ID: 1015804263

View in Genome Browser
Species Human (GRCh38)
Location 6:137092508-137092530
Sequence TGTAACAAAGCACCACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015804254_1015804263 30 Left 1015804254 6:137092455-137092477 CCCACCTGGTGGCTCTGAGATCT No data
Right 1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG No data
1015804256_1015804263 26 Left 1015804256 6:137092459-137092481 CCTGGTGGCTCTGAGATCTTAGC No data
Right 1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG No data
1015804261_1015804263 -8 Left 1015804261 6:137092493-137092515 CCTTCCTGGGGCTGCTGTAACAA No data
Right 1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG No data
1015804255_1015804263 29 Left 1015804255 6:137092456-137092478 CCACCTGGTGGCTCTGAGATCTT No data
Right 1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG No data
1015804259_1015804263 4 Left 1015804259 6:137092481-137092503 CCAAGCACTGTACCTTCCTGGGG No data
Right 1015804263 6:137092508-137092530 TGTAACAAAGCACCACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015804263 Original CRISPR TGTAACAAAGCACCACAAGT TGG Intergenic
No off target data available for this crispr