ID: 1015799585

View in Genome Browser
Species Human (GRCh38)
Location 6:137046599-137046621
Sequence CTTTATAATGGGAGGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015799576_1015799585 -8 Left 1015799576 6:137046584-137046606 CCTAGGTTCCATGCTCTTTATAA No data
Right 1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG No data
1015799574_1015799585 10 Left 1015799574 6:137046566-137046588 CCACACAAGGCGGTGGGTCCTAG No data
Right 1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG No data
1015799569_1015799585 28 Left 1015799569 6:137046548-137046570 CCAGTGGTGTGTGGACTTCCACA No data
Right 1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015799585 Original CRISPR CTTTATAATGGGAGGGGGGA AGG Intergenic
No off target data available for this crispr