ID: 1015810386

View in Genome Browser
Species Human (GRCh38)
Location 6:137156637-137156659
Sequence GAATCCATTCCTGTCTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015810386_1015810391 -10 Left 1015810386 6:137156637-137156659 CCCTTAGAGACAGGAATGGATTC 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1015810391 6:137156650-137156672 GAATGGATTCAGGTATTCTGGGG 0: 1
1: 0
2: 2
3: 18
4: 191
1015810386_1015810392 12 Left 1015810386 6:137156637-137156659 CCCTTAGAGACAGGAATGGATTC 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1015810392 6:137156672-137156694 GTCTGAAATTTATACAATCTTGG 0: 1
1: 0
2: 2
3: 19
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015810386 Original CRISPR GAATCCATTCCTGTCTCTAA GGG (reversed) Intronic