ID: 1015806968

View in Genome Browser
Species Human (GRCh38)
Location 6:137119458-137119480
Sequence TCCCAAGGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015806968_1015806973 8 Left 1015806968 6:137119458-137119480 CCAGCACTCCCTCAACCTTGGGA No data
Right 1015806973 6:137119489-137119511 ACAAATTTTCCTTTCTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015806968 Original CRISPR TCCCAAGGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr