ID: 1015806911

View in Genome Browser
Species Human (GRCh38)
Location 6:137118974-137118996
Sequence GCAAATAACTAGTCTCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015806911_1015806916 10 Left 1015806911 6:137118974-137118996 CCAGAATGAGACTAGTTATTTGC No data
Right 1015806916 6:137119007-137119029 GGGATTTTAGTCCAAAACCTTGG No data
1015806911_1015806915 -10 Left 1015806911 6:137118974-137118996 CCAGAATGAGACTAGTTATTTGC No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data
1015806911_1015806917 19 Left 1015806911 6:137118974-137118996 CCAGAATGAGACTAGTTATTTGC No data
Right 1015806917 6:137119016-137119038 GTCCAAAACCTTGGAAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015806911 Original CRISPR GCAAATAACTAGTCTCATTC TGG (reversed) Intergenic
No off target data available for this crispr