ID: 1015806908

View in Genome Browser
Species Human (GRCh38)
Location 6:137118937-137118959
Sequence CTTATTACTCCCCTTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015806908_1015806913 23 Left 1015806908 6:137118937-137118959 CCTCCCTCAAGGGGAGTAATAAG No data
Right 1015806913 6:137118983-137119005 GACTAGTTATTTGCTGAAGAGGG No data
1015806908_1015806915 27 Left 1015806908 6:137118937-137118959 CCTCCCTCAAGGGGAGTAATAAG No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data
1015806908_1015806914 26 Left 1015806908 6:137118937-137118959 CCTCCCTCAAGGGGAGTAATAAG No data
Right 1015806914 6:137118986-137119008 TAGTTATTTGCTGAAGAGGGTGG No data
1015806908_1015806912 22 Left 1015806908 6:137118937-137118959 CCTCCCTCAAGGGGAGTAATAAG No data
Right 1015806912 6:137118982-137119004 AGACTAGTTATTTGCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015806908 Original CRISPR CTTATTACTCCCCTTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr