ID: 1015803326

View in Genome Browser
Species Human (GRCh38)
Location 6:137082816-137082838
Sequence CTGTAGGTAAGCAGATGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015803326_1015803331 16 Left 1015803326 6:137082816-137082838 CCTGACCATCTGCTTACCTACAG No data
Right 1015803331 6:137082855-137082877 TAATGGCCCTGCGCAAATCTAGG No data
1015803326_1015803330 -1 Left 1015803326 6:137082816-137082838 CCTGACCATCTGCTTACCTACAG No data
Right 1015803330 6:137082838-137082860 GGAATTACAATCACATGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015803326 Original CRISPR CTGTAGGTAAGCAGATGGTC AGG (reversed) Intergenic
No off target data available for this crispr