ID: 1015806915

View in Genome Browser
Species Human (GRCh38)
Location 6:137118987-137119009
Sequence AGTTATTTGCTGAAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015806908_1015806915 27 Left 1015806908 6:137118937-137118959 CCTCCCTCAAGGGGAGTAATAAG No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data
1015806910_1015806915 23 Left 1015806910 6:137118941-137118963 CCTCAAGGGGAGTAATAAGACAG No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data
1015806909_1015806915 24 Left 1015806909 6:137118940-137118962 CCCTCAAGGGGAGTAATAAGACA No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data
1015806911_1015806915 -10 Left 1015806911 6:137118974-137118996 CCAGAATGAGACTAGTTATTTGC No data
Right 1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015806915 Original CRISPR AGTTATTTGCTGAAGAGGGT GGG Intergenic
No off target data available for this crispr