GGTTTTTGGAAACCAAGATCTGG + Intergenic
950621334 3:14207858-14207880 GATATTTAGAATCCAAGATCTGG - Intergenic
951304928 3:21047950-21047972 GGGGTTTAGAAACTGAAATTTGG - Intergenic
951586597 3:24221233-24221255 AGTCATTAGAAACCAAATTCTGG + Intronic
952200534 3:31122334-31122356 GGTATTTAGAAACCATCATCTGG + Intergenic
952433058 3:33244736-33244758 GGTATTTAGAAACCGAGATCTGG - Intergenic
952558636 3:34562868-34562890 TGTATTTAGAAACCAAAGTATGG + Intergenic
952773754 3:37025013-37025035 GGTATTTAGAGACTATAATCTGG + Intronic
952808153 3:37376940-37376962 GGTGCTTTGAATCCAACATCTGG + Intergenic
952949538 3:38509539-38509561 GCTTTTTAGAAACAAATATCTGG - Intronic
952950222 3:38517491-38517513 GATGTTTAGAAACCAAGATCTGG + Intronic
952952444 3:38536104-38536126 GATATTTAGAAACCAAGATTTGG + Intronic
953095665 3:39773127-39773149 GGTATTTAGAAACCAAGATCTGG - Intergenic
953478148 3:43223524-43223546 GGTATTTAGAGACCACAATCTGG - Intergenic
953648672 3:44779327-44779349 GGTATTTAGAAACCAAGATCTGG + Intronic
954597145 3:51835869-51835891 GGTGTTTACAAACCACAACTTGG + Intergenic
954612187 3:51950911-51950933 AATGTTTAGAATCCAAGATCTGG + Intergenic
954768649 3:52945103-52945125 GGTATTTGGAAATCAAAATTTGG - Intronic
954770614 3:52964614-52964636 GATATTTAGAGACCACAATCTGG - Intronic
954983441 3:54767579-54767601 GTTTTTTAGAAGCCAGAATCTGG - Intronic
955013156 3:55039738-55039760 GTTATTTAGAGACCACAATCTGG + Intronic
955206088 3:56897405-56897427 AGTATTTAGAAGCCAAGATCTGG + Intronic
955235067 3:57131883-57131905 GGTGATTAAAAACAAAATTCAGG + Intronic
955245021 3:57217157-57217179 GGTGTTTAGAGGGCAAAATCTGG + Intronic
955550290 3:60077377-60077399 GGTATTTAGAAACCAAGATCTGG - Intronic
955588762 3:60511710-60511732 GATAATTAGAAACCAAGATCTGG - Intronic
956280875 3:67555476-67555498 TGTATTTAGAAACTAAGATCTGG - Intronic
956439469 3:69265792-69265814 GGTATCTAGAAACAAAGATCTGG - Intronic
956504993 3:69928691-69928713 GGAGTTTTCAACCCAAAATCTGG - Intronic
956660239 3:71590412-71590434 GGTATTTAGAAACCAAGATCTGG - Intergenic
956771539 3:72530410-72530432 GGTATTTAGAGAGCACAATCTGG - Intergenic
956889315 3:73595966-73595988 AGTGTTTAGAAACCAAAATATGG - Intronic
957235186 3:77578940-77578962 TGTGCTTTGAAACCAAAATATGG - Intronic
958061297 3:88485037-88485059 AGTATTTAGAAACCATACTCTGG - Intergenic
958521665 3:95197518-95197540 GGTAGTTAGAAACAAAGATCTGG + Intergenic
958820521 3:98968611-98968633 TGTTTTTAGAAATCAAGATCTGG + Intergenic
958921910 3:100116540-100116562 GGTATTTAGAAACCAAGATCTGG + Intronic
958928558 3:100185395-100185417 GGTCTGCAGAAACCAACATCTGG - Intergenic
959790649 3:110357319-110357341 GCTGTTTAGAAACCAAGATCTGG - Intergenic
960205980 3:114898798-114898820 GGTATTTAGTAACATAAATCTGG - Intronic
960244436 3:115384345-115384367 GGTAGTTAGAAACCAAGATCAGG - Intergenic
960454641 3:117855422-117855444 GGTGTTTAGAAGCCAAACGCTGG - Intergenic
960648674 3:119920961-119920983 GGTATTTAGAGACCACAGTCTGG - Intronic
961220664 3:125196990-125197012 GATATTTAGAAATCAAGATCTGG - Intronic
961230692 3:125304809-125304831 GGTATTTAGAAGCCAAGGTCTGG - Intronic
961550144 3:127665922-127665944 GGTATTTAGAAACTAAGATCTGG + Intronic
961943869 3:130665377-130665399 GGTATTTAGAAACCACAATGTGG - Intronic
961966146 3:130905135-130905157 GATATCTAGAAACCAAGATCTGG + Intronic
962175352 3:133148137-133148159 GATATTCAGAAACCAAAATCTGG - Intronic
962238989 3:133734255-133734277 GGTATTTAGAAAGCAAATTCTGG - Intergenic
962303632 3:134266559-134266581 GGTCTTTAGAAACCAAGATTTGG + Intergenic
962647435 3:137454200-137454222 AATATTTAGAAATCAAAATCTGG + Intergenic
962658566 3:137575930-137575952 AGTATTTAGAGACCATAATCTGG - Intergenic
962884897 3:139615286-139615308 GGTACTTAGAAACCAAAATTAGG + Intronic
963231354 3:142911451-142911473 GGAGCTAAGAAACCAAAGTCTGG - Intergenic
963945152 3:151137473-151137495 GGTATTTAGAAAGCAAGATCTGG + Intronic
964078054 3:152715912-152715934 TGTATTTAGAATCCAAAATCTGG + Intergenic
964226354 3:154407801-154407823 AGTATTTAGAAGCCAAAATCTGG - Intronic
964459531 3:156908714-156908736 GATATTTAGAAACCAGCATCTGG + Intronic
964557966 3:157961826-157961848 TGTGGTTAGAAACAAAAATGGGG - Intergenic
964813306 3:160689863-160689885 AATATTTAGAAACCAAGATCTGG - Intergenic
964892184 3:161550687-161550709 GATATTTAGAAACCAAGACCCGG + Intergenic
965068256 3:163880690-163880712 GGTTTTGAGACACCAAATTCAGG - Intergenic
965306831 3:167075514-167075536 AGTTGTTAGAAACCAAAATCTGG - Intergenic
965327096 3:167320110-167320132 GGTGCTCAGAAACAAAGATCTGG - Intronic
965400370 3:168206118-168206140 GGATTTTAGAAACCAAAGGCGGG - Intergenic
965718335 3:171631517-171631539 GGTATTTATAAAGCAAAATCTGG - Intronic
966141635 3:176764002-176764024 GGTATTTAGAAATCAAAATCTGG - Intergenic
966165033 3:177007588-177007610 AGTATTTAGAAACCAAGATCTGG - Intergenic
966239274 3:177738151-177738173 GGTGTTTAGGAATCAAGGTCTGG - Intergenic
966504741 3:180686931-180686953 GGTGTTTAGAAACCAAGATCTGG + Intronic
967019819 3:185512910-185512932 GGTGTTAAGAAAACAAAATCTGG - Intronic
967659202 3:192084848-192084870 TGGGTTTAGAAACCAGATTCAGG + Intergenic
967717920 3:192784462-192784484 GGTCTATAGAAACTAAAAACCGG - Intergenic
967784282 3:193473043-193473065 GGAATTTAGAAACCAAACTTTGG - Intronic
967791359 3:193552270-193552292 GGAGTTAAAAAACCAAAAACAGG - Intronic
968347923 3:198026720-198026742 GGTGTTTAGAGACTAAGATCTGG + Intronic
968718916 4:2184639-2184661 GGCATTTAGAGACCAGAATCTGG - Intronic
968795661 4:2702448-2702470 GGTGTTCAGAAACCCAGACCTGG + Intronic
968896146 4:3404793-3404815 GAGGTATAGACACCAAAATCTGG - Intronic
969367145 4:6702936-6702958 GCTATTTAGAAGCCAAGATCTGG + Intergenic
969479287 4:7439049-7439071 GGTGTTTAGAAACCAAGATCTGG + Intronic
969542309 4:7800492-7800514 GATGTTTAGAATCCAAACCCGGG + Exonic
969723016 4:8903634-8903656 GGTGATTAGAAACCAAGATCTGG + Intergenic
969827712 4:9771088-9771110 GGTGTTTATAAACCACAATCTGG + Intergenic
970898610 4:21132580-21132602 GATGTCTAGAAAGCTAAATCTGG - Intronic
971074067 4:23127767-23127789 GGGCATTAGAAAACAAAATCAGG + Intergenic
971467754 4:26982667-26982689 GCTGTTTAGAAACCAAGATTTGG + Intronic
971864751 4:32154963-32154985 AGTATCTAGAAACCAAAATAGGG - Intergenic
972001011 4:34033073-34033095 GGTATTTAGTAACCAATGTCTGG + Intergenic
972445250 4:39137319-39137341 GGTATTTAGAAGCCAAGACCTGG - Intergenic
972851987 4:43061662-43061684 AGTATTTAGAAACCAACATCTGG + Intergenic
973118602 4:46490354-46490376 GGTGTTTTGAAATCACAATAAGG + Intergenic
973622332 4:52740005-52740027 TGGTTTTAGAAACCAAGATCTGG - Intronic
973681824 4:53328297-53328319 TGTATTTAGAAACCAAGATCTGG - Intronic
973929782 4:55780577-55780599 GGCATTTAGAACCCAAAATCTGG - Intergenic
973962568 4:56126281-56126303 AGTATTTAGAAACCAAGATCTGG + Intergenic
974217590 4:58871486-58871508 GGTATTTAGAAAACAGACTCTGG - Intergenic
974291896 4:59943883-59943905 GCTGTTTAGAAACCAAGATCTGG + Intergenic
974494647 4:62610813-62610835 GGCATTTAGAAACCACAGTCTGG + Intergenic
974501478 4:62710088-62710110 GTTGTTTGGAAAAAAAAATCTGG + Intergenic
974859346 4:67500447-67500469 GGCATTTAGAAACCAAGATTTGG - Intronic
975048400 4:69830262-69830284 GGTGTACATTAACCAAAATCAGG - Intronic
975631094 4:76403109-76403131 GCTGTTTATAAAACAAAATGGGG - Intronic
975743124 4:77449928-77449950 GCTGTTAAGAAACCAAGATCTGG + Intergenic
975889327 4:79007165-79007187 GATATTTAGAAACCAAGATCTGG + Intergenic
976501818 4:85799183-85799205 GATGTTTAGAAACCAAAATCTGG - Intronic
976757066 4:88509935-88509957 GGTCTTGAGAAACCCAAATGTGG + Intergenic
976816733 4:89156770-89156792 GGTCTTCAGAAACAATAATCTGG - Intergenic
977483681 4:97613924-97613946 GGTATTTAGAAAATAAGATCTGG + Intronic
977573175 4:98650703-98650725 GGAATTTAGAAGCCAAGATCTGG - Intronic
977902898 4:102442886-102442908 GGGGTTCAGAAACCAAAACATGG + Intergenic
978152865 4:105457864-105457886 GGCATTTTGAAACCAAAATCTGG - Intronic
978505483 4:109451681-109451703 GATATTTAGAAACCAAGAACTGG + Intronic
979608728 4:122668163-122668185 GGTTTTCACAAACTAAAATCTGG + Intergenic
979621233 4:122801039-122801061 GGTGTTTAAAAACTGAGATCTGG - Intergenic
979946707 4:126841926-126841948 GGTATTTAGAAACCAAGATATGG + Intergenic
980012177 4:127608906-127608928 GGTATTTAGACACCAAGATCTGG - Intergenic
980012275 4:127610025-127610047 GGTATTTAGACACCAAGATCTGG - Intergenic
980035426 4:127877976-127877998 GGTGCTTAAAAAACAATATCTGG - Intergenic
980091529 4:128447973-128447995 GGTTTTTAGAAACCAATGTCTGG - Intergenic
980195436 4:129582626-129582648 GATGTTTAGAAACCAGTATTTGG + Intergenic
980756254 4:137166230-137166252 GGTGTTTAGAAATTAAAATATGG - Intergenic
980783208 4:137517839-137517861 GCTGTTTAAAAATTAAAATCTGG - Intergenic
981055573 4:140357624-140357646 GGTGTTTATAAACCAAACATTGG + Intronic
981248183 4:142565159-142565181 GGTATTTAGAAACCAAAGTCTGG - Intronic
981509155 4:145536296-145536318 AGTATTTAGAAACCAAAATCTGG - Intronic
981549079 4:145924609-145924631 GCTGTTGAAAAACCAAACTCAGG - Intronic
981706604 4:147665663-147665685 GGTATTTAAAAACCAAGATCTGG + Intronic
981712505 4:147723210-147723232 GGTGTTTAGAATCGATTATCTGG - Intergenic
981839827 4:149098415-149098437 TGGTATTAGAAACCAAAATCTGG + Intergenic
981982331 4:150809308-150809330 AGTATTTAGAAACCAAGATCTGG - Intronic
982038876 4:151375149-151375171 GGTATTTAGAAACCAAGAACTGG + Intergenic
982378873 4:154726346-154726368 GGTATTTAGAAATAAAAATCTGG - Intronic
982480212 4:155899687-155899709 CGTGTTTATATACCAAAATATGG + Intronic
983021850 4:162686272-162686294 CTTGTTTATAAAACAAAATCTGG + Intergenic
983745739 4:171197502-171197524 GGTATTTAGAAACCAAATCTGGG + Intergenic
984035335 4:174661071-174661093 GGTTTTTAGAAACCAAGATCTGG + Intronic
984344119 4:178499185-178499207 GGTATTTAGAAATCAAGATTTGG + Intergenic
984732892 4:183084889-183084911 GGTATTTAGCAACCAAGATCTGG + Intergenic
984810772 4:183794880-183794902 GGTATTTAGAAACCAACATGTGG - Intergenic
984926088 4:184808314-184808336 GTCATTTAGAAACCAAAAACCGG + Intronic
985771216 5:1812680-1812702 GGTGTTTAGAGACCACCATGTGG + Intronic
985807397 5:2056964-2056986 GGTAATTAGAAACCAAGATCTGG - Intergenic
986097336 5:4572375-4572397 GGTACTTAGAAAACAAGATCTGG - Intergenic
986243802 5:5986439-5986461 GGTGTTTAGAAGCCAAAATGAGG + Intergenic
986503222 5:8423413-8423435 GGTATTTTGAAACCAAGATCTGG - Intergenic
986729011 5:10621278-10621300 GGTATTTAGAAACCAAAATCTGG + Intronic
986745695 5:10742764-10742786 GGTGTTTAGACACCACAGTCTGG + Intronic
986991899 5:13563923-13563945 TGGGATTAGAAACCAATATCTGG - Intergenic
987304851 5:16627743-16627765 AGTATTCAGAAACCAAAACCTGG - Intergenic
987520555 5:18977043-18977065 GATATTTAGAAACCAAGATCTGG - Intergenic
988029749 5:25748606-25748628 GGTATTTAGAAACCAAAATATGG - Intergenic
989198618 5:38740876-38740898 GGTATTAAGAAACCAAGATCTGG + Intergenic
989962750 5:50436058-50436080 GGTATTTAGAACCCAAGATCTGG + Intronic
990172840 5:53073867-53073889 GGTGTTTAAACACCAAGGTCAGG - Intronic
990399826 5:55427299-55427321 GGTGTTCAGTCACCAAAAGCTGG + Intronic
990724589 5:58739844-58739866 GGTGTTTATAAATAAAAATTAGG - Intronic
990807399 5:59681058-59681080 GGTTTTTAGAAATCAAAATTTGG - Intronic
990966605 5:61455015-61455037 AGTATTGAGAAACCAAGATCTGG + Intronic
991348048 5:65691272-65691294 TGTATTTAGAAACCAAGATTGGG - Intronic
991636367 5:68710064-68710086 GTTTTTTATAAACCAAAATTCGG + Intergenic
992177692 5:74166613-74166635 GGCAGTTAGATACCAAAATCTGG + Intergenic
992684065 5:79182078-79182100 TTTCTTTAGAAACCAAAATGGGG + Intronic
993171155 5:84420355-84420377 AGTATTTAGAACCAAAAATCAGG - Intergenic
994084334 5:95742136-95742158 GATATTTAGAAACCAAGGTCTGG + Intronic
994340510 5:98622078-98622100 GGTATTTTGAAATCAAGATCTGG + Intergenic
994539062 5:101071514-101071536 TATCTTTAGAAATCAAAATCTGG - Intergenic
994810463 5:104511618-104511640 GATCTATAGAAACCAAAATATGG + Intergenic
995496279 5:112747893-112747915 GGTGTTTGAAAACCCAAATTAGG + Intronic
995730471 5:115234978-115235000 AGGGTTTAGAAACTAGAATCTGG - Intronic
996058677 5:119008836-119008858 GTTTTTTAAAAACCTAAATCAGG + Intergenic
996161311 5:120169712-120169734 GATTTTTAGAAACCAAAATGAGG + Intergenic
996447837 5:123577259-123577281 GGTATTTAGAAACCAAGATTTGG + Intronic
996870063 5:128180396-128180418 AGTGTTTAGAAACAAAGATCAGG + Intronic
996901009 5:128541336-128541358 GGTATTTAGGAACCACAATCTGG - Intronic
997161928 5:131617984-131618006 TGAATTTAGAAACCAAAGTCTGG - Intronic
997621053 5:135295719-135295741 GGTATTTAGAAACTAAGATCTGG + Intronic
997867169 5:137474536-137474558 GGTATTTATAAACCAAGATCTGG - Intronic
998054063 5:139058873-139058895 AGTGTTTAGAAGCCAAGATCTGG + Intronic
998344792 5:141452379-141452401 AGTATTTAGAAACTAAGATCTGG + Intronic
998489621 5:142535159-142535181 GGTATTTAGATACCAAAATCAGG - Intergenic
999168024 5:149567872-149567894 GTATTTTAGAAACCAAGATCTGG + Intronic
999788172 5:154911210-154911232 GTCATTTAGAAACCAAGATCTGG + Intronic
999937789 5:156506450-156506472 GGTATTTAGAAACCACAACTGGG - Intronic
1000097339 5:157983584-157983606 GGTATGTAGGAACCAAGATCTGG + Intergenic
1000116695 5:158160446-158160468 GGTCTTTTCAAACCAGAATCTGG - Intergenic
1000309571 5:160029310-160029332 AGTGTTTAGAAACAAAGATCTGG - Intronic
1001423562 5:171606547-171606569 GATGTTTAGAAGCCAAGATCTGG + Intergenic
1001532879 5:172476941-172476963 GGTCTTTAGAAACCAAGATCTGG - Intergenic
1001584354 5:172823200-172823222 GGTATTAAGAAACCACGATCTGG + Intergenic
1001594535 5:172889429-172889451 GGTCTTTAGAACCCAAAGTCTGG - Intronic
1002411465 5:179081701-179081723 GGCATTTAGAAACCAAAATTTGG - Exonic
1002659912 5:180784577-180784599 GGTTTTTAAAAATCAAAATCTGG - Intergenic
1003129817 6:3386244-3386266 GGGGTTTAGAAACCCAAGGCAGG + Intronic
1003267435 6:4578339-4578361 GATATTTAGAAGCCAAAATTTGG - Intergenic
1003889102 6:10548097-10548119 GGTATTTAAAGATCAAAATCTGG + Intronic
1004994599 6:21176995-21177017 GCTTTTTAAAAACCAACATCTGG - Intronic
1005082913 6:21974916-21974938 GGAATTTAGAAACTACAATCTGG - Intergenic
1005285373 6:24320813-24320835 GGTATTTAGAAACCAGCATCTGG - Intronic
1005334705 6:24783020-24783042 AGTGTTTATAAACCAAGAACTGG - Intronic
1005361302 6:25033507-25033529 GATATTTAAAAACCAACATCTGG + Intronic
1005496528 6:26392658-26392680 GATGTTTGGAAACCAATACCGGG + Exonic
1005705192 6:28444335-28444357 GGTATATAGAAACCAAGATCTGG + Intergenic
1006466316 6:34196861-34196883 TGTGTGGAGAAACCAAAACCTGG + Intergenic
1006526877 6:34613853-34613875 CCTATATAGAAACCAAAATCTGG - Intronic
1006540412 6:34735463-34735485 GGAATTCAGAAACCAAGATCTGG + Intergenic
1007043364 6:38746463-38746485 AGTATTTAGGAACCAAAATCTGG + Intronic
1007534561 6:42574497-42574519 GGTAGTTAGAAACCAAGATCTGG + Intronic
1007772672 6:44203640-44203662 TCTGTTTAGGAACCAAAATAAGG + Intergenic
1007851585 6:44807950-44807972 GATATTTAGAAACTAAGATCTGG + Intergenic
1008112679 6:47510349-47510371 GGTATTTGGAAATCAAGATCTGG - Intronic
1008590379 6:52988043-52988065 GATATTTAGAAACCAAGATGTGG - Intronic
1010162862 6:72878575-72878597 GGAATATAGAGACCAAAATCTGG + Intronic
1010266076 6:73869350-73869372 GGTATTTAGAAAACAAGATCTGG + Intergenic
1010418508 6:75643952-75643974 GGTATTTAGAAACCAGGATCTGG - Intronic
1010897741 6:81386093-81386115 GGCATTTAGAATCCAAGATCTGG - Intergenic
1010952127 6:82049347-82049369 GGTATTTAGAAACCAATACCTGG + Intergenic
1011043899 6:83060589-83060611 GGCCTTTACAAACCAAGATCTGG - Intronic
1011280208 6:85669946-85669968 GGTATTTAGAGGCCACAATCTGG + Intergenic
1011362651 6:86544490-86544512 GTTATTTAGAAACCAAGACCTGG + Intergenic
1012168738 6:95991379-95991401 GGAGGCTAGAAATCAAAATCTGG + Intergenic
1012200239 6:96397332-96397354 AGTCTTTAGAGACCAAGATCTGG - Intergenic
1012211976 6:96530802-96530824 GGGATTTAGAAACCAAGATCTGG + Intronic
1012511304 6:100005108-100005130 GATATTTAGAAAGCAACATCTGG - Intergenic
1012574731 6:100780225-100780247 GGTGTTTAGCAATTAAAATATGG - Intronic
1013145752 6:107389779-107389801 GGTATTTAGAAACCAATATCTGG - Intronic
1013470183 6:110457255-110457277 GGTATTTAGAAACTAAGATCTGG - Intronic
1013671709 6:112410474-112410496 TGGTATTAGAAACCAAAATCTGG - Intergenic
1014034215 6:116746673-116746695 AGTAGTTAGAAACCAAGATCTGG + Intergenic
1014074580 6:117221644-117221666 GGTTTTTAAAAGCAAAAATCAGG + Intergenic
1014200053 6:118599147-118599169 GGTATTCAGAAACCAAGATCTGG - Intronic
1014783825 6:125595179-125595201 GGTGTTCATAAACCAAATTCGGG - Intergenic
1014814661 6:125922307-125922329 AGTGTTTAGAAAGAAAAATTGGG + Intronic
1014989193 6:128053060-128053082 GGTATTTAGACACCAACATCTGG + Intronic
1015479773 6:133695465-133695487 GGTGTTTAGAAACCAATAACTGG + Intergenic
1015628739 6:135209162-135209184 GGTACATAGACACCAAAATCAGG + Intronic
1015644850 6:135375800-135375822 GCAATTTAGAAACTAAAATCTGG - Intronic
1015752739 6:136576690-136576712 GGCATTTAGAAACCAAGATTTGG + Intronic
1015798817 6:137040404-137040426 GGTGTTTAGAAACCAAAATCTGG - Intronic
1016455621 6:144227559-144227581 GGTATTTAGAAACCAAAATCTGG + Intergenic
1016871530 6:148822090-148822112 AGTGTTTATTAACCAAGATCTGG + Intronic
1017094517 6:150792777-150792799 AGTGTTTGGAGACCACAATCTGG - Intronic
1017505096 6:155061064-155061086 GATATTTAGAAACCAAGTTCTGG + Intronic
1017831491 6:158134312-158134334 GGTATTTAGTAACCAAGTTCTGG - Intronic
1018393760 6:163361138-163361160 TGTGTTTGGAAACCAAGATGTGG + Intergenic
1020438602 7:8193036-8193058 GGTATGTAGAAACAAAGATCTGG + Intronic
1020441862 7:8225543-8225565 GGTATTTAGAAAGCAAGATCTGG + Intronic
1020459044 7:8407310-8407332 AGTATTCAGAAACCAAGATCTGG + Intergenic
1020649012 7:10852543-10852565 GATGTTTAGAAAATAAGATCTGG - Intergenic
1020671273 7:11116322-11116344 GATATTTAGAAACCAAGATCTGG + Intronic
1021612298 7:22470097-22470119 GGTATTTAGAAACCAAGATATGG - Intronic
1021666637 7:22988509-22988531 GGTATTTGGAAAACAAGATCTGG + Intronic
1021944327 7:25710979-25711001 AATGTTTAGAAACCAAAATCTGG + Intergenic
1022167867 7:27788842-27788864 GGTATTTTGAAACCAAGAACTGG + Intronic
1022169268 7:27808117-27808139 GTAGTTTAGAAACCAAGATCTGG + Intronic
1022578277 7:31520665-31520687 TGGTTTTAGAAACCAAGATCTGG + Intronic
1022600598 7:31755434-31755456 TGGTTTTAGAAACCAAGATCAGG - Intronic
1022779913 7:33569928-33569950 GGTAATTAGAAACCAAAATCTGG - Intronic
1022903543 7:34834088-34834110 TGTGATTAGAATCCAAAAACAGG - Intronic
1022987843 7:35676581-35676603 GGTATCTAAAGACCAAAATCTGG + Intronic
1023090313 7:36611326-36611348 GCTGATGAGAAACCCAAATCAGG - Intronic
1023095076 7:36652047-36652069 GGTATTTGGAAACCAAGATCTGG - Intronic
1023276428 7:38523330-38523352 GGGATTTAGAAACCAAGATCTGG - Intronic
1023288010 7:38639019-38639041 GGTATTTAGAAACCAAGATCTGG + Intergenic
1023561714 7:41480793-41480815 GGTATTTAGAAACCAAAATCTGG - Intergenic
1023896663 7:44439447-44439469 GGTATTTAGAAACCAAGATCTGG - Intronic
1023927398 7:44679634-44679656 GGTGTTTAGCAAAAAAAACCTGG - Intronic
1023930386 7:44701728-44701750 GGTCTTTACAACCAAAAATCTGG - Intronic
1024132377 7:46367365-46367387 GGTATTTAGAAATCAAGATCTGG + Intergenic
1024425907 7:49226376-49226398 AGGTTTTAGAAAACAAAATCAGG + Intergenic
1024781095 7:52848917-52848939 GGTATTTAGAAACCAATATCTGG + Intergenic
1024824440 7:53374521-53374543 GGCATTTAGAAACCAAAATCCGG + Intergenic
1025289554 7:57703430-57703452 GGAGGTTAGATACTAAAATCAGG - Intergenic
1026276741 7:68885537-68885559 GGCATTTAGAAACCAAAATCCGG - Intergenic
1027999198 7:85469332-85469354 TGTACTTAGAAACCAATATCTGG - Intergenic
1028171188 7:87598943-87598965 GGTATTTAGAAACCCAGATCTGG + Intronic
1028558920 7:92152101-92152123 CATATTTAGAAACCAAGATCTGG + Intronic
1029165228 7:98584276-98584298 AGTATTTAGAAACCAAAATCTGG + Intergenic
1030153999 7:106434283-106434305 GATGTTTAGAAACCAGTATATGG - Intergenic
1030279891 7:107762450-107762472 GGTGTTTAAAAATCCAAATTAGG - Intergenic
1030437154 7:109537114-109537136 GGTGTTTGGAAACCAATATCTGG - Intergenic
1030844663 7:114394100-114394122 GGTATTTAGAAAGGAAGATCTGG - Intronic
1031656909 7:124367408-124367430 GATCTTTAGAAGCCAAGATCTGG - Intergenic
1031819410 7:126480854-126480876 GGTATTTAGAAATCAAAATCTGG - Intronic
1032717565 7:134523258-134523280 GATATTTAGAAACCACAATTAGG - Intergenic
1032864586 7:135913274-135913296 GATGTTCAGAAACCAAGATCAGG + Intergenic
1032936356 7:136736857-136736879 GGTGTTCAGAAACCAAGATTTGG + Intergenic
1033107807 7:138545676-138545698 GGTATTTTGAAACCAAGATCTGG - Intronic
1033300596 7:140181198-140181220 GGTATTTAGAAGCCAAGACCTGG - Intergenic
1033375188 7:140753998-140754020 GTTGTCGAGAAACCAAAAGCAGG + Intronic
1033534138 7:142296696-142296718 GGTATTTAGAAAACAGAATATGG - Intergenic
1033639169 7:143244255-143244277 GCAGTTTTGAAACCAAGATCAGG + Intronic
1033806620 7:144961628-144961650 AGTCTTTAGAAACCAAAATGTGG + Intergenic
1033820923 7:145133348-145133370 GGTATTGAGAAACCAAGATCTGG + Intergenic
1033983172 7:147191174-147191196 GTGGATTAGAAACCAAAGTCTGG + Intronic
1034868935 7:154665612-154665634 GGTATTTAGACACCAAGATCTGG + Intronic
1036530247 8:9578355-9578377 GGTATTTAAAAAACAAAACCAGG + Intronic
1037300306 8:17444278-17444300 GATATGTGGAAACCAAAATCTGG + Intergenic
1037424957 8:18745627-18745649 AGTATTTAGAAACCAAGGTCTGG + Intronic
1037572223 8:20167921-20167943 GGTGTTTAGAAACCAAACTATGG - Intronic
1037856807 8:22377406-22377428 GCTGTTTAGAAACCAAGGTCTGG + Intronic
1038460642 8:27713793-27713815 GGGATTTAGAAACCACAATCAGG + Intergenic
1038585553 8:28785652-28785674 GGTATCTAGAAACCAACATGTGG + Intronic
1038699681 8:29838071-29838093 GGCATTTAGAAATCACAATCTGG - Intergenic
1038758247 8:30361790-30361812 GGTACTTAGATACCAAGATCTGG + Intergenic
1039192138 8:34988294-34988316 GGCATTTAGAAACCAAGATCTGG + Intergenic
1039349574 8:36747537-36747559 GGTGTATAGAAAGCAAATTTTGG - Intergenic
1041234065 8:55781048-55781070 AGTATTTAGAAACCAAAAGCTGG + Intronic
1041821795 8:62044253-62044275 TGTACTTAGAAACCAAGATCTGG + Intergenic
1041969449 8:63720706-63720728 AATGGTTAGTAACCAAAATCAGG + Intergenic
1042400242 8:68336702-68336724 GGTATTTAGAAACCAAAATGTGG - Intronic
1042633042 8:70842418-70842440 GGAATTTGGAAACCAAGATCTGG + Intergenic
1042639848 8:70921823-70921845 GGTGTTAAGAAAACAAAATTTGG - Intergenic
1043142648 8:76609060-76609082 GGTATTTAGAAATCAAGTTCTGG - Intergenic
1043160217 8:76837606-76837628 TGGGTTTAGAAAGCAAAATTTGG - Intronic
1043371742 8:79602391-79602413 GGTATTTCAAAAACAAAATCTGG + Intergenic
1043432019 8:80204451-80204473 GGTATTTAGAAACCAAGATCTGG - Intronic
1043852183 8:85227956-85227978 GATACTTAGAAACCAAGATCTGG + Intronic
1043853475 8:85240045-85240067 GGTGTTTAGGAAACAAGATCTGG + Intronic
1044499339 8:92933024-92933046 GTTTTTTAGAAAGCAAGATCTGG + Intronic
1045175034 8:99713702-99713724 GGTATCTAGAAACCAAAATCTGG - Intronic
1045273930 8:100684743-100684765 GGCATTTAGAAGCCAATATCTGG - Intergenic
1045346196 8:101295657-101295679 GGTGTTTAAAATTCAAAATTTGG + Intergenic
1045415222 8:101959790-101959812 GGTATTTAGGAACCAACATCTGG + Intronic
1045965996 8:108025216-108025238 GGTATTTAGAAAACAAAATCTGG - Intronic
1046129106 8:109945522-109945544 TGGTTTTAGAAACCAAGATCTGG + Intergenic
1046455909 8:114460707-114460729 GGTATTTAGGAACCAATATCTGG + Intergenic
1046895929 8:119473374-119473396 GGTATTTTGAAACCAAAATCTGG - Intergenic
1046966554 8:120173449-120173471 AGTATTTTGAAACCAAAATATGG + Intronic
1047331656 8:123894638-123894660 TGCATTTAGAAACCAAGATCTGG - Intronic
1047380104 8:124353561-124353583 AGTATTTAGAAACCAAGATCTGG - Intronic
1047467387 8:125130575-125130597 GGTATTGAGAAACCAAGATCTGG + Intronic
1047542727 8:125785936-125785958 AGTGTTGATAAACCAAAATGTGG + Intergenic
1047583795 8:126246422-126246444 GGTATTTAGAAACCAAGACCTGG + Intergenic
1048051092 8:130817387-130817409 GATATTTAGAAACCACAATCTGG - Intronic
1048226843 8:132595922-132595944 GGTGTTAAGAAACTGAATTCAGG + Intronic
1048341445 8:133542204-133542226 GGTGTTTAGAAACCAAGATCTGG - Intronic
1048414800 8:134214467-134214489 GATATTTACAAACCACAATCTGG + Intergenic
1048555110 8:135468348-135468370 GTTGTTTAGAAGCCAAGATCTGG + Intronic
1049077542 8:140411234-140411256 GGTATTTAGAAACCAAGGTCTGG - Intronic
1049805945 8:144539107-144539129 GGTATTTAGAAACCAAGATCTGG + Intronic
1049864684 8:144926857-144926879 AGTTTTTAGAAAACAAGATCTGG - Intergenic
1050981437 9:12020790-12020812 GCTGATTAGAAAAAAAAATCTGG - Intergenic
1051279948 9:15432391-15432413 GGTGTTTAGAGACCAGTATCTGG - Intronic
1051505920 9:17827733-17827755 GGTATTTAGAAACTAAGATCTGG + Intergenic
1051587787 9:18745557-18745579 GGTATTTAGAACCCAAGATCTGG + Intronic
1051733042 9:20167558-20167580 GGTATTTAGAAACCAAGATTTGG - Intergenic
1051765398 9:20517368-20517390 TGTATTTAGAAACCTCAATCTGG - Intronic
1052264125 9:26551928-26551950 GGAATTTAGAAACCACCATCTGG - Intergenic
1052825827 9:33173679-33173701 GGTGTTTAGAAACCAAGACTTGG - Intergenic
1053127986 9:35598519-35598541 GGTGTTTGGATACCACAACCTGG - Intergenic
1053184075 9:36000264-36000286 GGTATTTAGAAGTCATAATCTGG - Intergenic
1053326187 9:37153810-37153832 TGATATTAGAAACCAAAATCTGG + Intronic
1055688600 9:78805517-78805539 GATAGTTAGAGACCAAAATCTGG + Intergenic
1056339321 9:85609579-85609601 GATGTTTAAAAACCAAGATCTGG - Intronic
1057014543 9:91639927-91639949 GGTATTTAAATACCAAGATCTGG - Intronic
1057053456 9:91943268-91943290 AGTATTGAGAAACCAACATCTGG + Intronic
1057665947 9:97045670-97045692 AGTTTTTAGAAAGCAAATTCTGG - Intergenic
1057735738 9:97658085-97658107 GGTATTTAGGAGCCAAGATCTGG + Intronic
1057746338 9:97754816-97754838 GGTATTTAGGAACCAAGATTTGG + Intergenic
1057850269 9:98561349-98561371 TGTGTTAAGAAACCAACATTTGG - Intronic
1057876449 9:98758474-98758496 GGTATTTAGAAACCAAAATCTGG + Intronic
1058041974 9:100312574-100312596 GGTATTTAGAAACCAACATGTGG - Intronic
1058441759 9:105015243-105015265 GGTATTTAGAAACCAAGTTCTGG + Intergenic
1058482605 9:105412504-105412526 GGTATTTGGAAACCAAGGTCTGG + Intronic
1058790501 9:108439914-108439936 GGAGTTTAGAGGCCAAGATCTGG - Intergenic
1059088503 9:111331187-111331209 GGTGTTTAGAAACTAATATCTGG - Intergenic
1059192823 9:112342997-112343019 GGTGTCTAGAAACTAAGATATGG - Intergenic
1060030249 9:120208578-120208600 GGTATTTAGAAACCAAGAGGTGG - Intergenic
1060054044 9:120398093-120398115 GGTATCTAGAAACCATAATTTGG + Intronic
1060257890 9:122048466-122048488 TGTGTTTAAAAATAAAAATCTGG - Intronic
1060444283 9:123673564-123673586 GGTATTTAGAAACCAAGATCTGG + Intronic
1060445321 9:123681811-123681833 AGTATTTAGAAACCAATATCTGG - Intronic
1060849617 9:126862868-126862890 GTTGTTTACCAACAAAAATCAGG - Intronic
1060864526 9:126984853-126984875 AATATTTAGAAACCATAATCTGG + Intronic
1061021217 9:128016155-128016177 GGCATTTAGAAACTAAAATCTGG - Intergenic
1061600222 9:131664302-131664324 GGTATTTAGAAACCAAGATCGGG + Intronic
1061791188 9:133060009-133060031 GGTGTTTAGAGACCCCAGTCTGG + Intergenic
1061793858 9:133072130-133072152 GGTGTTTAGAGACCCCAATCTGG + Intronic
1061960390 9:133985581-133985603 GGTATTTAGAAGGCAAGATCAGG - Intronic
1185703211 X:2247248-2247270 GAGGTTTAGAAACCAATACCAGG - Intronic
1186400539 X:9254894-9254916 GGGATTTAGAAAACAAGATCTGG - Intergenic
1186491183 X:9973950-9973972 GGGATTTAGAAACCACAATTTGG + Intergenic
1187317416 X:18208891-18208913 GGTATTTAGAAACCGAGATCTGG - Intronic
1187864333 X:23710290-23710312 GGTATTTAGACATCAAAATCTGG - Intronic
1188219177 X:27518947-27518969 GGTGCATAAAAAACAAAATCAGG - Intergenic
1188224732 X:27583415-27583437 GGTGTTTAGAAACCAAGATCTGG + Intergenic
1188666170 X:32823864-32823886 TGTGTTTGGAAATGAAAATCTGG + Intronic
1188769591 X:34135851-34135873 GGTATTTAGAAACCAAGATTTGG - Intergenic
1188796087 X:34467631-34467653 GGTATTTAGAAACCAAGATCTGG - Intergenic
1188834460 X:34939584-34939606 GGTATTTAGAAACCAAGATCTGG + Intergenic
1189006887 X:37005469-37005491 TGTATTTAGAAACCAAGATCTGG + Intergenic
1189041687 X:37548189-37548211 GGTATTTAGAAACCAAGATCTGG - Intronic
1189314823 X:40047638-40047660 GGTATTTAGAAACCATAGGCTGG + Intergenic
1189454729 X:41175637-41175659 GGTGTTTAGAAACCAAGATCTGG + Intronic
1189844359 X:45119448-45119470 GATATTTAGAAACCAAGGTCTGG + Intergenic
1189961853 X:46332029-46332051 GGTATTTAGAAACCAAGATCTGG + Intergenic
1190124298 X:47689865-47689887 GGTATTGAGAAGCCAAGATCTGG + Intergenic
1190155402 X:47987796-47987818 TATATTTAGAAACCAAAATCTGG - Intronic
1190379113 X:49821222-49821244 GGTATTTAGAAACTAAGATCTGG - Intergenic
1190605909 X:52141939-52141961 GGTATTTAGAAGTCAAGATCGGG - Intergenic
1190933982 X:54977695-54977717 GGTATTTGGAAACCAAGATCTGG - Intronic
1192348543 X:70334199-70334221 TGTGTTTAGAAGCCAAGATTTGG + Intronic
1192625550 X:72723635-72723657 GGTGTTTGGAAATAAAAATCTGG + Intergenic
1193109498 X:77713376-77713398 AGTGTTTAGAAATCAAGATCAGG - Intronic
1194060380 X:89189364-89189386 GGCATTTAGAAAGCAAGATCTGG - Intergenic
1194202265 X:90967426-90967448 GGTGTTTTGAAACTGATATCTGG + Intergenic
1194789895 X:98134844-98134866 GGTATTTAGAAACCAAGATCTGG - Intergenic
1194897798 X:99467592-99467614 GGCATTTAGAAACCAAGATCTGG + Intergenic
1195013314 X:100753893-100753915 GGTATTTAGAAACTGAGATCTGG - Intergenic
1195039538 X:101001535-101001557 GGTGTTTAGAAACCAAGATCCGG - Intergenic
1195631468 X:107059911-107059933 GACTTTTAGAAACCAAGATCTGG - Intergenic
1195779421 X:108444605-108444627 GGTATGTAGAAGCCAAGATCTGG + Intronic
1196388564 X:115186398-115186420 GGTATTAAGAAACCAGATTCTGG - Intronic
1197240218 X:124115425-124115447 GGTATTTAGAAGCCAGAATTTGG + Intronic
1197365174 X:125555661-125555683 AGTATTTAGAAATCAAGATCTGG + Intergenic
1197500384 X:127233710-127233732 AGTGTTTAAAAACTAAAATAAGG + Intergenic
1197579903 X:128269565-128269587 GGTATTTAGGGACCAAGATCTGG - Intergenic
1197895770 X:131312879-131312901 AGTGTTTAGAAACCAAGATCTGG - Intronic
1198065397 X:133091482-133091504 GGTGTTAAAAAGTCAAAATCAGG + Intronic
1199015915 X:142814944-142814966 GGTATTTAGAAACCAATGTCTGG + Intergenic
1199123972 X:144091887-144091909 GGTGATTATAAACAAATATCAGG + Intergenic
1199498594 X:148483765-148483787 GGAGTTTCGAGACCAAGATCTGG - Intergenic
1199509494 X:148605512-148605534 GGTATTTAGAAATTAAGATCTGG - Intronic
1199588599 X:149442933-149442955 GGTATTTTGAAATCAAAATCTGG - Intergenic
1199689285 X:150295717-150295739 GGTATTTAGAAATCAAGATCTGG + Intergenic
1199701379 X:150378957-150378979 GGTATTTAAAAACTAAGATCTGG + Intronic
1199842315 X:151662472-151662494 GGTATTTAGAAACGAAGATCTGG + Intronic
1199920982 X:152403864-152403886 GGTTTTGAAAAACCAAGATCCGG + Intronic
1200170680 X:154071714-154071736 GGTATTTAGAATCCAACATGTGG - Intronic
1200548101 Y:4542880-4542902 GGTGTTTTGAAACTGATATCTGG + Intergenic
1201481011 Y:14439663-14439685 GATGTATAGAAGCCAAACTCTGG + Intergenic